Homologs in group_814

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_04080 FBDBKF_04080 86.9 Morganella morganii S1 lysS lysine--tRNA ligase
EHELCC_05370 EHELCC_05370 86.9 Morganella morganii S2 lysS lysine--tRNA ligase
NLDBIP_05690 NLDBIP_05690 86.9 Morganella morganii S4 lysS lysine--tRNA ligase
LHKJJB_02570 LHKJJB_02570 86.9 Morganella morganii S3 lysS lysine--tRNA ligase
HKOGLL_06045 HKOGLL_06045 86.9 Morganella morganii S5 lysS lysine--tRNA ligase
F4V73_RS08520 F4V73_RS08520 84.9 Morganella psychrotolerans lysS lysine--tRNA ligase

Distribution of the homologs in the orthogroup group_814

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_814

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B4F0M6 0.0 1043 100 0 504 3 lysS Lysine--tRNA ligase Proteus mirabilis (strain HI4320)
Q7N1C8 0.0 924 85 0 504 3 lysS Lysine--tRNA ligase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A1JPL4 0.0 917 85 1 505 3 lysS Lysine--tRNA ligase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
B1JPH6 0.0 911 84 1 505 3 lysS Lysine--tRNA ligase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q666T3 0.0 911 84 1 505 3 lysS Lysine--tRNA ligase Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TIC5 0.0 911 84 1 505 3 lysS Lysine--tRNA ligase Yersinia pestis (strain Pestoides F)
Q1CF16 0.0 911 84 1 505 3 lysS Lysine--tRNA ligase Yersinia pestis bv. Antiqua (strain Nepal516)
A9R4M4 0.0 911 84 1 505 3 lysS Lysine--tRNA ligase Yersinia pestis bv. Antiqua (strain Angola)
Q8ZHK5 0.0 911 84 1 505 3 lysS Lysine--tRNA ligase Yersinia pestis
B2K0N6 0.0 911 84 1 505 3 lysS Lysine--tRNA ligase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1CB23 0.0 911 84 1 505 3 lysS Lysine--tRNA ligase Yersinia pestis bv. Antiqua (strain Antiqua)
A7FF39 0.0 911 84 1 505 3 lysS Lysine--tRNA ligase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q6D945 0.0 894 84 0 501 3 lysS Lysine--tRNA ligase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A8GIP4 0.0 890 84 1 505 3 lysS Lysine--tRNA ligase Serratia proteamaculans (strain 568)
C6D8Z6 0.0 890 85 0 501 3 lysS Lysine--tRNA ligase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
A7MR65 0.0 887 83 1 505 3 lysS Lysine--tRNA ligase Cronobacter sakazakii (strain ATCC BAA-894)
A8AP96 0.0 884 83 1 505 3 lysS Lysine--tRNA ligase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
B2VF45 0.0 883 83 1 504 3 lysS Lysine--tRNA ligase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
B4TUQ8 0.0 880 82 1 505 3 lysS Lysine--tRNA ligase Salmonella schwarzengrund (strain CVM19633)
B5BFK5 0.0 880 82 1 505 3 lysS Lysine--tRNA ligase Salmonella paratyphi A (strain AKU_12601)
A9N3L6 0.0 880 82 1 505 3 lysS Lysine--tRNA ligase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PL30 0.0 880 82 1 505 3 lysS Lysine--tRNA ligase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4T535 0.0 880 82 1 505 3 lysS Lysine--tRNA ligase Salmonella newport (strain SL254)
B4TGW0 0.0 880 82 1 505 3 lysS Lysine--tRNA ligase Salmonella heidelberg (strain SL476)
B5RE01 0.0 880 82 1 505 3 lysS Lysine--tRNA ligase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5QXG7 0.0 880 82 1 505 3 lysS Lysine--tRNA ligase Salmonella enteritidis PT4 (strain P125109)
B5FUF3 0.0 880 82 1 505 3 lysS Lysine--tRNA ligase Salmonella dublin (strain CT_02021853)
Q57K76 0.0 880 82 1 505 3 lysS Lysine--tRNA ligase Salmonella choleraesuis (strain SC-B67)
B5F5G4 0.0 880 82 1 505 3 lysS Lysine--tRNA ligase Salmonella agona (strain SL483)
P28354 0.0 880 82 1 505 3 lysS Lysine--tRNA ligase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A9MRI4 0.0 879 82 1 505 3 lysS Lysine--tRNA ligase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q0T106 0.0 878 82 1 505 3 lysS Lysine--tRNA ligase Shigella flexneri serotype 5b (strain 8401)
B2U0Q7 0.0 878 82 1 505 3 lysS Lysine--tRNA ligase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q83JU6 0.0 878 82 1 505 3 lysS Lysine--tRNA ligase Shigella flexneri
Q8Z3X8 0.0 878 82 1 505 3 lysS Lysine--tRNA ligase Salmonella typhi
P0A8N3 0.0 878 82 1 505 1 lysS Lysine--tRNA ligase Escherichia coli (strain K12)
P0A8N4 0.0 878 82 1 505 3 lysS Lysine--tRNA ligase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
C5BAR6 0.0 878 83 0 492 3 lysS Lysine--tRNA ligase Edwardsiella ictaluri (strain 93-146)
A4WE42 0.0 877 82 1 505 3 lysS Lysine--tRNA ligase Enterobacter sp. (strain 638)
Q32BV3 0.0 877 82 1 505 3 lysS Lysine--tRNA ligase Shigella dysenteriae serotype 1 (strain Sd197)
Q31WF2 0.0 877 82 1 505 3 lysS Lysine--tRNA ligase Shigella boydii serotype 4 (strain Sb227)
C0PY12 0.0 877 82 1 505 3 lysS Lysine--tRNA ligase Salmonella paratyphi C (strain RKS4594)
Q8XD57 0.0 877 82 1 505 3 lysS Lysine--tRNA ligase Escherichia coli O157:H7
P0A8N5 0.0 861 80 1 505 1 lysU Lysine--tRNA ligase, heat inducible Escherichia coli (strain K12)
P0A8N6 0.0 861 80 1 505 3 lysU Lysine--tRNA ligase, heat inducible Escherichia coli O157:H7
Q2NRG1 0.0 859 80 0 503 3 lysS Lysine--tRNA ligase Sodalis glossinidius (strain morsitans)
Q8FAT5 0.0 858 80 1 505 3 lysU Lysine--tRNA ligase, heat inducible Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P57822 0.0 748 69 2 503 3 lysS Lysine--tRNA ligase Pasteurella multocida (strain Pm70)
A0KNK7 0.0 743 69 2 511 3 lysS Lysine--tRNA ligase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
B0URW9 0.0 743 70 1 494 3 lysS Lysine--tRNA ligase Histophilus somni (strain 2336)
Q5QYV9 0.0 737 69 1 495 3 lysS Lysine--tRNA ligase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
A4SJK0 0.0 736 69 2 509 3 lysS Lysine--tRNA ligase Aeromonas salmonicida (strain A449)
Q65SB0 0.0 736 69 2 500 3 lysS Lysine--tRNA ligase Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
C4LCP0 0.0 735 69 3 511 3 lysS Lysine--tRNA ligase Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
A5UCQ0 0.0 735 70 1 491 3 lysS Lysine--tRNA ligase Haemophilus influenzae (strain PittEE)
