Homologs in group_814

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_04080 FBDBKF_04080 100.0 Morganella morganii S1 lysS lysine--tRNA ligase
EHELCC_05370 EHELCC_05370 100.0 Morganella morganii S2 lysS lysine--tRNA ligase
LHKJJB_02570 LHKJJB_02570 100.0 Morganella morganii S3 lysS lysine--tRNA ligase
HKOGLL_06045 HKOGLL_06045 100.0 Morganella morganii S5 lysS lysine--tRNA ligase
F4V73_RS08520 F4V73_RS08520 95.4 Morganella psychrotolerans lysS lysine--tRNA ligase
PMI_RS09900 PMI_RS09900 86.9 Proteus mirabilis HI4320 lysS lysine--tRNA ligase

Distribution of the homologs in the orthogroup group_814

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_814

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B4F0M6 0.0 928 86 1 505 3 lysS Lysine--tRNA ligase Proteus mirabilis (strain HI4320)
Q7N1C8 0.0 915 85 1 505 3 lysS Lysine--tRNA ligase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A1JPL4 0.0 913 86 1 503 3 lysS Lysine--tRNA ligase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
B1JPH6 0.0 904 85 1 503 3 lysS Lysine--tRNA ligase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q666T3 0.0 904 85 1 503 3 lysS Lysine--tRNA ligase Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TIC5 0.0 904 85 1 503 3 lysS Lysine--tRNA ligase Yersinia pestis (strain Pestoides F)
Q1CF16 0.0 904 85 1 503 3 lysS Lysine--tRNA ligase Yersinia pestis bv. Antiqua (strain Nepal516)
A9R4M4 0.0 904 85 1 503 3 lysS Lysine--tRNA ligase Yersinia pestis bv. Antiqua (strain Angola)
Q8ZHK5 0.0 904 85 1 503 3 lysS Lysine--tRNA ligase Yersinia pestis
B2K0N6 0.0 904 85 1 503 3 lysS Lysine--tRNA ligase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1CB23 0.0 904 85 1 503 3 lysS Lysine--tRNA ligase Yersinia pestis bv. Antiqua (strain Antiqua)
A7FF39 0.0 904 85 1 503 3 lysS Lysine--tRNA ligase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q6D945 0.0 882 83 2 504 3 lysS Lysine--tRNA ligase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A8GIP4 0.0 882 84 2 506 3 lysS Lysine--tRNA ligase Serratia proteamaculans (strain 568)
C5BAR6 0.0 874 83 1 493 3 lysS Lysine--tRNA ligase Edwardsiella ictaluri (strain 93-146)
C6D8Z6 0.0 872 84 2 504 3 lysS Lysine--tRNA ligase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q2NRG1 0.0 868 81 1 504 3 lysS Lysine--tRNA ligase Sodalis glossinidius (strain morsitans)
A7MR65 0.0 865 83 2 506 3 lysS Lysine--tRNA ligase Cronobacter sakazakii (strain ATCC BAA-894)
Q0T106 0.0 858 81 1 503 3 lysS Lysine--tRNA ligase Shigella flexneri serotype 5b (strain 8401)
B2U0Q7 0.0 858 81 1 503 3 lysS Lysine--tRNA ligase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B2VF45 0.0 858 81 3 508 3 lysS Lysine--tRNA ligase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
Q83JU6 0.0 858 81 1 503 3 lysS Lysine--tRNA ligase Shigella flexneri
P0A8N3 0.0 858 81 1 503 1 lysS Lysine--tRNA ligase Escherichia coli (strain K12)
P0A8N4 0.0 858 81 1 503 3 lysS Lysine--tRNA ligase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q32BV3 0.0 858 81 1 503 3 lysS Lysine--tRNA ligase Shigella dysenteriae serotype 1 (strain Sd197)
Q31WF2 0.0 857 81 1 503 3 lysS Lysine--tRNA ligase Shigella boydii serotype 4 (strain Sb227)
Q8XD57 0.0 857 81 1 503 3 lysS Lysine--tRNA ligase Escherichia coli O157:H7
A8AP96 0.0 857 81 1 503 3 lysS Lysine--tRNA ligase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
A9MRI4 0.0 855 81 1 503 3 lysS Lysine--tRNA ligase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B4TUQ8 0.0 854 81 1 503 3 lysS Lysine--tRNA ligase Salmonella schwarzengrund (strain CVM19633)
B5BFK5 0.0 854 81 1 503 3 lysS Lysine--tRNA ligase Salmonella paratyphi A (strain AKU_12601)
A9N3L6 0.0 854 81 1 503 3 lysS Lysine--tRNA ligase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PL30 0.0 854 81 1 503 3 lysS Lysine--tRNA ligase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4T535 0.0 854 81 1 503 3 lysS Lysine--tRNA ligase Salmonella newport (strain SL254)
B4TGW0 0.0 854 81 1 503 3 lysS Lysine--tRNA ligase Salmonella heidelberg (strain SL476)
B5RE01 0.0 854 81 1 503 3 lysS Lysine--tRNA ligase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5QXG7 0.0 854 81 1 503 3 lysS Lysine--tRNA ligase Salmonella enteritidis PT4 (strain P125109)
B5FUF3 0.0 854 81 1 503 3 lysS Lysine--tRNA ligase Salmonella dublin (strain CT_02021853)
Q57K76 0.0 854 81 1 503 3 lysS Lysine--tRNA ligase Salmonella choleraesuis (strain SC-B67)
B5F5G4 0.0 854 81 1 503 3 lysS Lysine--tRNA ligase Salmonella agona (strain SL483)
P28354 0.0 854 81 1 503 3 lysS Lysine--tRNA ligase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8Z3X8 0.0 852 81 1 503 3 lysS Lysine--tRNA ligase Salmonella typhi
C0PY12 0.0 851 80 1 503 3 lysS Lysine--tRNA ligase Salmonella paratyphi C (strain RKS4594)
A4WE42 0.0 847 80 2 506 3 lysS Lysine--tRNA ligase Enterobacter sp. (strain 638)
P0A8N5 0.0 840 79 1 503 1 lysU Lysine--tRNA ligase, heat inducible Escherichia coli (strain K12)
P0A8N6 0.0 840 79 1 503 3 lysU Lysine--tRNA ligase, heat inducible Escherichia coli O157:H7
Q8FAT5 0.0 838 79 1 503 3 lysU Lysine--tRNA ligase, heat inducible Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A0KNK7 0.0 741 70 2 502 3 lysS Lysine--tRNA ligase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
A4SJK0 0.0 735 71 2 496 3 lysS Lysine--tRNA ligase Aeromonas salmonicida (strain A449)
B0URW9 0.0 724 69 2 495 3 lysS Lysine--tRNA ligase Histophilus somni (strain 2336)
P57822 0.0 722 69 2 495 3 lysS Lysine--tRNA ligase Pasteurella multocida (strain Pm70)
Q5QYV9 0.0 720 68 2 496 3 lysS Lysine--tRNA ligase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
C4LCP0 0.0 717 69 2 498 3 lysS Lysine--tRNA ligase Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
Q65SB0 0.0 716 68 3 502 3 lysS Lysine--tRNA ligase Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
A5UCQ0 0.0 711 68 2 492 3 lysS Lysine--tRNA ligase Haemophilus influenzae (strain PittEE)
A6VPH6 0.0 711 68 3 504 3 lysS Lysine--tRNA ligase Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
Q4QL88 0.0 708 68 2 492 3 lysS Lysine--tRNA ligase Haemophilus influenzae (strain 86-028NP)
A5UIX4 0.0 707 68 2 492 3 lysS Lysine--tRNA ligase Haemophilus influenzae (strain PittGG)
P43825 0.0 707 69 2 492 3 lysS Lysine--tRNA ligase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
B3H1E8 0.0 706 67 2 502 3 lysS Lysine--tRNA ligase Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
B0BP90 0.0 706 67 2 502 3 lysS Lysine--tRNA ligase Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
A3N0G9 0.0 706 67 2 502 3 lysS Lysine--tRNA ligase Actinobacillus pleuropneumoniae serotype 5b (strain L20)
Q7VLU5 0.0 691 66 1 496 3 lysS Lysine--tRNA ligase Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q1LTU4 0.0 690 62 1 495 3 lysS Lysine--tRNA ligase Baumannia cicadellinicola subsp. Homalodisca coagulata
A1T047 0.0 686 66 2 500 3 lysS Lysine--tRNA ligase Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q493E1 0.0 675 61 3 505 3 lysS Lysine--tRNA ligase Blochmanniella pennsylvanica (strain BPEN)
