Homologs in group_2596

Help

5 homologs were identified in 5 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_03170 FBDBKF_03170 100.0 Morganella morganii S1 tauC taurine ABC transporter permease TauC
EHELCC_07365 EHELCC_07365 100.0 Morganella morganii S2 tauC taurine ABC transporter permease TauC
LHKJJB_07225 LHKJJB_07225 100.0 Morganella morganii S3 tauC taurine ABC transporter permease TauC
HKOGLL_03705 HKOGLL_03705 100.0 Morganella morganii S5 tauC taurine ABC transporter permease TauC
F4V73_RS11750 F4V73_RS11750 84.5 Morganella psychrotolerans tauC taurine ABC transporter permease TauC

Distribution of the homologs in the orthogroup group_2596

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2596

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q47539 4.62e-99 293 61 1 257 3 tauC Taurine transport system permease protein TauC Escherichia coli (strain K12)
Q8YDR8 1.68e-41 145 34 2 252 3 BMEII0107 Probable ABC transporter permease protein BMEII0107 Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q2YJB4 1.91e-41 145 35 2 250 3 BAB2_1148 Probable ABC transporter permease protein BAB2_1148 Brucella abortus (strain 2308)
Q576D9 1.91e-41 145 35 2 250 3 BruAb2_1124 Probable ABC transporter permease protein BruAb2_1124 Brucella abortus biovar 1 (strain 9-941)
Q8FUN2 7.95e-41 144 35 2 250 3 BRA1188 Probable ABC transporter permease protein BRA1188/BS1330_II1179 Brucella suis biovar 1 (strain 1330)
P40401 1.54e-37 136 38 1 238 2 ssuC Putative aliphatic sulfonates transport permease protein SsuC Bacillus subtilis (strain 168)
Q57856 8.1e-36 131 31 1 250 3 MJ0413 Putative ABC transporter permease protein MJ0413 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P75851 2.83e-33 124 34 1 232 1 ssuC Putative aliphatic sulfonates transport permease protein SsuC Escherichia coli (strain K12)
P73451 2.52e-27 109 28 3 274 3 nrtB Nitrate import permease protein NrtB Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
A9WGD1 2.55e-27 109 33 1 218 1 ribX Riboflavin transport system permease protein RibX Chloroflexus aurantiacus (strain ATCC 29366 / DSM 635 / J-10-fl)
Q51881 3.94e-26 106 32 1 201 3 nrtB Nitrate import permease protein NrtB Phormidium laminosum
Q5MZ55 1.2e-25 105 31 2 201 3 cmpB Bicarbonate transport system permease protein CmpB Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q55106 1.2e-25 105 31 2 201 1 cmpB Bicarbonate transport system permease protein CmpB Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q55461 3.52e-24 101 30 2 204 2 cmpB Bicarbonate transport system permease protein CmpB Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P38044 4.12e-24 101 26 3 263 1 nrtB Nitrate import permease protein NrtB Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q9K9G6 1.02e-20 91 27 3 236 3 thiX Formylaminopyrimidine transport permease protein ThiX Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
O34649 5.69e-17 81 23 2 220 3 ytlD Uncharacterized ABC transporter permease protein YtlD Bacillus subtilis (strain 168)
E0SCY2 9.42e-17 82 33 1 181 1 ousW Glycine betaine/choline transport system permease protein OusW Dickeya dadantii (strain 3937)
O34742 2.04e-16 79 29 3 208 1 opuCD Glycine betaine/carnitine/choline transport system permease protein OpuCD Bacillus subtilis (strain 168)
Q57306 8.13e-16 77 25 1 245 3 HI_0355 Probable ABC transporter permease protein HI_0355 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9KHT8 9.03e-15 74 27 4 201 1 opuCB Carnitine transport permease protein OpuCB Listeria monocytogenes
G2JZ43 9.03e-15 74 27 4 201 1 opuCB Carnitine transport permease protein OpuCB Listeria monocytogenes serotype 1/2a (strain 10403S)
P39775 1.48e-14 73 30 2 186 2 opuBD Choline transport system permease protein OpuBD Bacillus subtilis (strain 168)
P46921 3.06e-14 74 28 4 203 1 opuAB Glycine betaine transport system permease protein OpuAB Bacillus subtilis (strain 168)
Q9KHT6 7.18e-14 72 27 3 210 1 opuCD Carnitine transport permease protein OpuCD Listeria monocytogenes
G2JZ41 7.18e-14 72 27 3 210 1 opuCD Carnitine transport permease protein OpuCD Listeria monocytogenes serotype 1/2a (strain 10403S)
Q8ZPK1 8e-14 72 28 4 191 1 osmY Osmoprotectant import permease protein OsmY Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P14176 1.82e-13 72 31 3 183 1 proW Glycine betaine/proline betaine transport system permease protein ProW Escherichia coli (strain K12)
P17327 2.45e-13 72 31 3 183 2 proW Glycine betaine/proline betaine transport system permease protein ProW Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q9RR45 6.62e-11 64 29 1 161 1 gbuB Glycine betaine/carnitine transport permease protein GbuB Listeria monocytogenes serotype 1/2a (strain 10403S)
A0A0H2XK79 3e-10 63 32 3 157 3 egtUBC Probable ergothioneine transporter EgtUBC Staphylococcus aureus (strain USA300)
Q4FL38 4.07e-10 63 26 1 181 1 tmoV Trimethylamine N-oxide transport system permease protein TmoV Pelagibacter ubique (strain HTCC1062)
Q4FL38 0.000792 44 17 1 199 1 tmoV Trimethylamine N-oxide transport system permease protein TmoV Pelagibacter ubique (strain HTCC1062)
Q45461 6.37e-10 60 26 5 210 2 opuBB Choline transport system permease protein OpuBB Bacillus subtilis (strain 168)
O34878 1.1e-07 54 25 4 194 1 opuCB Glycine betaine/carnitine/choline transport system permease protein OpuCB Bacillus subtilis (strain 168)
Q5LT64 4.41e-07 54 24 0 148 1 tmoV Trimethylamine N-oxide transport system permease protein TmoV Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q5LT64 4.09e-05 48 26 0 128 1 tmoV Trimethylamine N-oxide transport system permease protein TmoV Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
P33359 1.3e-06 51 29 2 178 1 yehW Glycine betaine uptake system permease protein YehW Escherichia coli (strain K12)
Q8Y775 4.35e-06 51 28 6 196 1 egtUBC Probable ergothioneine transporter EgtUBC Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
B5Z7I3 4.6e-06 50 31 0 116 1 egtU Ergothioneine transport permease/ergothioneine binding protein EgtU Helicobacter pylori (strain G27)
Q9KTJ6 5.18e-05 47 32 4 125 3 metI Probable D-methionine transport system permease protein MetI Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q8ZPK3 8.12e-05 46 26 5 212 1 osmW Osmoprotectant import permease protein OsmW Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)