A6VPH6 0.0 731 68 2 503 3 lysS Lysine--tRNA ligase Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
A5UIX4 0.0 728 69 1 491 3 lysS Lysine--tRNA ligase Haemophilus influenzae (strain PittGG)
P43825 0.0 727 69 1 491 3 lysS Lysine--tRNA ligase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q4QL88 0.0 727 69 1 491 3 lysS Lysine--tRNA ligase Haemophilus influenzae (strain 86-028NP)
B3H1E8 0.0 714 67 0 492 3 lysS Lysine--tRNA ligase Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
B0BP90 0.0 713 67 0 492 3 lysS Lysine--tRNA ligase Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
A3N0G9 0.0 713 67 0 492 3 lysS Lysine--tRNA ligase Actinobacillus pleuropneumoniae serotype 5b (strain L20)
A1T047 0.0 706 66 2 506 3 lysS Lysine--tRNA ligase Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q7VLU5 0.0 698 66 0 493 3 lysS Lysine--tRNA ligase Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q1LTU4 0.0 687 62 0 494 3 lysS Lysine--tRNA ligase Baumannia cicadellinicola subsp. Homalodisca coagulata
B8GRJ2 0.0 679 63 2 502 3 lysS Lysine--tRNA ligase Thioalkalivibrio sulfidiphilus (strain HL-EbGR7)
Q493E1 0.0 668 62 1 496 3 lysS Lysine--tRNA ligase Blochmanniella pennsylvanica (strain BPEN)
A1AWN8 0.0 655 63 1 489 3 lysS Lysine--tRNA ligase Ruthia magnifica subsp. Calyptogena magnifica
A4XXQ6 0.0 635 62 2 488 3 lysS Lysine--tRNA ligase Pseudomonas mendocina (strain ymp)
Q82SH1 0.0 634 60 1 498 3 lysS Lysine--tRNA ligase Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
A5W890 0.0 632 62 2 488 3 lysS Lysine--tRNA ligase Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q88MS3 0.0 631 62 2 488 3 lysS Lysine--tRNA ligase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
B0KRL5 0.0 631 62 2 488 3 lysS Lysine--tRNA ligase Pseudomonas putida (strain GB-1)
B1JD39 0.0 630 61 2 488 3 lysS Lysine--tRNA ligase Pseudomonas putida (strain W619)
Q1IDW1 0.0 629 61 3 497 3 lysS Lysine--tRNA ligase Pseudomonas entomophila (strain L48)
Q1H372 0.0 629 61 1 497 3 lysS Lysine--tRNA ligase Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q5NY31 0.0 629 60 1 501 3 lysS Lysine--tRNA ligase Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
Q7MNP6 0.0 628 61 4 500 3 lysS Lysine--tRNA ligase Vibrio vulnificus (strain YJ016)
Q8DEQ9 0.0 627 61 4 500 3 lysS Lysine--tRNA ligase Vibrio vulnificus (strain CMCP6)
Q2SL47 0.0 627 60 3 502 3 lysS Lysine--tRNA ligase Hahella chejuensis (strain KCTC 2396)
Q5X4D5 0.0 627 61 2 483 3 lysS Lysine--tRNA ligase Legionella pneumophila (strain Paris)
Q5ZUL6 0.0 626 61 2 483 3 lysS Lysine--tRNA ligase Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
A5ICT2 0.0 626 61 2 483 3 lysS Lysine--tRNA ligase Legionella pneumophila (strain Corby)
Q9KU60 0.0 625 60 5 510 3 lysS Lysine--tRNA ligase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q5WVS0 0.0 625 61 2 483 3 lysS Lysine--tRNA ligase Legionella pneumophila (strain Lens)
Q886S6 0.0 624 60 4 505 3 lysS Lysine--tRNA ligase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q4ZWW0 0.0 623 60 4 505 3 lysS Lysine--tRNA ligase Pseudomonas syringae pv. syringae (strain B728a)
Q0HRS5 0.0 622 61 4 502 3 lysS Lysine--tRNA ligase Shewanella sp. (strain MR-7)
Q0HM10 0.0 622 61 4 502 3 lysS Lysine--tRNA ligase Shewanella sp. (strain MR-4)
A0L0F1 0.0 622 61 4 502 3 lysS Lysine--tRNA ligase Shewanella sp. (strain ANA-3)
Q8EI58 0.0 622 61 4 502 3 lysS Lysine--tRNA ligase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q47C53 0.0 622 59 2 502 3 lysS Lysine--tRNA ligase Dechloromonas aromatica (strain RCB)
A1RGF1 0.0 621 61 4 502 3 lysS Lysine--tRNA ligase Shewanella sp. (strain W3-18-1)
A4Y9X9 0.0 621 61 4 502 3 lysS Lysine--tRNA ligase Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
Q8K9C5 0.0 620 57 1 500 3 lysS Lysine--tRNA ligase Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
A7MXL2 0.0 619 61 4 500 3 lysS Lysine--tRNA ligase Vibrio campbellii (strain ATCC BAA-1116)
Q3KHF3 0.0 619 61 2 488 3 lysS Lysine--tRNA ligase Pseudomonas fluorescens (strain Pf0-1)
Q12JH2 0.0 619 60 4 502 3 lysS Lysine--tRNA ligase Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q4KHL4 0.0 619 60 4 505 3 lysS Lysine--tRNA ligase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q9HXU0 0.0 619 60 4 504 3 lysS Lysine--tRNA ligase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A3QB36 0.0 619 60 4 503 3 lysS Lysine--tRNA ligase Shewanella loihica (strain ATCC BAA-1088 / PV-4)
Q02RH2 0.0 619 60 4 504 3 lysS Lysine--tRNA ligase Pseudomonas aeruginosa (strain UCBPP-PA14)
B7V0Z5 0.0 618 60 4 504 3 lysS Lysine--tRNA ligase Pseudomonas aeruginosa (strain LESB58)
Q83E97 0.0 618 58 1 493 3 lysS Lysine--tRNA ligase Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
A9NBP7 0.0 618 58 1 493 3 lysS Lysine--tRNA ligase Coxiella burnetii (strain RSA 331 / Henzerling II)
A9KEG1 0.0 618 58 1 493 3 lysS Lysine--tRNA ligase Coxiella burnetii (strain Dugway 5J108-111)
B6J1P6 0.0 618 58 1 493 3 lysS Lysine--tRNA ligase Coxiella burnetii (strain CbuG_Q212)
B6J8K2 0.0 618 58 1 493 3 lysS Lysine--tRNA ligase Coxiella burnetii (strain CbuK_Q154)
Q087X1 0.0 617 60 4 502 3 lysS Lysine--tRNA ligase Shewanella frigidimarina (strain NCIMB 400)
A6V187 0.0 617 60 4 504 3 lysS Lysine--tRNA ligase Pseudomonas aeruginosa (strain PA7)
Q48F26 0.0 617 60 4 505 3 lysS Lysine--tRNA ligase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
B6EMX2 0.0 616 61 4 498 3 lysS Lysine--tRNA ligase Aliivibrio salmonicida (strain LFI1238)
Q473I5 0.0 616 60 2 495 3 lysS Lysine--tRNA ligase Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q3SKD9 0.0 615 61 1 491 3 lysS Lysine--tRNA ligase Thiobacillus denitrificans (strain ATCC 25259)
A9L1I0 0.0 615 60 4 502 3 lysS Lysine--tRNA ligase Shewanella baltica (strain OS195)
A6WS29 0.0 615 60 4 502 3 lysS Lysine--tRNA ligase Shewanella baltica (strain OS185)