B8GRJ2 0.0 659 63 2 495 3 lysS Lysine--tRNA ligase Thioalkalivibrio sulfidiphilus (strain HL-EbGR7)
Q5NY31 0.0 642 61 2 502 3 lysS Lysine--tRNA ligase Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
A4XXQ6 0.0 641 64 4 490 3 lysS Lysine--tRNA ligase Pseudomonas mendocina (strain ymp)
Q9HXU0 0.0 640 62 3 500 3 lysS Lysine--tRNA ligase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02RH2 0.0 639 62 3 500 3 lysS Lysine--tRNA ligase Pseudomonas aeruginosa (strain UCBPP-PA14)
B7V0Z5 0.0 639 62 3 500 3 lysS Lysine--tRNA ligase Pseudomonas aeruginosa (strain LESB58)
Q8DEQ9 0.0 638 61 4 500 3 lysS Lysine--tRNA ligase Vibrio vulnificus (strain CMCP6)
Q7MNP6 0.0 637 61 4 500 3 lysS Lysine--tRNA ligase Vibrio vulnificus (strain YJ016)
A6V187 0.0 637 62 3 500 3 lysS Lysine--tRNA ligase Pseudomonas aeruginosa (strain PA7)
Q0HRS5 0.0 636 62 4 503 3 lysS Lysine--tRNA ligase Shewanella sp. (strain MR-7)
Q0HM10 0.0 636 62 4 503 3 lysS Lysine--tRNA ligase Shewanella sp. (strain MR-4)
A0L0F1 0.0 636 62 4 503 3 lysS Lysine--tRNA ligase Shewanella sp. (strain ANA-3)
Q47C53 0.0 636 62 3 503 3 lysS Lysine--tRNA ligase Dechloromonas aromatica (strain RCB)
A1RGF1 0.0 635 62 4 503 3 lysS Lysine--tRNA ligase Shewanella sp. (strain W3-18-1)
A4Y9X9 0.0 635 62 4 503 3 lysS Lysine--tRNA ligase Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
Q2SL47 0.0 634 60 5 513 3 lysS Lysine--tRNA ligase Hahella chejuensis (strain KCTC 2396)
Q8EI58 0.0 632 62 4 503 3 lysS Lysine--tRNA ligase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
B1JD39 0.0 632 62 4 502 3 lysS Lysine--tRNA ligase Pseudomonas putida (strain W619)
Q1IDW1 0.0 630 62 4 498 3 lysS Lysine--tRNA ligase Pseudomonas entomophila (strain L48)
Q9KU60 0.0 630 60 5 509 3 lysS Lysine--tRNA ligase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5W890 0.0 629 62 4 502 3 lysS Lysine--tRNA ligase Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
B0KRL5 0.0 629 62 4 502 3 lysS Lysine--tRNA ligase Pseudomonas putida (strain GB-1)
Q12JH2 0.0 628 61 4 503 3 lysS Lysine--tRNA ligase Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q88MS3 0.0 628 61 4 502 3 lysS Lysine--tRNA ligase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A1AWN8 0.0 627 61 2 490 3 lysS Lysine--tRNA ligase Ruthia magnifica subsp. Calyptogena magnifica
Q1QT66 0.0 627 61 3 495 3 lysS Lysine--tRNA ligase Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
A9AGV1 0.0 624 61 3 496 3 lysS Lysine--tRNA ligase Burkholderia multivorans (strain ATCC 17616 / 249)
A1K5J9 0.0 624 61 3 500 3 lysS Lysine--tRNA ligase Azoarcus sp. (strain BH72)
Q087X1 0.0 624 61 4 503 3 lysS Lysine--tRNA ligase Shewanella frigidimarina (strain NCIMB 400)
B5F9U5 0.0 624 62 4 498 3 lysS Lysine--tRNA ligase Aliivibrio fischeri (strain MJ11)
Q5E7P8 0.0 624 62 4 498 3 lysS Lysine--tRNA ligase Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q4ZWW0 0.0 623 63 3 489 3 lysS Lysine--tRNA ligase Pseudomonas syringae pv. syringae (strain B728a)
A3QB36 0.0 622 60 4 503 3 lysS Lysine--tRNA ligase Shewanella loihica (strain ATCC BAA-1088 / PV-4)
Q886S6 0.0 622 63 3 489 3 lysS Lysine--tRNA ligase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q1H372 0.0 622 61 2 497 3 lysS Lysine--tRNA ligase Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q473I5 0.0 622 60 3 496 3 lysS Lysine--tRNA ligase Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q4KHL4 0.0 622 62 3 489 3 lysS Lysine--tRNA ligase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q48F26 0.0 621 62 3 489 3 lysS Lysine--tRNA ligase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
B2U8U9 0.0 621 61 3 500 3 lysS Lysine--tRNA ligase Ralstonia pickettii (strain 12J)
A9L1I0 0.0 620 61 4 503 3 lysS Lysine--tRNA ligase Shewanella baltica (strain OS195)
A6WS29 0.0 620 61 4 503 3 lysS Lysine--tRNA ligase Shewanella baltica (strain OS185)
A3D0Y5 0.0 620 61 4 503 3 lysS Lysine--tRNA ligase Shewanella baltica (strain OS155 / ATCC BAA-1091)
B0TTP2 0.0 620 60 4 503 3 lysS Lysine--tRNA ligase Shewanella halifaxensis (strain HAW-EB4)
Q3SKD9 0.0 619 61 2 492 3 lysS Lysine--tRNA ligase Thiobacillus denitrificans (strain ATCC 25259)
Q1LPK6 0.0 619 61 4 498 3 lysS Lysine--tRNA ligase Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
A8FRH9 0.0 618 60 4 503 3 lysS Lysine--tRNA ligase Shewanella sediminis (strain HAW-EB3)
Q6LUN2 0.0 618 60 4 503 3 lysS Lysine--tRNA ligase Photobacterium profundum (strain SS9)
Q0BDR2 0.0 617 60 3 496 3 lysS Lysine--tRNA ligase Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
B1YT20 0.0 617 60 3 496 3 lysS Lysine--tRNA ligase Burkholderia ambifaria (strain MC40-6)
A8H0J7 0.0 617 60 4 503 3 lysS Lysine--tRNA ligase Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
Q8Y0L5 0.0 617 60 3 497 3 lysS Lysine--tRNA ligase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q3KHF3 0.0 617 62 3 489 3 lysS Lysine--tRNA ligase Pseudomonas fluorescens (strain Pf0-1)
A7MXL2 0.0 617 61 4 500 3 lysS Lysine--tRNA ligase Vibrio campbellii (strain ATCC BAA-1116)
Q83E97 0.0 617 58 2 494 3 lysS Lysine--tRNA ligase Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
A9NBP7 0.0 617 58 2 494 3 lysS Lysine--tRNA ligase Coxiella burnetii (strain RSA 331 / Henzerling II)
A9KEG1 0.0 617 58 2 494 3 lysS Lysine--tRNA ligase Coxiella burnetii (strain Dugway 5J108-111)
B6J1P6 0.0 617 58 2 494 3 lysS Lysine--tRNA ligase Coxiella burnetii (strain CbuG_Q212)
B6J8K2 0.0 617 58 2 494 3 lysS Lysine--tRNA ligase Coxiella burnetii (strain CbuK_Q154)
B1KFR7 0.0 616 60 4 499 3 lysS Lysine--tRNA ligase Shewanella woodyi (strain ATCC 51908 / MS32)
B8CU98 0.0 616 60 4 503 3 lysS Lysine--tRNA ligase Shewanella piezotolerans (strain WP3 / JCM 13877)
A4JFZ6 0.0 616 60 3 496 3 lysS Lysine--tRNA ligase Burkholderia vietnamiensis (strain G4 / LMG 22486)
Q1BHT1 0.0 616 60 3 494 3 lysS Lysine--tRNA ligase Burkholderia orbicola (strain AU 1054)
B1JUZ7 0.0 616 60 3 494 3 lysS Lysine--tRNA ligase Burkholderia orbicola (strain MC0-3)
A0K8P2 0.0 616 60 3 494 3 lysS Lysine--tRNA ligase Burkholderia cenocepacia (strain HI2424)
B6EMX2 0.0 616 61 4 498 3 lysS Lysine--tRNA ligase Aliivibrio salmonicida (strain LFI1238)
B4EDB2 0.0 615 60 3 494 3 lysS Lysine--tRNA ligase Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
A9IQY2 0.0 615 59 3 503 3 lysS Lysine--tRNA ligase Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
B2JIY1 0.0 614 60 3 494 3 lysS Lysine--tRNA ligase Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
C1DB68 0.0 613 58 1 503 3 lysS Lysine--tRNA ligase Laribacter hongkongensis (strain HLHK9)
P57512 0.0 613 57 1 492 3 lysS Lysine--tRNA ligase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q87SB1 0.0 613 61 4 496 3 lysS Lysine--tRNA ligase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
A1S9M3 0.0 613 60 4 503 3 lysS Lysine--tRNA ligase Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q5WVS0 0.0 613 60 3 482 3 lysS Lysine--tRNA ligase Legionella pneumophila (strain Lens)
Q5X4D5 0.0 612 60 3 482 3 lysS Lysine--tRNA ligase Legionella pneumophila (strain Paris)
