Homologs in group_1779

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_12975 FBDBKF_12975 100.0 Morganella morganii S1 cnoX Chaperedoxin CnoX, contains thioredoxin-like and TPR-like domains, YbbN/TrxSC family
EHELCC_06290 EHELCC_06290 100.0 Morganella morganii S2 cnoX Chaperedoxin CnoX, contains thioredoxin-like and TPR-like domains, YbbN/TrxSC family
LHKJJB_03490 LHKJJB_03490 100.0 Morganella morganii S3 cnoX Chaperedoxin CnoX, contains thioredoxin-like and TPR-like domains, YbbN/TrxSC family
HKOGLL_06965 HKOGLL_06965 100.0 Morganella morganii S5 cnoX Chaperedoxin CnoX, contains thioredoxin-like and TPR-like domains, YbbN/TrxSC family
F4V73_RS16160 F4V73_RS16160 88.4 Morganella psychrotolerans - co-chaperone YbbN
PMI_RS10690 PMI_RS10690 61.1 Proteus mirabilis HI4320 - co-chaperone YbbN

Distribution of the homologs in the orthogroup group_1779

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1779

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P77395 1.09e-120 349 58 0 284 1 cnoX Chaperedoxin Escherichia coli (strain K12)
P43786 8.41e-66 207 46 2 218 1 HI_1159 Uncharacterized protein HI_1159 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q17424 1.04e-12 67 33 2 110 3 trx-2 Probable thioredoxin-2 Caenorhabditis elegans
P64808 1.92e-12 69 31 3 156 3 BQ2027_MB1359 Uncharacterized protein Mb1359 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WG61 1.92e-12 69 31 3 156 1 Rv1324 Uncharacterized protein Rv1324 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WG60 1.92e-12 69 31 3 156 3 MT1366 Uncharacterized protein MT1366 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P12243 2.78e-11 62 32 2 107 3 trxA Thioredoxin 1 Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q7M1B9 2.78e-11 62 32 1 106 1 trxA Thioredoxin Chloroflexus aurantiacus (strain ATCC 29366 / DSM 635 / J-10-fl)
P0A4L2 7.01e-11 61 31 2 111 1 trxA Thioredoxin 1 Nostoc sp. (strain ATCC 29151 / PCC 7119)
P0A4L1 7.01e-11 61 31 2 111 3 trxA Thioredoxin 1 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
P50338 2.13e-10 60 29 1 107 3 trxA Thioredoxin Griffithsia pacifica
P10472 2.15e-10 60 35 2 90 1 trxA Thioredoxin Chlorobaculum thiosulfatiphilum
Q8KE49 3.18e-10 59 34 2 90 3 trx2 Thioredoxin 2 Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
Q95108 1.44e-09 59 35 0 88 1 TXN2 Thioredoxin, mitochondrial Bos taurus
P0A0K5 1.58e-09 57 30 2 105 3 trxA Thioredoxin Staphylococcus aureus (strain MW2)
P0A0K6 1.58e-09 57 30 2 105 1 trxA Thioredoxin Staphylococcus aureus
Q6GA69 1.58e-09 57 30 2 105 3 trxA Thioredoxin Staphylococcus aureus (strain MSSA476)
Q6GHU0 1.58e-09 57 30 2 105 3 trxA Thioredoxin Staphylococcus aureus (strain MRSA252)
P99122 1.58e-09 57 30 2 105 1 trxA Thioredoxin Staphylococcus aureus (strain N315)
P0A0K4 1.58e-09 57 30 2 105 3 trxA Thioredoxin Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HGT9 1.58e-09 57 30 2 105 3 trxA Thioredoxin Staphylococcus aureus (strain COL)
Q2YXD0 1.58e-09 57 30 2 105 3 trxA Thioredoxin Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q2FZD2 1.58e-09 57 30 2 105 2 trxA Thioredoxin Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FHT6 1.58e-09 57 30 2 105 3 trxA Thioredoxin Staphylococcus aureus (strain USA300)
Q41864 1.91e-09 58 25 0 93 2 TRM1 Thioredoxin M-type, chloroplastic Zea mays
P07591 3.34e-09 58 26 2 106 1 None Thioredoxin M-type, chloroplastic Spinacia oleracea
P97493 3.81e-09 58 34 0 88 1 Txn2 Thioredoxin, mitochondrial Mus musculus
Q4L5F0 4.5e-09 56 29 2 105 3 trxA Thioredoxin Staphylococcus haemolyticus (strain JCSC1435)
Q9SEU6 4.52e-09 58 30 1 95 2 At3g15360 Thioredoxin M4, chloroplastic Arabidopsis thaliana
P0AGG7 5.03e-09 57 34 0 73 3 trxC Thioredoxin 2 Shigella flexneri
P0AGG4 5.03e-09 57 34 0 73 1 trxC Thioredoxin 2 Escherichia coli (strain K12)