A3D0Y5 0.0 615 60 4 502 3 lysS Lysine--tRNA ligase Shewanella baltica (strain OS155 / ATCC BAA-1091)
A5CWL4 0.0 615 60 1 489 3 lysS Lysine--tRNA ligase Vesicomyosocius okutanii subsp. Calyptogena okutanii (strain HA)
A9AGV1 0.0 615 59 2 495 3 lysS Lysine--tRNA ligase Burkholderia multivorans (strain ATCC 17616 / 249)
A4JFZ6 0.0 614 60 2 495 3 lysS Lysine--tRNA ligase Burkholderia vietnamiensis (strain G4 / LMG 22486)
A9IQY2 0.0 614 59 2 498 3 lysS Lysine--tRNA ligase Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
Q87SB1 0.0 614 61 4 496 3 lysS Lysine--tRNA ligase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
C1DB68 0.0 614 59 2 503 3 lysS Lysine--tRNA ligase Laribacter hongkongensis (strain HLHK9)
Q1QT66 0.0 614 58 3 495 3 lysS Lysine--tRNA ligase Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
P57512 0.0 614 57 0 491 3 lysS Lysine--tRNA ligase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q7WK46 0.0 613 60 2 501 3 lysS Lysine--tRNA ligase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
A1K5J9 0.0 612 60 2 492 3 lysS Lysine--tRNA ligase Azoarcus sp. (strain BH72)
Q1LPK6 0.0 612 60 3 497 3 lysS Lysine--tRNA ligase Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
B5F9U5 0.0 612 60 4 498 3 lysS Lysine--tRNA ligase Aliivibrio fischeri (strain MJ11)
Q0KCG3 0.0 612 59 3 506 3 lysS Lysine--tRNA ligase Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q7VZ37 0.0 612 60 2 501 3 lysS Lysine--tRNA ligase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q8Y0L5 0.0 611 60 2 496 3 lysS Lysine--tRNA ligase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q7W8T6 0.0 611 60 2 501 3 lysS Lysine--tRNA ligase Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q5E7P8 0.0 611 60 4 498 3 lysS Lysine--tRNA ligase Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q0BDR2 0.0 610 59 2 495 3 lysS Lysine--tRNA ligase Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
B1YT20 0.0 610 59 2 495 3 lysS Lysine--tRNA ligase Burkholderia ambifaria (strain MC40-6)
B2U8U9 0.0 610 59 3 512 3 lysS Lysine--tRNA ligase Ralstonia pickettii (strain 12J)
Q2SXD6 0.0 610 59 2 501 1 lysS Lysine--tRNA ligase Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q6LUN2 0.0 609 59 4 503 3 lysS Lysine--tRNA ligase Photobacterium profundum (strain SS9)
B3R478 0.0 609 59 3 504 3 lysS Lysine--tRNA ligase Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
B8CU98 0.0 608 59 4 503 3 lysS Lysine--tRNA ligase Shewanella piezotolerans (strain WP3 / JCM 13877)
B0TTP2 0.0 608 59 4 503 3 lysS Lysine--tRNA ligase Shewanella halifaxensis (strain HAW-EB4)
C5BRM0 0.0 608 59 5 507 3 lysS Lysine--tRNA ligase Teredinibacter turnerae (strain ATCC 39867 / T7901)
Q1BHT1 0.0 608 58 3 502 3 lysS Lysine--tRNA ligase Burkholderia orbicola (strain AU 1054)
B1JUZ7 0.0 608 58 3 502 3 lysS Lysine--tRNA ligase Burkholderia orbicola (strain MC0-3)
B4EDB2 0.0 608 58 3 502 3 lysS Lysine--tRNA ligase Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
A0K8P2 0.0 608 58 3 502 3 lysS Lysine--tRNA ligase Burkholderia cenocepacia (strain HI2424)
Q3JQP3 0.0 607 59 2 501 3 lysS Lysine--tRNA ligase Burkholderia pseudomallei (strain 1710b)
A3NX27 0.0 607 59 2 501 3 lysS Lysine--tRNA ligase Burkholderia pseudomallei (strain 1106a)
A1V5L6 0.0 607 59 2 501 3 lysS Lysine--tRNA ligase Burkholderia mallei (strain SAVP1)
Q62IZ9 0.0 607 59 2 501 3 lysS Lysine--tRNA ligase Burkholderia mallei (strain ATCC 23344)
A2SAT3 0.0 607 59 2 501 3 lysS Lysine--tRNA ligase Burkholderia mallei (strain NCTC 10229)
A3ML91 0.0 607 59 2 501 3 lysS Lysine--tRNA ligase Burkholderia mallei (strain NCTC 10247)
B1KFR7 0.0 607 59 4 499 3 lysS Lysine--tRNA ligase Shewanella woodyi (strain ATCC 51908 / MS32)
A8H0J7 0.0 607 59 4 503 3 lysS Lysine--tRNA ligase Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
A3NB96 0.0 607 58 2 501 3 lysS Lysine--tRNA ligase Burkholderia pseudomallei (strain 668)
A4SYX2 0.0 607 58 3 502 3 lysS Lysine--tRNA ligase Polynucleobacter asymbioticus (strain DSM 18221 / CIP 109841 / QLW-P1DMWA-1)
Q63SN9 0.0 606 59 2 501 3 lysS Lysine--tRNA ligase Burkholderia pseudomallei (strain K96243)
A8FRH9 0.0 606 59 4 503 3 lysS Lysine--tRNA ligase Shewanella sediminis (strain HAW-EB3)
Q7NZ62 0.0 605 58 1 502 3 lysS Lysine--tRNA ligase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
A1S9M3 0.0 605 59 4 502 3 lysS Lysine--tRNA ligase Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q89AC5 0.0 601 56 1 498 3 lysS Lysine--tRNA ligase Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
B2JIY1 0.0 598 58 2 493 3 lysS Lysine--tRNA ligase Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
B2SXV7 0.0 592 57 4 497 3 lysS Lysine--tRNA ligase Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
A5EY50 0.0 592 60 7 497 3 lysS Lysine--tRNA ligase Dichelobacter nodosus (strain VCS1703A)
A6SXF3 0.0 591 59 3 495 3 lysS Lysine--tRNA ligase Janthinobacterium sp. (strain Marseille)
C5CSG3 0.0 590 58 4 498 3 lysS Lysine--tRNA ligase Variovorax paradoxus (strain S110)
B1XTS4 0.0 590 57 3 500 3 lysS Lysine--tRNA ligase Polynucleobacter necessarius subsp. necessarius (strain STIR1)
Q13WZ5 0.0 588 57 2 493 3 lysS Lysine--tRNA ligase Paraburkholderia xenovorans (strain LB400)
Q7VRF5 0.0 584 58 2 474 3 lysS Lysine--tRNA ligase Blochmanniella floridana
A1KUN1 0.0 583 56 2 503 3 lysS Lysine--tRNA ligase Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
Q9JTT7 0.0 581 55 2 503 3 lysS Lysine--tRNA ligase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
A4G778 0.0 581 58 3 495 3 lysS Lysine--tRNA ligase Herminiimonas arsenicoxydans
Q9JYU6 0.0 581 55 2 503 3 lysS Lysine--tRNA ligase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
A5WFG0 0.0 579 57 6 498 3 lysS Lysine--tRNA ligase Psychrobacter sp. (strain PRwf-1)
Q47WT5 0.0 578 56 8 533 3 lysS Lysine--tRNA ligase Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q5F6U2 0.0 577 55 2 503 3 lysS Lysine--tRNA ligase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