Q2SXD6 0.0 612 59 3 502 1 lysS Lysine--tRNA ligase Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q82SH1 0.0 611 58 3 502 3 lysS Lysine--tRNA ligase Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q5ZUL6 0.0 611 60 3 482 3 lysS Lysine--tRNA ligase Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
A5ICT2 0.0 611 60 3 482 3 lysS Lysine--tRNA ligase Legionella pneumophila (strain Corby)
Q0KCG3 0.0 609 58 4 507 3 lysS Lysine--tRNA ligase Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q7WK46 0.0 608 60 3 503 3 lysS Lysine--tRNA ligase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q7NZ62 0.0 608 60 2 503 3 lysS Lysine--tRNA ligase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q3JQP3 0.0 608 59 3 502 3 lysS Lysine--tRNA ligase Burkholderia pseudomallei (strain 1710b)
A3NX27 0.0 607 59 3 502 3 lysS Lysine--tRNA ligase Burkholderia pseudomallei (strain 1106a)
A1V5L6 0.0 607 59 3 502 3 lysS Lysine--tRNA ligase Burkholderia mallei (strain SAVP1)
Q62IZ9 0.0 607 59 3 502 3 lysS Lysine--tRNA ligase Burkholderia mallei (strain ATCC 23344)
A2SAT3 0.0 607 59 3 502 3 lysS Lysine--tRNA ligase Burkholderia mallei (strain NCTC 10229)
A3ML91 0.0 607 59 3 502 3 lysS Lysine--tRNA ligase Burkholderia mallei (strain NCTC 10247)
Q7VZ37 0.0 607 60 3 503 3 lysS Lysine--tRNA ligase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
A3NB96 0.0 607 59 3 502 3 lysS Lysine--tRNA ligase Burkholderia pseudomallei (strain 668)
Q8K9C5 0.0 607 55 2 501 3 lysS Lysine--tRNA ligase Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q63SN9 0.0 606 59 3 502 3 lysS Lysine--tRNA ligase Burkholderia pseudomallei (strain K96243)
Q7W8T6 0.0 606 60 3 503 3 lysS Lysine--tRNA ligase Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
B3R478 0.0 605 59 4 506 3 lysS Lysine--tRNA ligase Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
C5BRM0 0.0 604 60 7 510 3 lysS Lysine--tRNA ligase Teredinibacter turnerae (strain ATCC 39867 / T7901)
Q13WZ5 0.0 600 59 3 494 3 lysS Lysine--tRNA ligase Paraburkholderia xenovorans (strain LB400)
B2SXV7 0.0 599 59 4 498 3 lysS Lysine--tRNA ligase Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
Q89AC5 0.0 597 56 2 499 3 lysS Lysine--tRNA ligase Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
A4SYX2 0.0 595 58 4 503 3 lysS Lysine--tRNA ligase Polynucleobacter asymbioticus (strain DSM 18221 / CIP 109841 / QLW-P1DMWA-1)
A5CWL4 0.0 595 59 2 490 3 lysS Lysine--tRNA ligase Vesicomyosocius okutanii subsp. Calyptogena okutanii (strain HA)
Q7VRF5 0.0 595 57 3 479 3 lysS Lysine--tRNA ligase Blochmanniella floridana
A5EY50 0.0 593 60 6 497 3 lysS Lysine--tRNA ligase Dichelobacter nodosus (strain VCS1703A)
A1KUN1 0.0 588 57 3 504 3 lysS Lysine--tRNA ligase Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
C5CSG3 0.0 585 57 4 498 3 lysS Lysine--tRNA ligase Variovorax paradoxus (strain S110)
Q9JTT7 0.0 585 57 3 504 3 lysS Lysine--tRNA ligase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q9JYU6 0.0 585 57 3 504 3 lysS Lysine--tRNA ligase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
B1XTS4 0.0 585 57 5 501 3 lysS Lysine--tRNA ligase Polynucleobacter necessarius subsp. necessarius (strain STIR1)
A6SXF3 0.0 585 58 4 506 3 lysS Lysine--tRNA ligase Janthinobacterium sp. (strain Marseille)
Q5F6U2 0.0 581 56 3 504 3 lysS Lysine--tRNA ligase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
A4G778 0.0 580 57 4 506 3 lysS Lysine--tRNA ligase Herminiimonas arsenicoxydans
B4RP57 0.0 580 56 3 504 3 lysS Lysine--tRNA ligase Neisseria gonorrhoeae (strain NCCP11945)
Q47WT5 0.0 578 57 8 533 3 lysS Lysine--tRNA ligase Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
A2SDC3 0.0 569 57 5 504 3 lysS Lysine--tRNA ligase Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
Q9L3G6 0.0 569 54 3 506 3 lysS Lysine--tRNA ligase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q4UU84 0.0 569 54 3 506 3 lysS Lysine--tRNA ligase Xanthomonas campestris pv. campestris (strain 8004)
A5WFG0 0.0 568 55 5 507 3 lysS Lysine--tRNA ligase Psychrobacter sp. (strain PRwf-1)
B0V9L5 0.0 568 56 6 510 3 lysS Lysine--tRNA ligase Acinetobacter baumannii (strain AYE)
B0VSE0 0.0 568 56 6 510 3 lysS Lysine--tRNA ligase Acinetobacter baumannii (strain SDF)
B7GXW0 0.0 568 56 6 510 3 lysS Lysine--tRNA ligase Acinetobacter baumannii (strain AB307-0294)
Q43990 0.0 568 55 5 504 3 lysS Lysine--tRNA ligase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
A3M3D6 0.0 568 56 6 510 3 lysS Lysine--tRNA ligase Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
B0RSQ8 0.0 567 54 3 506 3 lysS Lysine--tRNA ligase Xanthomonas campestris pv. campestris (strain B100)
Q2P1U6 0.0 565 54 4 504 3 lysS Lysine--tRNA ligase Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q8PLC6 0.0 561 54 4 504 3 lysS Lysine--tRNA ligase Xanthomonas axonopodis pv. citri (strain 306)
B2SV97 0.0 559 54 4 504 3 lysS Lysine--tRNA ligase Xanthomonas oryzae pv. oryzae (strain PXO99A)
Q3BUB6 0.0 556 54 4 504 3 lysS Lysine--tRNA ligase Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q9PEB6 0.0 553 53 3 506 3 lysS Lysine--tRNA ligase Xylella fastidiosa (strain 9a5c)
A0L6F7 0.0 553 56 4 490 3 lysS Lysine--tRNA ligase Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
Q87EB3 0.0 552 53 3 506 3 lysS Lysine--tRNA ligase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I848 0.0 552 53 3 506 3 lysS Lysine--tRNA ligase Xylella fastidiosa (strain M23)
B0U572 0.0 550 53 3 506 3 lysS Lysine--tRNA ligase Xylella fastidiosa (strain M12)
Q1QAW5 0.0 548 55 5 501 3 lysS Lysine--tRNA ligase Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q4FSV2 0.0 548 55 4 496 3 lysS Lysine--tRNA ligase Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
P37477 0.0 542 54 3 502 3 lysS Lysine--tRNA ligase Bacillus subtilis (strain 168)
B7HPY8 0.0 535 54 2 490 3 lysS Lysine--tRNA ligase Bacillus cereus (strain AH187)
Q73FD1 0.0 535 54 2 490 3 lysS Lysine--tRNA ligase Bacillus cereus (strain ATCC 10987 / NRS 248)
Q8D2B3 0.0 535 50 2 486 3 lysS Lysine--tRNA ligase Wigglesworthia glossinidia brevipalpis
Q6HPU0 0.0 534 54 2 490 3 lysS Lysine--tRNA ligase Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q63HC2 0.0 534 54 2 490 3 lysS Lysine--tRNA ligase Bacillus cereus (strain ZK / E33L)
B7JK84 0.0 534 54 2 490 3 lysS Lysine--tRNA ligase Bacillus cereus (strain AH820)
Q81VW3 0.0 534 54 2 490 3 lysS Lysine--tRNA ligase Bacillus anthracis
A0R8E9 0.0 534 54 2 490 3 lysS Lysine--tRNA ligase Bacillus thuringiensis (strain Al Hakam)
Q81J70 0.0 534 54 2 490 3 lysS Lysine--tRNA ligase Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
B7HJ16 0.0 534 54 2 490 3 lysS Lysine--tRNA ligase Bacillus cereus (strain B4264)
A7GJY9 0.0 532 54 2 490 3 lysS Lysine--tRNA ligase Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q9RHV9 0.0 529 53 2 490 1 lysS Lysine--tRNA ligase Geobacillus stearothermophilus
B7ISY7 0.0 528 53 2 490 3 lysS Lysine--tRNA ligase Bacillus cereus (strain G9842)
A5D5Q4 0.0 527 53 5 495 3 lysS Lysine--tRNA ligase Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
A9VN90 0.0 526 53 2 490 3 lysS Lysine--tRNA ligase Bacillus mycoides (strain KBAB4)