P0AGG5 5.03e-09 57 34 0 73 3 trxC Thioredoxin 2 Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AGG6 5.03e-09 57 34 0 73 3 trxC Thioredoxin 2 Escherichia coli O157:H7
Q99757 5.21e-09 57 34 0 88 1 TXN2 Thioredoxin, mitochondrial Homo sapiens
P97615 5.75e-09 57 34 0 88 2 Txn2 Thioredoxin, mitochondrial Rattus norvegicus
Q6H7E4 6.8e-09 57 25 1 106 2 Os02g0639900 Thioredoxin M1, chloroplastic Oryza sativa subsp. japonica
P33791 6.88e-09 55 31 1 86 3 trxA Thioredoxin (Fragment) Kitasatospora aureofaciens
P43785 6.97e-09 55 26 1 98 3 trxA Thioredoxin Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
O83889 7.28e-09 55 29 2 85 3 trxA Thioredoxin Treponema pallidum (strain Nichols)
Q9CM49 9.09e-09 55 30 2 102 3 trxA Thioredoxin Pasteurella multocida (strain Pm70)
P08058 1.21e-08 55 27 2 111 1 trxA Thioredoxin Cereibacter sphaeroides
P80579 1.23e-08 55 31 1 102 1 trxA Thioredoxin Alicyclobacillus acidocaldarius subsp. acidocaldarius
P52231 1.61e-08 55 28 0 88 1 trxA Thioredoxin Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q8CPL5 1.61e-08 54 28 2 105 3 trxA Thioredoxin Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HQ29 1.61e-08 54 28 2 105 3 trxA Thioredoxin Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P51225 1.79e-08 54 24 2 107 3 trxA Thioredoxin Porphyra purpurea
P50254 1.81e-08 54 24 2 107 3 trxA Thioredoxin Neopyropia yezoensis
Q49WR2 3.48e-08 53 28 2 105 3 trxA Thioredoxin Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
P00275 4.75e-08 53 33 2 81 1 None Thioredoxin C-1 Corynebacterium nephridii
P23400 4.99e-08 54 26 2 103 1 TRXM Thioredoxin M-type, chloroplastic Chlamydomonas reinhardtii
P37395 5.02e-08 53 27 0 81 3 trxA Thioredoxin Cyanidium caldarium
Q4UNK3 5.3e-08 53 26 1 94 3 trxA Thioredoxin Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q9ZP21 7.46e-08 54 27 1 103 2 None Thioredoxin M-type, chloroplastic Triticum aestivum
P66928 8.37e-08 52 26 2 107 1 trxA Thioredoxin Helicobacter pylori (strain ATCC 700392 / 26695)
P66929 8.37e-08 52 26 2 107 3 trxA Thioredoxin Helicobacter pylori (strain J99 / ATCC 700824)
Q7X8R5 9.49e-08 54 23 1 109 2 Os04g0530600 Thioredoxin M2, chloroplastic Oryza sativa subsp. japonica
P48384 1.46e-07 53 24 1 102 1 None Thioredoxin M-type, chloroplastic Pisum sativum
Q9X2T1 2.3e-07 51 27 1 84 3 trxA Thioredoxin Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9MAU6 2.84e-07 54 27 6 159 2 PDIL2-2 Protein disulfide-isomerase like 2-2 Arabidopsis thaliana
Q9MAU6 3.87e-07 54 25 1 107 2 PDIL2-2 Protein disulfide-isomerase like 2-2 Arabidopsis thaliana
Q92JR5 4.7e-07 50 25 1 94 3 trxA Thioredoxin Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q9ZP20 5.22e-07 52 24 0 90 2 TRXM Thioredoxin M5, chloroplastic Oryza sativa subsp. japonica
P52232 9e-07 50 33 0 71 1 slr0233 Thioredoxin-like protein slr0233 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P9WG67 1.01e-06 50 27 0 88 1 trxA Thioredoxin Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WG66 1.01e-06 50 27 0 88 3 trxA Thioredoxin Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A617 1.01e-06 50 27 0 88 3 trxA Thioredoxin Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q68Y00 1.04e-06 49 25 2 104 3 trxA Thioredoxin Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q9SEU8 2.38e-06 50 28 0 87 1 TRXM2 Thioredoxin M2, chloroplastic Arabidopsis thaliana
Q67UF5 2.42e-06 52 25 1 104 2 PDIL2-3 Protein disulfide isomerase-like 2-3 Oryza sativa subsp. japonica
Q1RKN1 2.45e-06 48 29 0 68 3 trxA Thioredoxin Rickettsia bellii (strain RML369-C)
O48737 2.89e-06 50 27 0 86 1 At1g03680 Thioredoxin M1, chloroplastic Arabidopsis thaliana
O22022 3.34e-06 48 29 1 81 3 trxA Thioredoxin Cyanidioschyzon merolae (strain NIES-3377 / 10D)
Q869Z0 3.81e-06 51 25 3 117 1 DDB_G0275025 Putative protein disulfide-isomerase DDB_G0275025 Dictyostelium discoideum