B4RP57 0.0 577 55 2 503 3 lysS Lysine--tRNA ligase Neisseria gonorrhoeae (strain NCCP11945)
Q43990 0.0 569 54 6 510 3 lysS Lysine--tRNA ligase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q2P1U6 0.0 567 54 2 505 3 lysS Lysine--tRNA ligase Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q9L3G6 0.0 567 54 2 505 3 lysS Lysine--tRNA ligase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q4UU84 0.0 567 54 2 505 3 lysS Lysine--tRNA ligase Xanthomonas campestris pv. campestris (strain 8004)
A2SDC3 0.0 566 58 3 469 3 lysS Lysine--tRNA ligase Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
Q4FSV2 0.0 566 56 6 499 3 lysS Lysine--tRNA ligase Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
B0RSQ8 0.0 565 54 2 505 3 lysS Lysine--tRNA ligase Xanthomonas campestris pv. campestris (strain B100)
Q8PLC6 0.0 563 54 2 505 3 lysS Lysine--tRNA ligase Xanthomonas axonopodis pv. citri (strain 306)
B0V9L5 0.0 563 55 6 510 3 lysS Lysine--tRNA ligase Acinetobacter baumannii (strain AYE)
B0VSE0 0.0 563 55 6 510 3 lysS Lysine--tRNA ligase Acinetobacter baumannii (strain SDF)
B7GXW0 0.0 563 55 6 510 3 lysS Lysine--tRNA ligase Acinetobacter baumannii (strain AB307-0294)
A3M3D6 0.0 562 55 6 510 3 lysS Lysine--tRNA ligase Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
B2SV97 0.0 560 53 2 505 3 lysS Lysine--tRNA ligase Xanthomonas oryzae pv. oryzae (strain PXO99A)
Q1QAW5 0.0 559 56 7 501 3 lysS Lysine--tRNA ligase Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q3BUB6 0.0 558 53 2 505 3 lysS Lysine--tRNA ligase Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q9PEB6 0.0 555 53 2 505 3 lysS Lysine--tRNA ligase Xylella fastidiosa (strain 9a5c)
Q87EB3 0.0 555 53 2 505 3 lysS Lysine--tRNA ligase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I848 0.0 555 53 2 505 3 lysS Lysine--tRNA ligase Xylella fastidiosa (strain M23)
A0L6F7 0.0 553 54 6 506 3 lysS Lysine--tRNA ligase Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
B0U572 0.0 553 53 2 505 3 lysS Lysine--tRNA ligase Xylella fastidiosa (strain M12)
P37477 0.0 548 54 4 502 3 lysS Lysine--tRNA ligase Bacillus subtilis (strain 168)
Q8D2B3 0.0 541 50 1 485 3 lysS Lysine--tRNA ligase Wigglesworthia glossinidia brevipalpis
Q8EU10 0.0 530 53 3 492 3 lysS Lysine--tRNA ligase Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q9RHV9 0.0 528 53 3 490 1 lysS Lysine--tRNA ligase Geobacillus stearothermophilus
A7GJY9 0.0 528 53 3 490 3 lysS Lysine--tRNA ligase Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
B7HPY8 0.0 528 53 3 490 3 lysS Lysine--tRNA ligase Bacillus cereus (strain AH187)
Q73FD1 0.0 528 53 3 490 3 lysS Lysine--tRNA ligase Bacillus cereus (strain ATCC 10987 / NRS 248)
Q6HPU0 0.0 526 53 3 490 3 lysS Lysine--tRNA ligase Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q63HC2 0.0 526 53 3 490 3 lysS Lysine--tRNA ligase Bacillus cereus (strain ZK / E33L)
B7JK84 0.0 526 53 3 490 3 lysS Lysine--tRNA ligase Bacillus cereus (strain AH820)
Q81VW3 0.0 526 53 3 490 3 lysS Lysine--tRNA ligase Bacillus anthracis
A0R8E9 0.0 526 53 3 490 3 lysS Lysine--tRNA ligase Bacillus thuringiensis (strain Al Hakam)
A5D5Q4 0.0 526 53 6 493 3 lysS Lysine--tRNA ligase Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
Q81J70 0.0 526 53 3 490 3 lysS Lysine--tRNA ligase Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
B7HJ16 0.0 526 53 3 490 3 lysS Lysine--tRNA ligase Bacillus cereus (strain B4264)
B1HSY5 0.0 525 51 4 496 3 lysS Lysine--tRNA ligase Lysinibacillus sphaericus (strain C3-41)
Q5WLU5 0.0 522 52 3 490 3 lysS Lysine--tRNA ligase Shouchella clausii (strain KSM-K16)
Q4L3H5 0.0 521 53 3 494 3 lysS Lysine--tRNA ligase Staphylococcus haemolyticus (strain JCSC1435)
B7ISY7 0.0 521 52 3 490 3 lysS Lysine--tRNA ligase Bacillus cereus (strain G9842)
Q9KGG4 0.0 520 53 4 491 3 lysS Lysine--tRNA ligase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
A9VN90 0.0 519 52 3 490 3 lysS Lysine--tRNA ligase Bacillus mycoides (strain KBAB4)
Q8NXZ0 0.0 519 53 5 497 3 lysS Lysine--tRNA ligase Staphylococcus aureus (strain MW2)
Q6GBX1 0.0 519 53 5 497 3 lysS Lysine--tRNA ligase Staphylococcus aureus (strain MSSA476)
Q6GJF4 2.48e-180 518 53 5 497 3 lysS Lysine--tRNA ligase Staphylococcus aureus (strain MRSA252)
P67610 4.1e-180 517 53 5 497 1 lysS Lysine--tRNA ligase Staphylococcus aureus (strain N315)
P67609 4.1e-180 517 53 5 497 3 lysS Lysine--tRNA ligase Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HIF7 4.1e-180 517 53 5 497 3 lysS Lysine--tRNA ligase Staphylococcus aureus (strain COL)
Q2YVW8 4.1e-180 517 53 5 497 3 lysS Lysine--tRNA ligase Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q2G0Q3 4.1e-180 517 53 5 497 3 lysS Lysine--tRNA ligase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FJC3 4.1e-180 517 53 5 497 3 lysS Lysine--tRNA ligase Staphylococcus aureus (strain USA300)
A7WYS8 4.1e-180 517 53 5 497 3 lysS Lysine--tRNA ligase Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q8CQV5 5.15e-180 517 52 5 497 3 lysS Lysine--tRNA ligase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HRN7 5.15e-180 517 52 5 497 3 lysS Lysine--tRNA ligase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
A2RIA0 6.59e-179 514 52 5 496 3 lysS Lysine--tRNA ligase Lactococcus lactis subsp. cremoris (strain MG1363)
Q839A8 6.64e-179 514 51 5 504 3 lysS Lysine--tRNA ligase Enterococcus faecalis (strain ATCC 700802 / V583)
Q057G7 7.21e-179 514 47 2 502 3 lysS Lysine--tRNA ligase Buchnera aphidicola subsp. Cinara cedri (strain Cc)
Q53638 1.03e-178 514 52 5 497 1 lysS Lysine--tRNA ligase Staphylococcus aureus
Q3A9M2 1.49e-178 513 51 4 491 3 lysS Lysine--tRNA ligase Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q031U8 4.64e-178 512 52 5 496 3 lysS Lysine--tRNA ligase Lactococcus lactis subsp. cremoris (strain SK11)
Q050Q1 7.67e-178 511 50 5 498 3 lysS Lysine--tRNA ligase Leptospira borgpetersenii serovar Hardjo-bovis (strain L550)