Q8EU10 2.15e-180 518 52 2 492 3 lysS Lysine--tRNA ligase Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q839A8 2.53e-180 518 51 4 504 3 lysS Lysine--tRNA ligase Enterococcus faecalis (strain ATCC 700802 / V583)
Q3A9M2 7.73e-180 516 52 4 491 3 lysS Lysine--tRNA ligase Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q9KGG4 9.21e-180 516 54 3 491 3 lysS Lysine--tRNA ligase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q4L3H5 1.96e-179 516 53 2 494 3 lysS Lysine--tRNA ligase Staphylococcus haemolyticus (strain JCSC1435)
Q9CII7 4.14e-179 514 52 4 496 3 lysS Lysine--tRNA ligase Lactococcus lactis subsp. lactis (strain IL1403)
A2RIA0 5.38e-179 514 52 4 496 3 lysS Lysine--tRNA ligase Lactococcus lactis subsp. cremoris (strain MG1363)
Q8NXZ0 1.52e-178 513 53 3 494 3 lysS Lysine--tRNA ligase Staphylococcus aureus (strain MW2)
Q6GBX1 1.52e-178 513 53 3 494 3 lysS Lysine--tRNA ligase Staphylococcus aureus (strain MSSA476)
Q8CQV5 1.95e-178 513 52 3 494 3 lysS Lysine--tRNA ligase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HRN7 1.95e-178 513 52 3 494 3 lysS Lysine--tRNA ligase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q6GJF4 2.25e-178 513 52 3 494 3 lysS Lysine--tRNA ligase Staphylococcus aureus (strain MRSA252)
Q031U8 2.47e-178 513 52 4 496 3 lysS Lysine--tRNA ligase Lactococcus lactis subsp. cremoris (strain SK11)
P67610 5.09e-178 512 52 3 494 1 lysS Lysine--tRNA ligase Staphylococcus aureus (strain N315)
P67609 5.09e-178 512 52 3 494 3 lysS Lysine--tRNA ligase Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HIF7 5.09e-178 512 52 3 494 3 lysS Lysine--tRNA ligase Staphylococcus aureus (strain COL)
Q2YVW8 5.09e-178 512 52 3 494 3 lysS Lysine--tRNA ligase Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q2G0Q3 5.09e-178 512 52 3 494 3 lysS Lysine--tRNA ligase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FJC3 5.09e-178 512 52 3 494 3 lysS Lysine--tRNA ligase Staphylococcus aureus (strain USA300)
A7WYS8 5.09e-178 512 52 3 494 3 lysS Lysine--tRNA ligase Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q050Q1 6.76e-178 512 51 6 498 3 lysS Lysine--tRNA ligase Leptospira borgpetersenii serovar Hardjo-bovis (strain L550)
Q04SM4 6.76e-178 512 51 6 498 3 lysS Lysine--tRNA ligase Leptospira borgpetersenii serovar Hardjo-bovis (strain JB197)
Q53638 1.49e-176 508 52 3 494 1 lysS Lysine--tRNA ligase Staphylococcus aureus
B0K5C0 4.67e-176 507 52 5 492 3 lysS Lysine--tRNA ligase Thermoanaerobacter sp. (strain X514)
B1HSY5 7.71e-176 506 50 3 496 3 lysS Lysine--tRNA ligase Lysinibacillus sphaericus (strain C3-41)
B0KCE4 1.6e-175 506 51 5 492 3 lysS Lysine--tRNA ligase Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
Q8R7N1 2.17e-175 505 52 6 493 3 lysS Lysine--tRNA ligase Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q057G7 2.54e-175 505 46 3 503 3 lysS Lysine--tRNA ligase Buchnera aphidicola subsp. Cinara cedri (strain Cc)
Q72R38 2.62e-175 505 50 6 496 3 lysS Lysine--tRNA ligase Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q5WLU5 4.62e-175 505 51 2 490 3 lysS Lysine--tRNA ligase Shouchella clausii (strain KSM-K16)
Q8F4P5 5.1e-175 504 50 6 496 3 lysS Lysine--tRNA ligase Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
B1MVJ0 1.96e-174 503 52 4 492 3 lysS Lysine--tRNA ligase Leuconostoc citreum (strain KM20)
Q2RM49 1.1e-173 501 51 3 489 3 lysS Lysine--tRNA ligase Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q724I4 2.1e-173 500 49 2 496 3 lysS Lysine--tRNA ligase Listeria monocytogenes serotype 4b (strain F2365)
Q0B0N3 3.49e-173 499 51 4 485 3 lysS Lysine--tRNA ligase Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
A4VTP6 4.85e-173 499 51 4 499 3 lysS Lysine--tRNA ligase Streptococcus suis (strain 05ZYH33)
A4VZY0 4.85e-173 499 51 4 499 3 lysS Lysine--tRNA ligase Streptococcus suis (strain 98HAH33)
Q49V26 6.58e-173 499 51 4 497 3 lysS Lysine--tRNA ligase Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q8YAB8 7.21e-173 499 49 2 496 3 lysS Lysine--tRNA ligase Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q92F47 2.24e-172 498 49 2 496 3 lysS Lysine--tRNA ligase Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q88Z28 1.49e-171 496 49 2 496 3 lysS Lysine--tRNA ligase Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q03E09 2.04e-171 495 49 3 500 3 lysS Lysine--tRNA ligase Pediococcus pentosaceus (strain ATCC 25745 / CCUG 21536 / LMG 10740 / 183-1w)
Q03Z44 5.3e-171 494 51 4 493 3 lysS Lysine--tRNA ligase Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
Q8E0I1 5.73e-171 494 50 3 497 3 lysS Lysine--tRNA ligase Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E656 5.73e-171 494 50 3 497 3 lysS Lysine--tRNA ligase Streptococcus agalactiae serotype III (strain NEM316)
Q3K1V5 8.39e-171 494 50 3 497 3 lysS Lysine--tRNA ligase Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
A0AF28 1.25e-170 493 48 2 496 3 lysS Lysine--tRNA ligase Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
A8AW92 4.59e-170 492 51 3 497 3 lysS Lysine--tRNA ligase Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
Q38V83 7.92e-170 491 50 3 495 3 lysS Lysine--tRNA ligase Latilactobacillus sakei subsp. sakei (strain 23K)
Q7VFL0 1.19e-169 491 50 7 498 3 lysS Lysine--tRNA ligase Helicobacter hepaticus (strain ATCC 51449 / 3B1)
A8ESJ5 1.2e-169 491 51 5 494 3 lysS Lysine--tRNA ligase Aliarcobacter butzleri (strain RM4018)
Q03LD3 2.35e-169 490 51 5 502 3 lysS Lysine--tRNA ligase Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q7MAR1 9.82e-169 489 51 5 495 3 lysS Lysine--tRNA ligase Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
B2IN95 1.44e-167 485 50 3 497 3 lysS Lysine--tRNA ligase Streptococcus pneumoniae (strain CGSP14)
A3CP17 7.07e-167 484 50 3 497 3 lysS Lysine--tRNA ligase Streptococcus sanguinis (strain SK36)
Q8DUW8 8.24e-167 483 49 4 502 3 lysS Lysine--tRNA ligase Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q97RS9 8.42e-167 483 50 4 499 1 lysS Lysine--tRNA ligase Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q8CWS5 1.18e-166 483 50 4 499 3 lysS Lysine--tRNA ligase Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
B5E317 1.18e-166 483 50 4 499 3 lysS Lysine--tRNA ligase Streptococcus pneumoniae serotype 19F (strain G54)
Q04LI2 1.18e-166 483 50 4 499 3 lysS Lysine--tRNA ligase Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
B1IAN6 1.4e-166 483 50 4 499 3 lysS Lysine--tRNA ligase Streptococcus pneumoniae (strain Hungary19A-6)
B1KTC1 3.61e-166 482 48 7 507 3 lysS Lysine--tRNA ligase Clostridium botulinum (strain Loch Maree / Type A3)
A5N4L1 4.39e-166 482 47 6 496 3 lysS Lysine--tRNA ligase Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
A5I7P4 5.07e-166 482 48 7 507 3 lysS Lysine--tRNA ligase Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
A7FZA5 5.07e-166 482 48 7 507 3 lysS Lysine--tRNA ligase Clostridium botulinum (strain ATCC 19397 / Type A)
A7GJB3 8.45e-166 481 48 7 507 3 lysS Lysine--tRNA ligase Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
B1IGJ2 8.45e-166 481 48 7 507 3 lysS Lysine--tRNA ligase Clostridium botulinum (strain Okra / Type B1)