  • Number of RefSeq hits:

General

Source Morganella morganii S4
Locus tag NLDBIP_07690
Feature type CDS
Gene tauC
Product taurine ABC transporter permease TauC
Location 208183 - 208980 (strand: -1)
Length 798 (nucleotides) / 265 (amino acids)

Contig

Accession ZDB_522
Length 269640 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2596
Orthogroup size 6
N. genomes 6

Actions

Genomic region

Domains

PF00528 Binding-protein-dependent transport system inner membrane component

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0600 Inorganic ion transport and metabolism (P) P ABC-type nitrate/sulfonate/bicarbonate transport system, permease component

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K15552 taurine transport system permease protein Sulfur metabolism
ABC transporters		 -

Protein Sequence

MADITGNKQPRHSRLLLSIVSLSVLITGWWLITAFQWVNPLYLPAPSQIGHQFLALSESGYMNATLWQHLAASLDRMLKALLLAVITGIPLGVLMGLSSRIRGILDPVVELYRPVPPLAYLPLIVIWFGIGETTKILLIWLAILAPVLISTMQGIMAAPGNRIRAVQSLGANRLQVLRYVILPSALPQILTGIRIGLGVGWSTLVAAELVAAQQGLGFMVQSAAQFLNTGIVITGIAVIAVVALAIELALRHLQQALVPWYGKES

Flanking regions ( +/- flanking 50bp)

AAAATAATGGCGTATCAGCGTGGTTAATTAACGGACACGGAGTGACATCAATGGCAGATATAACCGGAAATAAACAACCCCGCCACAGCCGTTTATTACTCAGCATTGTGAGTTTATCCGTGCTGATTACCGGCTGGTGGCTGATCACCGCATTTCAGTGGGTTAATCCGCTCTATTTACCCGCCCCGTCTCAGATAGGACACCAGTTTCTGGCGTTATCCGAATCCGGTTACATGAATGCCACGCTGTGGCAGCACCTGGCGGCCAGCCTGGATCGCATGCTCAAAGCGCTGCTTCTGGCGGTTATCACCGGGATCCCGCTGGGGGTACTGATGGGACTGAGTTCACGGATACGCGGAATACTGGATCCGGTGGTTGAACTGTACCGCCCGGTTCCCCCGCTCGCCTATCTGCCGCTGATCGTTATCTGGTTCGGGATCGGGGAAACCACCAAGATCCTGCTGATCTGGTTAGCGATTCTCGCCCCGGTCCTGATTTCAACGATGCAGGGCATTATGGCCGCGCCGGGAAACCGGATCCGCGCCGTGCAGTCCCTGGGGGCAAACCGGCTTCAGGTGCTGAGATATGTGATCCTGCCGTCAGCACTGCCGCAGATACTGACCGGGATCCGGATTGGCCTCGGCGTGGGCTGGTCAACCCTGGTGGCGGCAGAGCTGGTCGCGGCACAGCAGGGACTGGGGTTTATGGTGCAGTCCGCCGCGCAGTTTCTTAACACCGGTATTGTCATCACCGGTATCGCAGTGATTGCCGTGGTGGCACTCGCCATCGAACTGGCATTACGTCATTTGCAGCAGGCATTAGTGCCGTGGTACGGCAAAGAATCTTAACCGACAGAGAGATAATGAATATGGATATCAGACAGTTAACACCCGCTATC