Q04SM4 7.67e-178 511 50 5 498 3 lysS Lysine--tRNA ligase Leptospira borgpetersenii serovar Hardjo-bovis (strain JB197)
Q9CII7 8.45e-178 511 52 5 496 3 lysS Lysine--tRNA ligase Lactococcus lactis subsp. lactis (strain IL1403)
Q03E09 9.59e-178 511 51 4 502 3 lysS Lysine--tRNA ligase Pediococcus pentosaceus (strain ATCC 25745 / CCUG 21536 / LMG 10740 / 183-1w)
Q8R7N1 2.56e-177 510 53 6 493 3 lysS Lysine--tRNA ligase Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q72R38 5.95e-177 509 50 5 496 3 lysS Lysine--tRNA ligase Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
B1MVJ0 6.84e-177 509 53 4 492 3 lysS Lysine--tRNA ligase Leuconostoc citreum (strain KM20)
Q49V26 7.4e-177 509 52 5 497 3 lysS Lysine--tRNA ligase Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q8F4P5 1.12e-176 508 50 5 496 3 lysS Lysine--tRNA ligase Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
B0KCE4 1.94e-176 508 51 5 492 3 lysS Lysine--tRNA ligase Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
B0K5C0 2.85e-176 508 52 5 492 3 lysS Lysine--tRNA ligase Thermoanaerobacter sp. (strain X514)
Q8YAB8 2.68e-175 505 50 3 494 3 lysS Lysine--tRNA ligase Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q724I4 3.45e-175 505 50 3 494 3 lysS Lysine--tRNA ligase Listeria monocytogenes serotype 4b (strain F2365)
A8ESJ5 6.33e-175 504 52 6 494 3 lysS Lysine--tRNA ligase Aliarcobacter butzleri (strain RM4018)
Q92F47 7.39e-175 504 50 3 494 3 lysS Lysine--tRNA ligase Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q2RM49 2.53e-174 502 51 4 489 3 lysS Lysine--tRNA ligase Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q7VFL0 3.17e-174 503 51 7 498 3 lysS Lysine--tRNA ligase Helicobacter hepaticus (strain ATCC 51449 / 3B1)
A0AF28 2.42e-173 500 49 3 494 3 lysS Lysine--tRNA ligase Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q03Z44 2.77e-173 500 51 4 493 3 lysS Lysine--tRNA ligase Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
Q0B0N3 6.9e-173 499 51 4 485 3 lysS Lysine--tRNA ligase Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
Q7MAR1 1.01e-172 499 51 4 494 3 lysS Lysine--tRNA ligase Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
A4VTP6 2.92e-172 497 52 5 498 3 lysS Lysine--tRNA ligase Streptococcus suis (strain 05ZYH33)
A4VZY0 2.92e-172 497 52 5 498 3 lysS Lysine--tRNA ligase Streptococcus suis (strain 98HAH33)
Q88Z28 7.16e-172 496 50 3 496 3 lysS Lysine--tRNA ligase Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q38V83 1.29e-170 493 49 4 495 3 lysS Lysine--tRNA ligase Latilactobacillus sakei subsp. sakei (strain 23K)
A5N4L1 8.96e-170 491 48 6 496 3 lysS Lysine--tRNA ligase Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
B1KTC1 2.39e-169 490 50 7 499 3 lysS Lysine--tRNA ligase Clostridium botulinum (strain Loch Maree / Type A3)
A5I7P4 4.17e-169 489 49 7 499 3 lysS Lysine--tRNA ligase Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
A7FZA5 4.17e-169 489 49 7 499 3 lysS Lysine--tRNA ligase Clostridium botulinum (strain ATCC 19397 / Type A)
A7GJB3 5.78e-169 489 49 7 499 3 lysS Lysine--tRNA ligase Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
B1IGJ2 5.78e-169 489 49 7 499 3 lysS Lysine--tRNA ligase Clostridium botulinum (strain Okra / Type B1)
Q17YS1 1.12e-168 488 51 7 499 3 lysS Lysine--tRNA ligase Helicobacter acinonychis (strain Sheeba)
Q8E0I1 1.23e-168 488 51 4 491 3 lysS Lysine--tRNA ligase Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E656 1.23e-168 488 51 4 491 3 lysS Lysine--tRNA ligase Streptococcus agalactiae serotype III (strain NEM316)
Q3K1V5 2e-168 488 51 4 491 3 lysS Lysine--tRNA ligase Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
B2IN95 4.2e-168 487 51 4 496 3 lysS Lysine--tRNA ligase Streptococcus pneumoniae (strain CGSP14)
P56126 9.67e-168 486 50 7 499 3 lysS Lysine--tRNA ligase Helicobacter pylori (strain ATCC 700392 / 26695)
Q97RS9 1.54e-167 485 51 5 498 1 lysS Lysine--tRNA ligase Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q8CWS5 1.83e-167 485 51 5 498 3 lysS Lysine--tRNA ligase Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
B5E317 1.83e-167 485 51 5 498 3 lysS Lysine--tRNA ligase Streptococcus pneumoniae serotype 19F (strain G54)
Q04LI2 1.83e-167 485 51 5 498 3 lysS Lysine--tRNA ligase Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
B2US13 3.2e-167 485 50 7 499 3 lysS Lysine--tRNA ligase Helicobacter pylori (strain Shi470)
B1IAN6 3.83e-167 484 51 5 498 3 lysS Lysine--tRNA ligase Streptococcus pneumoniae (strain Hungary19A-6)
Q1CUX6 6.57e-167 484 50 7 499 3 lysS Lysine--tRNA ligase Helicobacter pylori (strain HPAG1)
B6JPT1 1.06e-166 483 50 7 499 3 lysS Lysine--tRNA ligase Helicobacter pylori (strain P12)
B5Z9V6 2e-166 483 50 7 499 3 lysS Lysine--tRNA ligase Helicobacter pylori (strain G27)
Q03LD3 2.78e-166 482 51 5 493 3 lysS Lysine--tRNA ligase Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
B2RJY1 4e-166 485 47 8 508 3 lysS Lysine--tRNA ligase Porphyromonas gingivalis (strain ATCC 33277 / DSM 20709 / CIP 103683 / JCM 12257 / NCTC 11834 / 2561)
Q9ZMP8 5.43e-166 481 50 7 499 3 lysS Lysine--tRNA ligase Helicobacter pylori (strain J99 / ATCC 700824)
Q899G7 1.07e-165 481 47 8 507 3 lysS Lysine--tRNA ligase Clostridium tetani (strain Massachusetts / E88)
A3CP17 1.18e-165 481 51 4 496 3 lysS Lysine--tRNA ligase Streptococcus sanguinis (strain SK36)
A8AW92 2.4e-165 480 51 4 496 3 lysS Lysine--tRNA ligase Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
Q0TMI7 7.21e-164 476 48 8 509 3 lysS Lysine--tRNA ligase Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q7MUV7 8.05e-164 479 47 8 508 3 lysS Lysine--tRNA ligase Porphyromonas gingivalis (strain ATCC BAA-308 / W83)
A7H4X7 8.21e-164 476 49 6 490 3 lysS Lysine--tRNA ligase Campylobacter jejuni subsp. doylei (strain ATCC BAA-1458 / RM4099 / 269.97)
A0PXN4 1.25e-163 476 48 7 503 3 lysS Lysine--tRNA ligase Clostridium novyi (strain NT)