Q17YS1 8.89e-166 481 50 6 504 3 lysS Lysine--tRNA ligase Helicobacter acinonychis (strain Sheeba)
Q899G7 3.43e-165 479 46 6 506 3 lysS Lysine--tRNA ligase Clostridium tetani (strain Massachusetts / E88)
B2US13 1.41e-164 478 50 5 498 3 lysS Lysine--tRNA ligase Helicobacter pylori (strain Shi470)
P56126 1.87e-164 478 50 5 498 3 lysS Lysine--tRNA ligase Helicobacter pylori (strain ATCC 700392 / 26695)
A2RFR7 8.85e-164 476 48 4 503 3 lysS Lysine--tRNA ligase Streptococcus pyogenes serotype M5 (strain Manfredo)
Q8P1X6 8.85e-164 476 48 4 503 3 lysS Lysine--tRNA ligase Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q5XD62 8.85e-164 476 48 4 503 3 lysS Lysine--tRNA ligase Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q9A0V7 1.04e-163 476 48 4 503 3 lysS Lysine--tRNA ligase Streptococcus pyogenes serotype M1
B6JPT1 1.55e-163 475 50 5 498 3 lysS Lysine--tRNA ligase Helicobacter pylori (strain P12)
B5XKG9 1.65e-163 475 48 4 503 3 lysS Lysine--tRNA ligase Streptococcus pyogenes serotype M49 (strain NZ131)
Q1CUX6 3.11e-163 474 50 5 498 3 lysS Lysine--tRNA ligase Helicobacter pylori (strain HPAG1)
B5Z9V6 3.43e-163 474 50 5 498 3 lysS Lysine--tRNA ligase Helicobacter pylori (strain G27)
Q0TMI7 5.65e-163 474 48 7 504 3 lysS Lysine--tRNA ligase Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
P0DG47 8.7e-163 473 48 4 503 3 lysS Lysine--tRNA ligase Streptococcus pyogenes serotype M3 (strain SSI-1)
P0DG46 8.7e-163 473 48 4 503 3 lysS Lysine--tRNA ligase Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q8XHL8 2.83e-162 472 48 7 504 3 lysS Lysine--tRNA ligase Clostridium perfringens (strain 13 / Type A)
Q9ZMP8 5.32e-162 471 50 5 498 3 lysS Lysine--tRNA ligase Helicobacter pylori (strain J99 / ATCC 700824)
A7H4X7 6.76e-162 471 52 1 441 3 lysS Lysine--tRNA ligase Campylobacter jejuni subsp. doylei (strain ATCC BAA-1458 / RM4099 / 269.97)
Q0SQ86 7.62e-162 471 48 7 504 3 lysS Lysine--tRNA ligase Clostridium perfringens (strain SM101 / Type A)
A0PXN4 1.15e-161 471 47 6 502 3 lysS Lysine--tRNA ligase Clostridium novyi (strain NT)
Q5HW66 1.22e-161 471 51 1 441 3 lysS Lysine--tRNA ligase Campylobacter jejuni (strain RM1221)
Q5N1D9 3.01e-161 469 49 8 495 3 lysS Lysine--tRNA ligase Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q31KH4 3.01e-161 469 49 8 495 3 lysS Lysine--tRNA ligase Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
A1VYC1 7.99e-161 468 51 1 441 3 lysS Lysine--tRNA ligase Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
P41258 7.99e-161 468 51 1 441 3 lysS Lysine--tRNA ligase Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
A8FKI8 1.64e-160 468 51 1 441 3 lysS Lysine--tRNA ligase Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
Q8DMA9 2.61e-159 465 47 4 489 3 lysS Lysine--tRNA ligase Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
B2RJY1 2.82e-159 467 46 8 509 3 lysS Lysine--tRNA ligase Porphyromonas gingivalis (strain ATCC 33277 / DSM 20709 / CIP 103683 / JCM 12257 / NCTC 11834 / 2561)
Q7NG18 1.43e-158 462 46 4 490 3 lysS Lysine--tRNA ligase Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q3M8C8 1.94e-158 464 46 4 491 3 lysS Lysine--tRNA ligase Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q8YPW9 2e-158 464 47 5 492 3 lysS Lysine--tRNA ligase Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
B2GA78 5.69e-158 461 49 4 495 3 lysS Lysine--tRNA ligase Limosilactobacillus fermentum (strain NBRC 3956 / LMG 18251)
B2J384 2.21e-157 462 46 4 491 3 lysS Lysine--tRNA ligase Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
Q7MUV7 2.24e-157 462 45 8 509 3 lysS Lysine--tRNA ligase Porphyromonas gingivalis (strain ATCC BAA-308 / W83)
Q97EB7 6.23e-157 459 47 6 501 3 lysS Lysine--tRNA ligase Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q5L9E5 6.94e-156 459 45 7 508 3 lysS Lysine--tRNA ligase Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
Q64PM9 7.57e-156 458 45 7 508 3 lysS Lysine--tRNA ligase Bacteroides fragilis (strain YCH46)
A0M5H8 1.22e-155 457 45 7 515 3 lysS Lysine--tRNA ligase Christiangramia forsetii (strain DSM 17595 / CGMCC 1.15422 / KT0803)
P73443 1.33e-155 456 47 5 506 3 lysS Lysine--tRNA ligase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
A6L8C6 2.58e-155 457 47 7 508 3 lysS Lysine--tRNA ligase Parabacteroides distasonis (strain ATCC 8503 / DSM 20701 / CIP 104284 / JCM 5825 / NCTC 11152)
B3QMN9 2.95e-155 454 46 5 511 3 lysS Lysine--tRNA ligase Chlorobaculum parvum (strain DSM 263 / NCIMB 8327)
B7ID87 6.28e-155 453 46 4 484 3 lysS Lysine--tRNA ligase Thermosipho africanus (strain TCF52B)
Q3ARD7 8.55e-155 453 46 6 519 3 lysS Lysine--tRNA ligase Chlorobium chlorochromatii (strain CaD3)
A6L7P5 1.08e-154 456 45 9 511 3 lysS Lysine--tRNA ligase Phocaeicola vulgatus (strain ATCC 8482 / DSM 1447 / JCM 5826 / CCUG 4940 / NBRC 14291 / NCTC 11154)
A7I3S8 1.72e-154 452 45 3 494 3 lysS Lysine--tRNA ligase Campylobacter hominis (strain ATCC BAA-381 / DSM 21671 / CCUG 45161 / LMG 19568 / NCTC 13146 / CH001A)
A6LMS4 2.22e-154 452 45 5 496 3 lysS Lysine--tRNA ligase Thermosipho melanesiensis (strain DSM 12029 / CIP 104789 / BI429)
B4SB22 7.28e-154 451 46 6 507 3 lysS Lysine--tRNA ligase Pelodictyon phaeoclathratiforme (strain DSM 5477 / BU-1)
A3PFA8 8.48e-154 451 46 4 493 3 lysS Lysine--tRNA ligase Prochlorococcus marinus (strain MIT 9301)
Q6MUG2 1.55e-153 450 46 6 488 3 lysS Lysine--tRNA ligase Mycoplasma mycoides subsp. mycoides SC (strain CCUG 32753 / NCTC 10114 / PG1)
O67258 1.83e-153 453 47 2 484 3 lysS Lysine--tRNA ligase Aquifex aeolicus (strain VF5)
Q8KCM7 5.68e-153 449 45 5 517 3 lysS Lysine--tRNA ligase Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
Q7U9X5 6.24e-153 448 48 6 497 3 lysS Lysine--tRNA ligase Parasynechococcus marenigrum (strain WH8102)
Q318C3 1.15e-152 448 45 4 495 3 lysS Lysine--tRNA ligase Prochlorococcus marinus (strain MIT 9312)
A5UPG6 1.82e-152 447 47 4 490 3 lysS Lysine--tRNA ligase Roseiflexus sp. (strain RS-1)
A3CY14 2.23e-152 447 48 9 492 3 lysS Lysine--tRNA ligase Methanoculleus marisnigri (strain ATCC 35101 / DSM 1498 / JR1)
A7NFC6 4.34e-152 446 47 4 490 3 lysS Lysine--tRNA ligase Roseiflexus castenholzii (strain DSM 13941 / HLO8)
Q7U3A4 5.93e-152 446 46 4 496 3 lysS Lysine--tRNA ligase Prochlorococcus marinus (strain MIT 9313)
Q2SR35 9.14e-152 445 46 6 488 3 lysS Lysine--tRNA ligase Mycoplasma capricolum subsp. capricolum (strain California kid / ATCC 27343 / NCTC 10154)
Q3B365 3.26e-151 444 45 5 516 3 lysS Lysine--tRNA ligase Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
A8G7C4 6.7e-151 444 44 3 493 3 lysS Lysine--tRNA ligase Prochlorococcus marinus (strain MIT 9215)
Q7UZP0 1.65e-150 442 47 7 467 3 lysS Lysine--tRNA ligase Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
B6YRR7 3.52e-150 441 44 7 498 3 lysS Lysine--tRNA ligase Azobacteroides pseudotrichonymphae genomovar. CFP2
A2BZ03 7.64e-150 441 47 6 467 3 lysS Lysine--tRNA ligase Prochlorococcus marinus (strain MIT 9515)
Q3ANE6 8.87e-150 440 49 4 447 3 lysS Lysine--tRNA ligase Synechococcus sp. (strain CC9605)
A5FRN5 2.16e-149 439 45 4 483 3 lysS Lysine--tRNA ligase Dehalococcoides mccartyi (strain ATCC BAA-2100 / JCM 16839 / KCTC 5957 / BAV1)