P59527 3.84e-06 48 25 1 105 3 trxA Thioredoxin Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q39239 5.26e-06 48 27 1 98 1 TRX4 Thioredoxin H4 Arabidopsis thaliana
Q10N04 5.74e-06 48 25 2 85 2 PDIL5-1 Protein disulfide isomerase-like 5-1 Oryza sativa subsp. japonica
P0AA30 6.46e-06 47 30 0 59 3 trxA Thioredoxin 1 Shigella flexneri
P0AA28 6.46e-06 47 30 0 59 1 trxA Thioredoxin 1 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0AA29 6.46e-06 47 30 0 59 1 trxA Thioredoxin 1 Salmonella typhi
P0AA25 6.46e-06 47 30 0 59 1 trxA Thioredoxin 1 Escherichia coli (strain K12)
P0AA26 6.46e-06 47 30 0 59 3 trxA Thioredoxin 1 Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AA27 6.46e-06 47 30 0 59 1 trxA Thioredoxin 1 Escherichia coli O157:H7
O22263 7.35e-06 50 27 3 83 2 PDIL2-1 Protein disulfide-isomerase like 2-1 Arabidopsis thaliana
O48773 8.74e-06 50 26 3 108 2 PDIL2-3 Protein disulfide-isomerase 2-3 Arabidopsis thaliana
O48773 1.59e-05 49 25 6 160 2 PDIL2-3 Protein disulfide-isomerase 2-3 Arabidopsis thaliana
Q9XGS0 1.27e-05 48 26 0 86 1 None Thioredoxin M-type, chloroplastic Brassica napus
P52233 1.36e-05 46 28 1 88 3 trxA Thioredoxin Acidithiobacillus ferridurans
Q9ZEE0 1.36e-05 46 25 2 104 1 trxA Thioredoxin Rickettsia prowazekii (strain Madrid E)
Q498R3 1.43e-05 50 22 2 109 2 Dnajc10 DnaJ homolog subfamily C member 10 Rattus norvegicus
P38658 1.47e-05 49 26 5 113 3 None Probable protein disulfide-isomerase ER-60 Schistosoma mansoni
Q9DC23 1.8e-05 49 23 2 109 1 Dnajc10 DnaJ homolog subfamily C member 10 Mus musculus
Q9SEU7 1.95e-05 47 26 0 78 2 GAT1 Thioredoxin M3, chloroplastic Arabidopsis thaliana
P46843 2.36e-05 48 26 0 88 3 trxB/A Bifunctional thioredoxin reductase/thioredoxin Mycobacterium leprae (strain TN)
Q6NRT6 3.22e-05 48 21 1 105 2 dnajc10 DnaJ homolog subfamily C member 10 Xenopus laevis
Q8IXB1 5.12e-05 48 22 2 109 1 DNAJC10 DnaJ homolog subfamily C member 10 Homo sapiens
Q5R5L3 5.75e-05 48 22 2 109 2 DNAJC10 DnaJ homolog subfamily C member 10 Pongo abelii
Q9DGI3 5.99e-05 44 30 3 80 3 txn Thioredoxin Ictalurus punctatus
Q1RQI9 6.65e-05 44 32 2 70 1 None Thioredoxin (Fragment) Malassezia sympodialis
P52227 9.8e-05 44 31 2 74 3 trxA Thioredoxin Chlamydia caviae (strain ATCC VR-813 / DSM 19441 / 03DC25 / GPIC)
Q0JD42 0.0001 47 30 3 98 2 PDIL5-2 Protein disulfide isomerase-like 5-2 Oryza sativa subsp. japonica
Q92249 0.000101 47 28 5 105 2 erp38 Protein disulfide-isomerase erp38 Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q39362 0.000102 44 28 0 75 2 THL-2 Thioredoxin H-type 2 Brassica napus
Q9PJK3 0.000126 43 29 3 100 3 trxA Thioredoxin Chlamydia muridarum (strain MoPn / Nigg)
Q8TFM8 0.000128 44 30 3 88 1 None Thioredoxin-like protein Fusarium culmorum
P52230 0.000147 43 23 0 86 1 trxA Thioredoxin 1 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q6NPF9 0.000164 45 28 0 71 1 At1g76760 Thioredoxin Y1, chloroplastic Arabidopsis thaliana
Q10057 0.000264 45 21 3 142 3 SPAC1F5.02 Putative protein disulfide-isomerase C1F5.02 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q8BUH1 0.000276 43 27 2 101 2 Txnl4b Thioredoxin-like protein 4B Mus musculus
Q91W90 0.000344 45 28 2 92 1 Txndc5 Thioredoxin domain-containing protein 5 Mus musculus
P57653 0.000357 42 23 1 84 3 trxA Thioredoxin Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
O13704 0.000405 45 20 3 125 4 SPAC13F5.05 Thioredoxin domain-containing protein C13F5.05, mitochondrial Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P47938 0.000409 42 20 2 109 1 dhd Thioredoxin-1 Drosophila melanogaster
P96132 0.000413 42 24 1 83 3 trxA Thioredoxin (Fragment) Thiocapsa roseopersicina
Q9USR1 0.000458 44 32 1 59 4 txl1 Thioredoxin-like protein 1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9NX01 0.000544 43 26 2 101 1 TXNL4B Thioredoxin-like protein 4B Homo sapiens
Q5JMR9 0.0006 43 27 1 77 3 Os01g0963400 Thioredoxin Y, chloroplastic Oryza sativa subsp. japonica