Q0SQ86 1.53e-163 475 48 8 509 3 lysS Lysine--tRNA ligase Clostridium perfringens (strain SM101 / Type A)
Q8XHL8 1.53e-163 475 48 8 509 3 lysS Lysine--tRNA ligase Clostridium perfringens (strain 13 / Type A)
Q5HW66 2.41e-163 475 49 6 490 3 lysS Lysine--tRNA ligase Campylobacter jejuni (strain RM1221)
Q9A0V7 5.74e-163 474 49 5 497 3 lysS Lysine--tRNA ligase Streptococcus pyogenes serotype M1
A2RFR7 7.21e-163 473 49 5 497 3 lysS Lysine--tRNA ligase Streptococcus pyogenes serotype M5 (strain Manfredo)
Q8P1X6 7.21e-163 473 49 5 497 3 lysS Lysine--tRNA ligase Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q5XD62 7.21e-163 473 49 5 497 3 lysS Lysine--tRNA ligase Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
A8FKI8 1.22e-162 473 49 6 490 3 lysS Lysine--tRNA ligase Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
A1VYC1 1.62e-162 473 48 6 490 3 lysS Lysine--tRNA ligase Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
P41258 1.62e-162 473 48 6 490 3 lysS Lysine--tRNA ligase Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
B5XKG9 1.76e-162 473 49 5 497 3 lysS Lysine--tRNA ligase Streptococcus pyogenes serotype M49 (strain NZ131)
Q8DUW8 9.82e-162 471 49 5 500 3 lysS Lysine--tRNA ligase Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
P0DG47 1.04e-161 471 49 5 497 3 lysS Lysine--tRNA ligase Streptococcus pyogenes serotype M3 (strain SSI-1)
P0DG46 1.04e-161 471 49 5 497 3 lysS Lysine--tRNA ligase Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q7NG18 2.06e-161 470 47 6 491 3 lysS Lysine--tRNA ligase Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
B2GA78 4.27e-161 469 49 5 495 3 lysS Lysine--tRNA ligase Limosilactobacillus fermentum (strain NBRC 3956 / LMG 18251)
Q5N1D9 1.29e-160 468 49 7 493 3 lysS Lysine--tRNA ligase Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q31KH4 1.29e-160 468 49 7 493 3 lysS Lysine--tRNA ligase Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
A7I3S8 1.67e-160 468 47 4 494 3 lysS Lysine--tRNA ligase Campylobacter hominis (strain ATCC BAA-381 / DSM 21671 / CCUG 45161 / LMG 19568 / NCTC 13146 / CH001A)
Q8DMA9 3.75e-160 467 48 5 489 3 lysS Lysine--tRNA ligase Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q3M8C8 1.61e-159 467 47 6 492 3 lysS Lysine--tRNA ligase Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q97EB7 1.91e-159 465 47 6 501 3 lysS Lysine--tRNA ligase Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
A6LMS4 4.28e-159 464 46 4 480 3 lysS Lysine--tRNA ligase Thermosipho melanesiensis (strain DSM 12029 / CIP 104789 / BI429)
Q64PM9 5.52e-159 466 46 7 517 3 lysS Lysine--tRNA ligase Bacteroides fragilis (strain YCH46)
Q5L9E5 5.52e-159 466 46 7 517 3 lysS Lysine--tRNA ligase Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
A0M5H8 6.17e-159 466 46 9 507 3 lysS Lysine--tRNA ligase Christiangramia forsetii (strain DSM 17595 / CGMCC 1.15422 / KT0803)
A6L7P5 9.1e-159 466 46 8 520 3 lysS Lysine--tRNA ligase Phocaeicola vulgatus (strain ATCC 8482 / DSM 1447 / JCM 5826 / CCUG 4940 / NBRC 14291 / NCTC 11154)
A3PFA8 3.19e-158 462 47 4 493 3 lysS Lysine--tRNA ligase Prochlorococcus marinus (strain MIT 9301)
B7ID87 3.2e-158 462 47 2 470 3 lysS Lysine--tRNA ligase Thermosipho africanus (strain TCF52B)
B2J384 4.92e-158 463 47 6 492 3 lysS Lysine--tRNA ligase Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
P73443 5.66e-158 461 48 6 491 3 lysS Lysine--tRNA ligase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q8YPW9 6.89e-158 463 46 6 492 3 lysS Lysine--tRNA ligase Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q3ARD7 1.14e-157 461 47 7 519 3 lysS Lysine--tRNA ligase Chlorobium chlorochromatii (strain CaD3)
Q318C3 1.63e-157 460 46 4 493 3 lysS Lysine--tRNA ligase Prochlorococcus marinus (strain MIT 9312)
A3CY14 4.71e-157 459 48 8 491 3 lysS Lysine--tRNA ligase Methanoculleus marisnigri (strain ATCC 35101 / DSM 1498 / JR1)
A8G7C4 2.03e-156 457 47 4 493 3 lysS Lysine--tRNA ligase Prochlorococcus marinus (strain MIT 9215)
Q7U9X5 5.73e-156 456 49 6 492 3 lysS Lysine--tRNA ligase Parasynechococcus marenigrum (strain WH8102)
A6L8C6 1.36e-155 458 47 8 508 3 lysS Lysine--tRNA ligase Parabacteroides distasonis (strain ATCC 8503 / DSM 20701 / CIP 104284 / JCM 5825 / NCTC 11152)
A9BD62 1.46e-155 455 46 7 503 3 lysS Lysine--tRNA ligase Prochlorococcus marinus (strain MIT 9211)
A5GQ58 2.71e-155 454 48 6 486 3 lysS Lysine--tRNA ligase Synechococcus sp. (strain RCC307)
B3QMN9 3.31e-155 454 46 6 512 3 lysS Lysine--tRNA ligase Chlorobaculum parvum (strain DSM 263 / NCIMB 8327)
Q7U3A4 4.59e-155 454 46 4 493 3 lysS Lysine--tRNA ligase Prochlorococcus marinus (strain MIT 9313)
A5GI38 2.34e-154 451 49 6 488 3 lysS Lysine--tRNA ligase Synechococcus sp. (strain WH7803)
Q6MUG2 7.71e-154 451 47 6 490 3 lysS Lysine--tRNA ligase Mycoplasma mycoides subsp. mycoides SC (strain CCUG 32753 / NCTC 10114 / PG1)
B4SB22 8.01e-154 451 46 7 507 3 lysS Lysine--tRNA ligase Pelodictyon phaeoclathratiforme (strain DSM 5477 / BU-1)
Q7UZP0 3.92e-153 449 49 4 451 3 lysS Lysine--tRNA ligase Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
Q8KCM7 5.85e-153 449 46 7 517 3 lysS Lysine--tRNA ligase Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
B6YRR7 6.42e-153 448 46 8 498 3 lysS Lysine--tRNA ligase Azobacteroides pseudotrichonymphae genomovar. CFP2
Q2SR35 1.41e-152 447 46 7 488 3 lysS Lysine--tRNA ligase Mycoplasma capricolum subsp. capricolum (strain California kid / ATCC 27343 / NCTC 10154)
A2BZ03 2.62e-152 447 45 7 498 3 lysS Lysine--tRNA ligase Prochlorococcus marinus (strain MIT 9515)
Q3ANE6 3.04e-152 447 48 6 489 3 lysS Lysine--tRNA ligase Synechococcus sp. (strain CC9605)
A5UPG6 5.09e-152 446 47 5 490 3 lysS Lysine--tRNA ligase Roseiflexus sp. (strain RS-1)
A2C629 1.09e-151 445 46 4 493 3 lysS Lysine--tRNA ligase Prochlorococcus marinus (strain MIT 9303)
Q0IDW9 1.13e-151 445 47 6 490 3 lysS Lysine--tRNA ligase Synechococcus sp. (strain CC9311)