Q8RG52 3.71e-149 438 48 5 443 3 lysS Lysine--tRNA ligase Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
A5GQ58 4.78e-149 438 46 6 491 3 lysS Lysine--tRNA ligase Synechococcus sp. (strain RCC307)
A9BD62 9.48e-149 438 47 4 453 3 lysS Lysine--tRNA ligase Prochlorococcus marinus (strain MIT 9211)
A7HM68 1.03e-148 438 46 7 493 3 lysS Lysine--tRNA ligase Fervidobacterium nodosum (strain ATCC 35602 / DSM 5306 / Rt17-B1)
Q3ZWX9 1.23e-148 437 45 4 483 3 lysS Lysine--tRNA ligase Dehalococcoides mccartyi (strain CBDB1)
B4UGU5 1.63e-148 437 46 8 505 3 lysS Lysine--tRNA ligase Anaeromyxobacter sp. (strain K)
B8JFW2 1.63e-148 437 46 8 505 3 lysS Lysine--tRNA ligase Anaeromyxobacter dehalogenans (strain 2CP-1 / ATCC BAA-258)
A2C629 2.03e-148 437 46 4 496 3 lysS Lysine--tRNA ligase Prochlorococcus marinus (strain MIT 9303)
Q0IDW9 2.18e-148 436 49 3 440 3 lysS Lysine--tRNA ligase Synechococcus sp. (strain CC9311)
Q7V9Q0 4.78e-148 436 46 6 498 3 lysS Lysine--tRNA ligase Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
O87821 5.87e-148 436 46 7 497 3 lysS Lysine--tRNA ligase Rhizobium meliloti (strain 1021)
A9B5T5 1.7e-147 434 46 4 492 3 lysS Lysine--tRNA ligase Herpetosiphon aurantiacus (strain ATCC 23779 / DSM 785 / 114-95)
A9WK04 1.94e-147 434 46 5 493 3 lysS Lysine--tRNA ligase Chloroflexus aurantiacus (strain ATCC 29366 / DSM 635 / J-10-fl)
Q2IPX5 3.61e-147 434 46 8 505 3 lysS Lysine--tRNA ligase Anaeromyxobacter dehalogenans (strain 2CP-C)
A6UDA0 6.91e-147 433 45 6 489 3 lysS Lysine--tRNA ligase Sinorhizobium medicae (strain WSM419)
A5GI38 9.76e-147 432 47 4 489 3 lysS Lysine--tRNA ligase Synechococcus sp. (strain WH7803)
Q9X231 1.63e-146 432 45 4 492 3 lysS Lysine--tRNA ligase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q8A5W4 1.1e-145 432 44 8 509 3 lysS Lysine--tRNA ligase Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
B5ZQW5 1.54e-145 429 45 6 485 3 lysS Lysine--tRNA ligase Rhizobium leguminosarum bv. trifolii (strain WSM2304)
Q6YPY6 2.21e-145 429 44 3 492 3 lysS Lysine--tRNA ligase Onion yellows phytoplasma (strain OY-M)
B1LAX6 2.41e-145 429 45 4 486 3 lysS Lysine--tRNA ligase Thermotoga sp. (strain RQ2)
A5ILE6 2.63e-145 429 45 4 486 3 lysS Lysine--tRNA ligase Thermotoga petrophila (strain ATCC BAA-488 / DSM 13995 / JCM 10881 / RKU-1)
Q3B0J9 4.1e-144 426 48 3 446 3 lysS Lysine--tRNA ligase Synechococcus sp. (strain CC9902)
Q2FSN8 1.09e-143 425 45 4 484 3 lysS Lysine--tRNA ligase Methanospirillum hungatei JF-1 (strain ATCC 27890 / DSM 864 / NBRC 100397 / JF-1)
A8F4K1 1.88e-143 424 45 8 494 3 lysS Lysine--tRNA ligase Pseudothermotoga lettingae (strain ATCC BAA-301 / DSM 14385 / NBRC 107922 / TMO)
Q1MBK9 1.98e-143 424 44 6 485 3 lysS Lysine--tRNA ligase Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q2NJZ8 6.12e-143 422 44 3 482 3 lysS Lysine--tRNA ligase Aster yellows witches'-broom phytoplasma (strain AYWB)
B3PNH7 3.83e-142 421 44 5 484 3 lysS Lysine--tRNA ligase Metamycoplasma arthritidis (strain 158L3-1)
Q8U7H6 6.32e-142 420 45 6 485 3 lysS Lysine--tRNA ligase Agrobacterium fabrum (strain C58 / ATCC 33970)
Q3Z8X9 9.86e-142 420 46 6 490 3 lysS Lysine--tRNA ligase Dehalococcoides mccartyi (strain ATCC BAA-2266 / KCTC 15142 / 195)
Q6KIP6 1.97e-141 419 46 5 484 3 lysS Lysine--tRNA ligase Mycoplasma mobile (strain ATCC 43663 / 163K / NCTC 11711)
Q2K424 4.41e-141 418 45 6 485 3 lysS Lysine--tRNA ligase Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
B3Q0S4 1.01e-140 417 45 6 485 3 lysS Lysine--tRNA ligase Rhizobium etli (strain CIAT 652)
B1VA97 1.44e-140 417 45 3 479 3 lysS Lysine--tRNA ligase Phytoplasma australiense
Q49158 8.63e-140 414 45 7 484 3 lysS Lysine--tRNA ligase Mycoplasmopsis fermentans (strain ATCC 19989 / NBRC 14854 / NCTC 10117 / PG18)
Q9RXE1 2.97e-139 414 48 5 452 3 lysS Lysine--tRNA ligase Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
P41255 4.16e-139 413 45 5 493 1 lysS Lysine--tRNA ligase Thermus thermophilus
Q5SJG7 4.16e-139 413 45 5 493 3 lysS Lysine--tRNA ligase Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
Q72JT9 4.16e-139 413 45 5 493 3 lysS Lysine--tRNA ligase Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
Q98QG4 1.92e-137 409 45 7 486 3 lysS2 Lysine--tRNA ligase 2 Mycoplasmopsis pulmonis (strain UAB CTIP)
Q9PR83 1.64e-135 404 43 8 486 3 lysS Lysine--tRNA ligase Ureaplasma parvum serovar 3 (strain ATCC 700970)
B1AI47 1.64e-135 404 43 8 486 3 lysS Lysine--tRNA ligase Ureaplasma parvum serovar 3 (strain ATCC 27815 / 27 / NCTC 11736)
Q98QH1 2.37e-135 403 44 8 487 3 lysS1 Lysine--tRNA ligase 1 Mycoplasmopsis pulmonis (strain UAB CTIP)
Q9LJE2 3.03e-135 407 42 8 517 2 OVA5 Lysine--tRNA ligase, chloroplastic/mitochondrial Arabidopsis thaliana
Q8EUS8 4.25e-135 402 43 6 494 3 lysS Lysine--tRNA ligase Malacoplasma penetrans (strain HF-2)
P46191 8.42e-135 402 43 5 489 3 lysS Lysine--tRNA ligase Metamycoplasma hominis (strain ATCC 23114 / DSM 25592 / NBRC 14850 / NCTC 10111 / PG21)
Q8PVP6 1.22e-133 399 43 5 473 3 lysS2 Lysine--tRNA ligase 2 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
B5ZAP2 5.96e-133 397 42 8 486 3 lysS Lysine--tRNA ligase Ureaplasma urealyticum serovar 10 (strain ATCC 33699 / Western)
Q8TSN5 1.24e-130 392 44 2 442 3 lysS2 Lysine--tRNA ligase 2 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q4AAC7 2.27e-129 388 42 8 498 3 lysS Lysine--tRNA ligase Mesomycoplasma hyopneumoniae (strain J / ATCC 25934 / NCTC 10110)
Q7NC34 4.85e-129 387 40 8 495 3 lysS Lysine--tRNA ligase Mycoplasmoides gallisepticum (strain R(low / passage 15 / clone 2))
Q4A8F8 5.83e-129 387 42 8 498 3 lysS Lysine--tRNA ligase Mesomycoplasma hyopneumoniae (strain 7448)
Q15046 8.92e-129 390 41 7 511 1 KARS1 Lysine--tRNA ligase Homo sapiens
P37879 2.07e-128 389 41 7 511 1 KARS1 Lysine--tRNA ligase Cricetulus griseus
Q99MN1 2.2e-128 389 41 7 513 1 Kars1 Lysine--tRNA ligase Mus musculus
Q5XIM7 9.21e-127 385 41 7 513 1 Kars1 Lysine--tRNA ligase Rattus norvegicus
Q8SS56 3.71e-126 380 40 6 484 3 ECU04_0580 Probable lysine--tRNA ligase, cytoplasmic Encephalitozoon cuniculi (strain GB-M1)
Q4A5F3 2.21e-125 377 42 7 468 3 lysS Lysine--tRNA ligase Mycoplasmopsis synoviae (strain 53)
Q9UUE6 3.27e-123 375 41 6 510 3 krs1 Lysine--tRNA ligase, cytoplasmic Schizosaccharomyces pombe (strain 972 / ATCC 24843)
A6W5H6 3.5e-123 372 40 10 507 3 lysS Lysine--tRNA ligase Kineococcus radiotolerans (strain ATCC BAA-149 / DSM 14245 / SRS30216)
P75500 4.59e-123 372 40 8 492 3 lysS Lysine--tRNA ligase Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
C4V8R9 2.22e-122 371 39 6 518 3 NCER_100909 Probable lysine--tRNA ligase, cytoplasmic Vairimorpha ceranae (strain BRL01)
P15180 2.38e-122 373 40 10 521 1 KRS1 Lysine--tRNA ligase, cytoplasmic Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A9CS74 9.69e-121 367 39 7 521 3 EBI_25548 Probable lysine--tRNA ligase, cytoplasmic Enterocytozoon bieneusi (strain H348)
Q43776 1.07e-120 369 38 10 549 2 LYSRS Lysine--tRNA ligase Solanum lycopersicum
Q6F2U9 5.52e-119 365 38 7 518 2 Os03g0586800 Lysine--tRNA ligase Oryza sativa subsp. japonica