  • Number of RefSeq hits:

General

Source Morganella morganii S4
Locus tag NLDBIP_06610
Feature type CDS
Gene cnoX
Product Chaperedoxin CnoX, contains thioredoxin-like and TPR-like domains, YbbN/TrxSC family
Location 306429 - 307286 (strand: 1)
Length 858 (nucleotides) / 285 (amino acids)

Contig

Accession ZDB_521
Length 325332 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1779
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00085 Thioredoxin
PF14559 Tetratricopeptide repeat
PF14561 Tetratricopeptide repeat

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG3118 Posttranslational modification, protein turnover, chaperones (O) O Chaperedoxin CnoX, contains thioredoxin-like and TPR-like domains, YbbN/TrxSC family

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K05838 putative thioredoxin - -

Protein Sequence

MLSNAHITDVNETNLRQVIESSMQVPVVFFFHSAQSPQCQELGAILEKVAADYAGMMILARVNCDTEQMIASQFGLRAVPTTYLFHQGQPVDGFEGPQNEETVRNFLAKFLPSESEIKTGQAIELIEAGDFQAALPLLREAHQAESNNSEITLLLAQTLMEVKLSEEAEKVLKSVPIQDQDTRYHGLLSQIELQKQAADTPEIQELQNTFAADPENAELAVQLALKLHEVHRNDEALALLFSFLKKDLAAAEGQVRKTMMDIMAAMGTADSTAASYRRKLYSLLY

Flanking regions ( +/- flanking 50bp)

CTGCGCCCAGATGTTAATAGAAAGTCCGCCAATTTATTAAGAGAATGAATATGTTATCAAACGCACATATCACAGACGTTAACGAAACCAATTTACGCCAGGTTATTGAATCTTCAATGCAGGTGCCGGTGGTCTTTTTCTTCCATTCCGCACAGTCCCCGCAGTGTCAGGAACTGGGTGCCATTCTGGAAAAGGTTGCGGCTGATTACGCCGGGATGATGATCCTCGCCAGAGTGAACTGCGATACCGAGCAGATGATCGCCTCACAGTTCGGCCTGCGTGCGGTGCCGACCACCTATCTGTTCCATCAGGGGCAGCCGGTCGACGGTTTTGAGGGGCCGCAGAATGAAGAGACTGTCCGTAATTTCCTGGCAAAATTCCTGCCGTCTGAATCTGAAATCAAAACCGGTCAGGCCATTGAACTGATTGAAGCCGGCGATTTTCAGGCTGCCCTGCCGCTGCTGCGTGAAGCACACCAGGCGGAGAGCAATAACAGCGAAATCACCCTGCTGCTGGCACAGACACTGATGGAAGTGAAGCTGTCAGAAGAAGCTGAAAAAGTATTGAAGTCCGTCCCGATTCAGGATCAGGATACGCGCTATCATGGTCTCTTATCTCAAATTGAGTTACAAAAGCAGGCCGCAGACACCCCGGAAATCCAGGAACTGCAAAATACCTTTGCGGCGGATCCGGAGAATGCAGAGCTCGCGGTACAGCTGGCACTGAAACTGCATGAAGTGCACCGCAATGATGAAGCACTGGCCCTGTTATTCAGCTTCCTGAAGAAGGATCTGGCGGCTGCGGAAGGTCAGGTGCGCAAAACCATGATGGATATTATGGCGGCCATGGGAACCGCAGACAGTACTGCCGCATCTTATCGTCGTAAGCTATACTCGTTACTGTACTAATTAATTGCTTTACTGAATTATTTAACCCACTCATTACTGATAAGGATTTT