Q3B365 2.15e-151 444 46 7 508 3 lysS Lysine--tRNA ligase Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
A7HM68 2.62e-151 444 45 6 494 3 lysS Lysine--tRNA ligase Fervidobacterium nodosum (strain ATCC 35602 / DSM 5306 / Rt17-B1)
O87821 5.3e-151 443 46 8 504 3 lysS Lysine--tRNA ligase Rhizobium meliloti (strain 1021)
A7NFC6 7.47e-151 442 46 5 492 3 lysS Lysine--tRNA ligase Roseiflexus castenholzii (strain DSM 13941 / HLO8)
B5ZQW5 7.92e-151 443 46 7 485 3 lysS Lysine--tRNA ligase Rhizobium leguminosarum bv. trifolii (strain WSM2304)
A5FRN5 2.95e-150 441 45 5 483 3 lysS Lysine--tRNA ligase Dehalococcoides mccartyi (strain ATCC BAA-2100 / JCM 16839 / KCTC 5957 / BAV1)
O67258 4.94e-150 444 49 2 438 3 lysS Lysine--tRNA ligase Aquifex aeolicus (strain VF5)
A9B5T5 5.18e-150 441 47 4 490 3 lysS Lysine--tRNA ligase Herpetosiphon aurantiacus (strain ATCC 23779 / DSM 785 / 114-95)
Q7V9Q0 1.12e-149 440 46 7 498 3 lysS Lysine--tRNA ligase Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
Q3ZWX9 1.62e-149 439 45 5 483 3 lysS Lysine--tRNA ligase Dehalococcoides mccartyi (strain CBDB1)
A6UDA0 1.72e-149 439 46 7 489 3 lysS Lysine--tRNA ligase Sinorhizobium medicae (strain WSM419)
A8F4K1 5.43e-148 436 45 8 494 3 lysS Lysine--tRNA ligase Pseudothermotoga lettingae (strain ATCC BAA-301 / DSM 14385 / NBRC 107922 / TMO)
Q9X231 8.58e-148 435 44 3 487 3 lysS Lysine--tRNA ligase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q1MBK9 8.85e-148 435 45 7 485 3 lysS Lysine--tRNA ligase Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
A9WK04 1.47e-147 434 46 6 490 3 lysS Lysine--tRNA ligase Chloroflexus aurantiacus (strain ATCC 29366 / DSM 635 / J-10-fl)
Q8RG52 1.93e-147 434 48 5 443 3 lysS Lysine--tRNA ligase Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q3B0J9 2.46e-147 434 47 6 492 3 lysS Lysine--tRNA ligase Synechococcus sp. (strain CC9902)
Q2FSN8 2.54e-147 434 47 4 469 3 lysS Lysine--tRNA ligase Methanospirillum hungatei JF-1 (strain ATCC 27890 / DSM 864 / NBRC 100397 / JF-1)
Q8A5W4 7.61e-147 436 48 6 454 3 lysS Lysine--tRNA ligase Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
B1LAX6 2.02e-146 432 44 6 489 3 lysS Lysine--tRNA ligase Thermotoga sp. (strain RQ2)
A5ILE6 2.26e-146 432 44 6 489 3 lysS Lysine--tRNA ligase Thermotoga petrophila (strain ATCC BAA-488 / DSM 13995 / JCM 10881 / RKU-1)
B4UGU5 1.11e-145 430 45 7 500 3 lysS Lysine--tRNA ligase Anaeromyxobacter sp. (strain K)
B8JFW2 1.11e-145 430 45 7 500 3 lysS Lysine--tRNA ligase Anaeromyxobacter dehalogenans (strain 2CP-1 / ATCC BAA-258)
Q6YPY6 4.05e-145 429 44 4 492 3 lysS Lysine--tRNA ligase Onion yellows phytoplasma (strain OY-M)
Q2IPX5 2.54e-144 427 45 7 500 3 lysS Lysine--tRNA ligase Anaeromyxobacter dehalogenans (strain 2CP-C)
Q2K424 5.37e-144 426 45 8 489 3 lysS Lysine--tRNA ligase Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
B3Q0S4 9.44e-144 425 45 8 489 3 lysS Lysine--tRNA ligase Rhizobium etli (strain CIAT 652)
Q2NJZ8 1.09e-143 424 46 4 453 3 lysS Lysine--tRNA ligase Aster yellows witches'-broom phytoplasma (strain AYWB)
Q3Z8X9 3.08e-143 424 46 6 486 3 lysS Lysine--tRNA ligase Dehalococcoides mccartyi (strain ATCC BAA-2266 / KCTC 15142 / 195)
Q8U7H6 3.29e-143 423 45 7 489 3 lysS Lysine--tRNA ligase Agrobacterium fabrum (strain C58 / ATCC 33970)
Q98QG4 6.11e-143 422 46 7 486 3 lysS2 Lysine--tRNA ligase 2 Mycoplasmopsis pulmonis (strain UAB CTIP)
B3PNH7 3.01e-141 418 44 6 484 3 lysS Lysine--tRNA ligase Metamycoplasma arthritidis (strain 158L3-1)
Q6KIP6 3.86e-141 418 45 6 484 3 lysS Lysine--tRNA ligase Mycoplasma mobile (strain ATCC 43663 / 163K / NCTC 11711)
B1VA97 1.39e-140 417 45 4 479 3 lysS Lysine--tRNA ligase Phytoplasma australiense
Q49158 8.8e-140 414 45 6 459 3 lysS Lysine--tRNA ligase Mycoplasmopsis fermentans (strain ATCC 19989 / NBRC 14854 / NCTC 10117 / PG18)
P41255 5.88e-139 412 45 6 496 1 lysS Lysine--tRNA ligase Thermus thermophilus
Q5SJG7 5.88e-139 412 45 6 496 3 lysS Lysine--tRNA ligase Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
Q72JT9 5.88e-139 412 45 6 496 3 lysS Lysine--tRNA ligase Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
P46191 1.02e-138 412 45 6 489 3 lysS Lysine--tRNA ligase Metamycoplasma hominis (strain ATCC 23114 / DSM 25592 / NBRC 14850 / NCTC 10111 / PG21)
Q98QH1 1.8e-138 411 45 7 486 3 lysS1 Lysine--tRNA ligase 1 Mycoplasmopsis pulmonis (strain UAB CTIP)
Q8PVP6 2.53e-138 411 44 6 489 3 lysS2 Lysine--tRNA ligase 2 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q9RXE1 1.81e-136 407 48 5 438 3 lysS Lysine--tRNA ligase Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
Q9LJE2 1.22e-135 407 43 10 514 2 OVA5 Lysine--tRNA ligase, chloroplastic/mitochondrial Arabidopsis thaliana
Q8TSN5 6.99e-135 402 43 4 488 3 lysS2 Lysine--tRNA ligase 2 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q15046 3.05e-133 401 44 8 509 1 KARS1 Lysine--tRNA ligase Homo sapiens
Q7NC34 7.55e-133 397 40 9 496 3 lysS Lysine--tRNA ligase Mycoplasmoides gallisepticum (strain R(low / passage 15 / clone 2))
Q4AAC7 1.07e-132 396 43 7 497 3 lysS Lysine--tRNA ligase Mesomycoplasma hyopneumoniae (strain J / ATCC 25934 / NCTC 10110)
Q4A8F8 2.23e-132 395 43 7 497 3 lysS Lysine--tRNA ligase Mesomycoplasma hyopneumoniae (strain 7448)
Q99MN1 5.04e-132 398 43 8 509 1 Kars1 Lysine--tRNA ligase Mus musculus
Q8EUS8 1.44e-131 393 42 5 492 3 lysS Lysine--tRNA ligase Malacoplasma penetrans (strain HF-2)
P37879 1.48e-131 397 43 8 509 1 KARS1 Lysine--tRNA ligase Cricetulus griseus
Q5XIM7 6.11e-131 396 43 9 511 1 Kars1 Lysine--tRNA ligase Rattus norvegicus
Q9UUE6 2.02e-130 394 42 6 510 3 krs1 Lysine--tRNA ligase, cytoplasmic Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9PR83 3.67e-130 390 41 9 487 3 lysS Lysine--tRNA ligase Ureaplasma parvum serovar 3 (strain ATCC 700970)
B1AI47 3.67e-130 390 41 9 487 3 lysS Lysine--tRNA ligase Ureaplasma parvum serovar 3 (strain ATCC 27815 / 27 / NCTC 11736)