P47382 1.87e-118 360 39 5 493 3 lysS Lysine--tRNA ligase Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q22099 3.02e-115 354 40 8 491 3 kars-1 Lysine--tRNA ligase Caenorhabditis elegans
P95970 5.98e-114 348 39 7 485 3 lysS Lysine--tRNA ligase Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q9ZPI1 9.64e-114 352 38 7 526 1 At3g11710 Lysine--tRNA ligase, cytoplasmic Arabidopsis thaliana
A0A120HYZ1 1.07e-111 346 37 10 503 2 cla4 Lysine--tRNA ligase cla4 Cladosporium cladosporioides
A5U8S4 1.17e-110 340 38 7 508 3 lysS Lysine--tRNA ligase Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
C1AI57 1.17e-110 340 38 7 508 3 lysS Lysine--tRNA ligase Mycobacterium bovis (strain BCG / Tokyo 172 / ATCC 35737 / TMC 1019)
A1KPT4 1.17e-110 340 38 7 508 3 lysS Lysine--tRNA ligase Mycobacterium bovis (strain BCG / Pasteur 1173P2)
P9WFU9 1.17e-110 340 38 7 508 1 lysS1 Lysine--tRNA ligase 1 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WFU8 1.17e-110 340 38 7 508 3 lysS1 Lysine--tRNA ligase 1 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P67608 1.17e-110 340 38 7 508 3 lysS1 Lysine--tRNA ligase 1 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
O84786 1.2e-109 338 40 9 505 3 lysS Lysine--tRNA ligase Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
Q3KKR1 1.2e-109 338 40 9 505 3 lysS Lysine--tRNA ligase Chlamydia trachomatis serovar A (strain ATCC VR-571B / DSM 19440 / HAR-13)
P46861 1.72e-109 337 38 9 502 3 lysS Lysine--tRNA ligase Mycobacterium leprae (strain TN)
B0BAN6 6.56e-109 337 40 9 505 1 lysS Lysine--tRNA ligase Chlamydia trachomatis serovar L2b (strain UCH-1/proctitis)
B0B907 6.56e-109 337 40 9 505 3 lysS Lysine--tRNA ligase Chlamydia trachomatis serovar L2 (strain ATCC VR-902B / DSM 19102 / 434/Bu)
A4T9U2 8.13e-109 351 39 6 504 3 lysX Lysylphosphatidylglycerol biosynthesis bifunctional protein LysX Mycolicibacterium gilvum (strain PYR-GCK)
Q821U6 1.08e-108 336 41 9 507 3 lysS Lysine--tRNA ligase Chlamydia caviae (strain ATCC VR-813 / DSM 19441 / 03DC25 / GPIC)
D0LB45 1.55e-108 351 39 6 492 3 lysX Lysylphosphatidylglycerol biosynthesis bifunctional protein LysX Gordonia bronchialis (strain ATCC 25592 / DSM 43247 / BCRC 13721 / JCM 3198 / KCTC 3076 / NBRC 16047 / NCTC 10667)
C0ZL89 4.31e-107 347 37 7 504 3 lysX Lysylphosphatidylglycerol biosynthesis bifunctional protein LysX Rhodococcus erythropolis (strain PR4 / NBRC 100887)
Q9Z6X5 4.69e-107 332 39 9 507 3 lysS Lysine--tRNA ligase Chlamydia pneumoniae
Q5L545 4.96e-107 332 41 8 458 3 lysS Lysine--tRNA ligase Chlamydia abortus (strain DSM 27085 / S26/3)
A4T5M9 2.74e-106 329 39 10 504 3 lysS Lysine--tRNA ligase Mycolicibacterium gilvum (strain PYR-GCK)
Q9PLE1 3.46e-106 329 42 9 459 3 lysS Lysine--tRNA ligase Chlamydia muridarum (strain MoPn / Nigg)
Q255U2 4.6e-106 329 40 9 507 3 lysS Lysine--tRNA ligase Chlamydia felis (strain Fe/C-56)
A1TAC7 6.06e-106 343 39 7 503 3 lysX Lysylphosphatidylglycerol biosynthesis bifunctional protein LysX Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
B2HR11 1.84e-105 342 39 5 496 3 lysX Lysylphosphatidylglycerol biosynthesis bifunctional protein LysX Mycobacterium marinum (strain ATCC BAA-535 / M)
Q740J9 2.21e-105 343 40 5 447 3 lysX Lysylphosphatidylglycerol biosynthesis bifunctional protein LysX Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
A0QHC4 2.75e-105 343 40 5 447 3 lysX Lysylphosphatidylglycerol biosynthesis bifunctional protein LysX Mycobacterium avium (strain 104)
A0PP57 4.09e-105 341 39 6 496 3 lysX Lysylphosphatidylglycerol biosynthesis bifunctional protein LysX Mycobacterium ulcerans (strain Agy99)
Q4JCI5 1.87e-104 324 37 11 497 3 lysS Lysine--tRNA ligase Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770)
Q0SAA3 4.7e-104 338 37 6 503 3 lysX Lysylphosphatidylglycerol biosynthesis bifunctional protein LysX Rhodococcus jostii (strain RHA1)
Q1B7P4 4.96e-104 338 38 6 501 3 lysX Lysylphosphatidylglycerol biosynthesis bifunctional protein LysX Mycobacterium sp. (strain MCS)
A1UHB3 4.96e-104 338 38 6 501 3 lysX Lysylphosphatidylglycerol biosynthesis bifunctional protein LysX Mycobacterium sp. (strain KMS)
C1B7Z5 6.75e-104 338 37 7 503 3 lysX Lysylphosphatidylglycerol biosynthesis bifunctional protein LysX Rhodococcus opacus (strain B4)
A0QYV1 6.32e-103 335 39 7 510 3 lysX Lysylphosphatidylglycerol biosynthesis bifunctional protein LysX Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
A3Q0V0 1.42e-102 335 38 6 501 3 lysX Lysylphosphatidylglycerol biosynthesis bifunctional protein LysX Mycobacterium sp. (strain JLS)
Q5Z3P6 2.94e-102 334 38 4 446 3 lysX Lysylphosphatidylglycerol biosynthesis bifunctional protein LysX Nocardia farcinica (strain IFM 10152)
P9WFU7 1.74e-101 333 38 5 502 1 lysX Lysylphosphatidylglycerol biosynthesis bifunctional protein LysX Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WFU6 1.74e-101 333 38 5 502 3 lysX Lysylphosphatidylglycerol biosynthesis bifunctional protein LysX Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5WMW1 1.74e-101 333 38 5 502 3 lysX Lysylphosphatidylglycerol biosynthesis bifunctional protein LysX Mycobacterium tuberculosis (strain F11)
A5U2Z7 1.74e-101 333 38 5 502 3 lysX Lysylphosphatidylglycerol biosynthesis bifunctional protein LysX Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
C6DS31 1.92e-101 332 38 5 502 3 lysX Lysylphosphatidylglycerol biosynthesis bifunctional protein LysX Mycobacterium tuberculosis (strain KZN 1435 / MDR)
C1ANR3 4.94e-101 331 38 5 502 3 lysX Lysylphosphatidylglycerol biosynthesis bifunctional protein LysX Mycobacterium bovis (strain BCG / Tokyo 172 / ATCC 35737 / TMC 1019)
A1KJ57 4.94e-101 331 38 5 502 3 lysX Lysylphosphatidylglycerol biosynthesis bifunctional protein LysX Mycobacterium bovis (strain BCG / Pasteur 1173P2)
Q7VEV7 1.45e-100 330 38 5 502 3 lysX Lysylphosphatidylglycerol biosynthesis bifunctional protein LysX Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
B1MAX9 7.98e-99 324 38 7 494 3 lysX Lysylphosphatidylglycerol biosynthesis bifunctional protein LysX Mycobacteroides abscessus (strain ATCC 19977 / DSM 44196 / CCUG 20993 / CIP 104536 / JCM 13569 / NCTC 13031 / TMC 1543 / L948)
Q9CC23 6.56e-97 320 39 5 452 3 lysX Lysylphosphatidylglycerol biosynthesis bifunctional protein LysX Mycobacterium leprae (strain TN)
B8ZRJ4 6.56e-97 320 39 5 452 3 lysX Lysylphosphatidylglycerol biosynthesis bifunctional protein LysX Mycobacterium leprae (strain Br4923)
O74858 5.96e-82 267 35 12 456 3 msk1 Lysine--tRNA ligase, mitochondrial Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P32048 1.14e-51 187 29 15 480 1 MSK1 Lysine--tRNA ligase, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
B5R9A5 5.46e-42 155 32 9 324 3 epmA Elongation factor P--(R)-beta-lysine ligase Salmonella gallinarum (strain 287/91 / NCTC 13346)
P57642 9.97e-42 155 30 7 327 3 epmA Elongation factor P--(R)-beta-lysine ligase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
C6DFN3 2.35e-41 154 31 9 333 3 epmA Elongation factor P--(R)-beta-lysine ligase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
B8D8A2 1.47e-40 151 29 7 327 3 epmA Elongation factor P--(R)-beta-lysine ligase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain Tuc7)
B8D8E5 1.47e-40 151 29 7 327 3 epmA Elongation factor P--(R)-beta-lysine ligase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain 5A)
Q89A27 3.08e-40 150 32 7 325 3 epmA Elongation factor P--(R)-beta-lysine ligase Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
B5FRL4 4.28e-40 150 32 9 322 3 epmA Elongation factor P--(R)-beta-lysine ligase Salmonella dublin (strain CT_02021853)
Q9ZJ12 6.44e-40 150 31 9 322 1 epmA Elongation factor P--(R)-beta-lysine ligase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TF92 6.44e-40 150 31 9 322 3 epmA Elongation factor P--(R)-beta-lysine ligase Salmonella heidelberg (strain SL476)
B5R019 6.44e-40 150 31 9 322 3 epmA Elongation factor P--(R)-beta-lysine ligase Salmonella enteritidis PT4 (strain P125109)
B5F2M2 6.44e-40 150 31 9 322 3 epmA Elongation factor P--(R)-beta-lysine ligase Salmonella agona (strain SL483)
Q8Z197 8.85e-40 149 32 7 320 3 epmA Elongation factor P--(R)-beta-lysine ligase Salmonella typhi
B4TSD9 1.76e-39 149 31 9 322 3 epmA Elongation factor P--(R)-beta-lysine ligase Salmonella schwarzengrund (strain CVM19633)
C0Q6B6 1.76e-39 149 31 9 322 3 epmA Elongation factor P--(R)-beta-lysine ligase Salmonella paratyphi C (strain RKS4594)
A9N413 1.76e-39 149 31 9 322 3 epmA Elongation factor P--(R)-beta-lysine ligase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4T2Q3 1.76e-39 149 31 9 322 3 epmA Elongation factor P--(R)-beta-lysine ligase Salmonella newport (strain SL254)
Q57GN3 1.76e-39 149 31 9 322 3 epmA Elongation factor P--(R)-beta-lysine ligase Salmonella choleraesuis (strain SC-B67)
P0A8P0 1.91e-39 149 30 8 328 3 epmA Elongation factor P--(R)-beta-lysine ligase Shigella flexneri
Q0SXC1 1.91e-39 149 30 8 328 3 epmA Elongation factor P--(R)-beta-lysine ligase Shigella flexneri serotype 5b (strain 8401)
B2TY33 1.91e-39 149 30 8 328 3 epmA Elongation factor P--(R)-beta-lysine ligase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q1R3A2 1.91e-39 149 30 8 328 3 epmA Elongation factor P--(R)-beta-lysine ligase Escherichia coli (strain UTI89 / UPEC)
B1LQH8 1.91e-39 149 30 8 328 3 epmA Elongation factor P--(R)-beta-lysine ligase Escherichia coli (strain SMS-3-5 / SECEC)
B6I264 1.91e-39 149 30 8 328 3 epmA Elongation factor P--(R)-beta-lysine ligase Escherichia coli (strain SE11)
B7NG94 1.91e-39 149 30 8 328 3 epmA Elongation factor P--(R)-beta-lysine ligase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P0A8N7 1.91e-39 149 30 8 328 1 epmA Elongation factor P--(R)-beta-lysine ligase Escherichia coli (strain K12)
P0A8N8 1.91e-39 149 30 8 328 3 epmA Elongation factor P--(R)-beta-lysine ligase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0T9N4 1.91e-39 149 30 8 328 3 epmA Elongation factor P--(R)-beta-lysine ligase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A8A7Q4 1.91e-39 149 30 8 328 3 epmA Elongation factor P--(R)-beta-lysine ligase Escherichia coli O9:H4 (strain HS)
B1XDQ9 1.91e-39 149 30 8 328 3 epmA Elongation factor P--(R)-beta-lysine ligase Escherichia coli (strain K12 / DH10B)
C5A1E9 1.91e-39 149 30 8 328 3 epmA Elongation factor P--(R)-beta-lysine ligase Escherichia coli (strain K12 / MC4100 / BW2952)
B7M8S0 1.91e-39 149 30 8 328 3 epmA Elongation factor P--(R)-beta-lysine ligase Escherichia coli O8 (strain IAI1)
B7MSX2 1.91e-39 149 30 8 328 3 epmA Elongation factor P--(R)-beta-lysine ligase Escherichia coli O81 (strain ED1a)
B7NTL6 1.91e-39 149 30 8 328 3 epmA Elongation factor P--(R)-beta-lysine ligase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5Z2G6 1.91e-39 149 30 8 328 3 epmA Elongation factor P--(R)-beta-lysine ligase Escherichia coli O157:H7 (strain EC4115 / EHEC)
P0A8N9 1.91e-39 149 30 8 328 3 epmA Elongation factor P--(R)-beta-lysine ligase Escherichia coli O157:H7
B7LC16 1.91e-39 149 30 8 328 3 epmA Elongation factor P--(R)-beta-lysine ligase Escherichia coli (strain 55989 / EAEC)
B7MKW2 1.91e-39 149 30 8 328 3 epmA Elongation factor P--(R)-beta-lysine ligase Escherichia coli O45:K1 (strain S88 / ExPEC)

  • Number of RefSeq hits:

General

Source Morganella morganii S4
Locus tag NLDBIP_05690
Feature type CDS
Gene lysS
Product lysine--tRNA ligase
Location 101118 - 102635 (strand: -1)
Length 1518 (nucleotides) / 505 (amino acids)

Contig

Accession ZDB_521
Length 325332 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_814
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00152 tRNA synthetases class II (D, K and N)
PF01336 OB-fold nucleic acid binding domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1190 Translation, ribosomal structure and biogenesis (J) J Lysyl-tRNA synthetase (class II)

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K04567 lysyl-tRNA synthetase, class II [EC:6.1.1.6] Aminoacyl-tRNA biosynthesis -

Protein Sequence

MSQDQHSAEQAPDLNNELKTRREKLAQLREKEAVAFPNDFRRDAVSGELHEKYGEKSAEELEALNIEVAIAGRMMTRRIMGKASFATLQDTAGRIQIYVSRDDLAEGVYNESFKKWDLGDILAARGKLFKTKTGELTVHCTEVRLLTKALRPLPDKFHGLSDQETRYRQRYLDLIANDESRHTFAVRSRILAEIRKFMVNKGFMEVETPMMQVIPGGASARPFVTHHNALDIDMYLRIAPELYLKRLVVGGFERVFEINRNFRNEGVSPRHNPEFTMMELYMAYADYKDLIVLTEELFRTIAQDVLGNPVVKYGDQEFDFGKPFAKLTMKEAICKYRPETNMADLDDMDKAVAIAKSLNIKIEKSWGLGRVQCEIFEEVAESHLIQPTFIIEYPAEVSPLARRNDDNPFITDRFEFFIGGREIGNGFSELNDAEDQAERFAEQVRQKDAGDDEAMFYDEDYVVALEHGLPPTAGLGIGIDRMVMLFTDSHTIRDVILFPAMRPGK

Flanking regions ( +/- flanking 50bp)

TGGATAAATTTATTGAGGCCAGCTTAAAAGCGGGTTTATAAGGATTAAAAATGTCACAAGATCAACACAGTGCTGAGCAGGCACCTGATTTAAATAACGAATTAAAAACACGCCGTGAAAAACTGGCACAGTTGCGTGAGAAAGAAGCCGTTGCATTCCCGAATGATTTCCGCCGTGACGCGGTATCCGGTGAGCTGCATGAAAAATATGGTGAAAAAAGCGCGGAAGAGCTGGAAGCCCTGAATATCGAAGTGGCGATTGCCGGCCGTATGATGACCCGCCGTATCATGGGTAAAGCCTCTTTTGCCACCTTACAGGACACTGCGGGCCGTATTCAGATTTACGTTTCCCGTGATGATCTGGCTGAAGGCGTGTACAACGAATCCTTTAAAAAATGGGATCTGGGCGATATCCTCGCGGCGCGCGGTAAGTTATTTAAAACCAAAACCGGCGAACTGACTGTCCACTGTACCGAAGTCCGCCTGCTGACCAAAGCACTGCGTCCGTTACCGGATAAATTCCACGGTCTGAGTGACCAGGAAACCCGTTACCGCCAGCGTTATCTGGATCTGATTGCCAACGATGAATCCCGTCATACCTTTGCGGTGCGTTCACGTATTCTGGCTGAAATCCGTAAATTCATGGTGAACAAAGGGTTTATGGAAGTTGAAACCCCGATGATGCAGGTGATTCCGGGCGGGGCAAGTGCGCGTCCGTTTGTTACCCATCATAATGCGCTGGATATCGATATGTATCTGCGTATTGCGCCGGAGCTGTATCTGAAGCGTCTGGTGGTCGGTGGTTTTGAGCGCGTGTTTGAAATCAACCGTAACTTCCGTAACGAAGGGGTTTCCCCGCGTCACAACCCGGAATTCACCATGATGGAACTTTATATGGCATATGCCGATTATAAAGACCTGATTGTACTGACCGAAGAGCTGTTCCGCACCATCGCGCAGGATGTGCTGGGCAATCCGGTTGTGAAATACGGTGACCAGGAATTCGATTTCGGCAAACCGTTTGCCAAACTCACCATGAAAGAAGCTATCTGCAAATATCGTCCGGAAACCAATATGGCGGATCTGGATGATATGGATAAAGCAGTTGCTATCGCGAAATCCCTGAATATCAAAATTGAAAAATCATGGGGTCTGGGCCGCGTACAGTGTGAAATCTTCGAGGAAGTGGCAGAAAGCCATCTGATCCAGCCGACATTCATCATTGAATATCCGGCAGAAGTCTCTCCGCTGGCGCGTCGTAATGACGACAATCCGTTTATTACTGACCGCTTTGAATTCTTTATCGGCGGGCGCGAAATCGGTAACGGTTTCTCCGAGCTGAACGATGCGGAAGATCAGGCAGAGCGTTTTGCCGAGCAGGTCCGCCAGAAAGATGCCGGTGACGACGAAGCGATGTTCTATGACGAAGACTATGTTGTCGCGCTGGAGCACGGTCTGCCGCCGACAGCGGGTCTGGGTATCGGGATCGACCGCATGGTTATGCTGTTTACTGACAGCCACACCATCCGTGACGTTATCCTGTTCCCTGCGATGCGTCCGGGCAAATAATTGCTGCGGTAAATGAACACGGAGCCTCACAAATTTGTGGGGCTTTTTTT