Q4A5F3 2.07e-128 385 42 7 468 3 lysS Lysine--tRNA ligase Mycoplasmopsis synoviae (strain 53)
B5ZAP2 2.11e-128 385 41 9 487 3 lysS Lysine--tRNA ligase Ureaplasma urealyticum serovar 10 (strain ATCC 33699 / Western)
Q8SS56 2.63e-128 386 40 5 488 3 ECU04_0580 Probable lysine--tRNA ligase, cytoplasmic Encephalitozoon cuniculi (strain GB-M1)
P75500 9.82e-126 379 40 8 492 3 lysS Lysine--tRNA ligase Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
A6W5H6 1.28e-124 376 41 13 508 3 lysS Lysine--tRNA ligase Kineococcus radiotolerans (strain ATCC BAA-149 / DSM 14245 / SRS30216)
P15180 1.29e-124 379 41 9 516 1 KRS1 Lysine--tRNA ligase, cytoplasmic Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q6F2U9 3.83e-123 375 40 9 518 2 Os03g0586800 Lysine--tRNA ligase Oryza sativa subsp. japonica
Q43776 1.95e-122 373 40 9 537 2 LYSRS Lysine--tRNA ligase Solanum lycopersicum
C4V8R9 3.9e-122 370 40 5 500 3 NCER_100909 Probable lysine--tRNA ligase, cytoplasmic Vairimorpha ceranae (strain BRL01)
P47382 3.66e-121 367 40 9 496 3 lysS Lysine--tRNA ligase Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q22099 2.16e-120 367 41 8 490 3 kars-1 Lysine--tRNA ligase Caenorhabditis elegans
A9CS74 8.68e-120 364 39 9 521 3 EBI_25548 Probable lysine--tRNA ligase, cytoplasmic Enterocytozoon bieneusi (strain H348)
P95970 1.19e-116 355 39 8 497 3 lysS Lysine--tRNA ligase Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
A0A120HYZ1 1.46e-114 353 37 8 505 2 cla4 Lysine--tRNA ligase cla4 Cladosporium cladosporioides
A4T9U2 9.31e-114 364 40 7 501 3 lysX Lysylphosphatidylglycerol biosynthesis bifunctional protein LysX Mycolicibacterium gilvum (strain PYR-GCK)
Q9ZPI1 1.92e-113 351 38 8 527 1 At3g11710 Lysine--tRNA ligase, cytoplasmic Arabidopsis thaliana
O84786 2.14e-110 340 40 10 505 3 lysS Lysine--tRNA ligase Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
Q3KKR1 2.14e-110 340 40 10 505 3 lysS Lysine--tRNA ligase Chlamydia trachomatis serovar A (strain ATCC VR-571B / DSM 19440 / HAR-13)
A1TAC7 3.36e-110 355 39 8 503 3 lysX Lysylphosphatidylglycerol biosynthesis bifunctional protein LysX Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
Q821U6 1.19e-109 338 41 12 507 3 lysS Lysine--tRNA ligase Chlamydia caviae (strain ATCC VR-813 / DSM 19441 / 03DC25 / GPIC)
B0BAN6 1.26e-109 338 39 10 505 1 lysS Lysine--tRNA ligase Chlamydia trachomatis serovar L2b (strain UCH-1/proctitis)
B0B907 1.26e-109 338 39 10 505 3 lysS Lysine--tRNA ligase Chlamydia trachomatis serovar L2 (strain ATCC VR-902B / DSM 19102 / 434/Bu)
P46861 2.74e-109 337 38 10 502 3 lysS Lysine--tRNA ligase Mycobacterium leprae (strain TN)
A4T5M9 3.68e-109 336 40 10 491 3 lysS Lysine--tRNA ligase Mycolicibacterium gilvum (strain PYR-GCK)
A5U8S4 4.58e-108 333 37 8 506 3 lysS Lysine--tRNA ligase Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
C1AI57 4.58e-108 333 37 8 506 3 lysS Lysine--tRNA ligase Mycobacterium bovis (strain BCG / Tokyo 172 / ATCC 35737 / TMC 1019)
A1KPT4 4.58e-108 333 37 8 506 3 lysS Lysine--tRNA ligase Mycobacterium bovis (strain BCG / Pasteur 1173P2)
P9WFU9 4.58e-108 333 37 8 506 1 lysS1 Lysine--tRNA ligase 1 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WFU8 4.58e-108 333 37 8 506 3 lysS1 Lysine--tRNA ligase 1 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P67608 4.58e-108 333 37 8 506 3 lysS1 Lysine--tRNA ligase 1 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q5L545 5.13e-108 334 40 12 505 3 lysS Lysine--tRNA ligase Chlamydia abortus (strain DSM 27085 / S26/3)
Q1B7P4 7.33e-108 348 38 7 501 3 lysX Lysylphosphatidylglycerol biosynthesis bifunctional protein LysX Mycobacterium sp. (strain MCS)
A1UHB3 7.33e-108 348 38 7 501 3 lysX Lysylphosphatidylglycerol biosynthesis bifunctional protein LysX Mycobacterium sp. (strain KMS)
A0QYV1 1.68e-107 348 38 8 516 3 lysX Lysylphosphatidylglycerol biosynthesis bifunctional protein LysX Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
A3Q0V0 1.15e-106 345 38 7 501 3 lysX Lysylphosphatidylglycerol biosynthesis bifunctional protein LysX Mycobacterium sp. (strain JLS)
Q9PLE1 4.02e-106 329 39 12 509 3 lysS Lysine--tRNA ligase Chlamydia muridarum (strain MoPn / Nigg)
D0LB45 7.66e-106 344 40 4 444 3 lysX Lysylphosphatidylglycerol biosynthesis bifunctional protein LysX Gordonia bronchialis (strain ATCC 25592 / DSM 43247 / BCRC 13721 / JCM 3198 / KCTC 3076 / NBRC 16047 / NCTC 10667)
B2HR11 7.8e-106 343 39 6 495 3 lysX Lysylphosphatidylglycerol biosynthesis bifunctional protein LysX Mycobacterium marinum (strain ATCC BAA-535 / M)
Q255U2 1.62e-105 328 40 13 507 3 lysS Lysine--tRNA ligase Chlamydia felis (strain Fe/C-56)
A0PP57 2.57e-105 342 39 6 495 3 lysX Lysylphosphatidylglycerol biosynthesis bifunctional protein LysX Mycobacterium ulcerans (strain Agy99)
C0ZL89 3.05e-105 342 37 8 504 3 lysX Lysylphosphatidylglycerol biosynthesis bifunctional protein LysX Rhodococcus erythropolis (strain PR4 / NBRC 100887)
Q740J9 8.33e-105 342 37 8 500 3 lysX Lysylphosphatidylglycerol biosynthesis bifunctional protein LysX Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
A0QHC4 8.68e-105 342 37 8 500 3 lysX Lysylphosphatidylglycerol biosynthesis bifunctional protein LysX Mycobacterium avium (strain 104)
Q4JCI5 2.1e-104 324 37 11 497 3 lysS Lysine--tRNA ligase Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770)
Q9Z6X5 2.34e-104 325 39 12 512 3 lysS Lysine--tRNA ligase Chlamydia pneumoniae
C6DS31 8.86e-104 339 38 6 502 3 lysX Lysylphosphatidylglycerol biosynthesis bifunctional protein LysX Mycobacterium tuberculosis (strain KZN 1435 / MDR)
P9WFU7 1.06e-103 338 38 6 502 1 lysX Lysylphosphatidylglycerol biosynthesis bifunctional protein LysX Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WFU6 1.06e-103 338 38 6 502 3 lysX Lysylphosphatidylglycerol biosynthesis bifunctional protein LysX Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5WMW1 1.06e-103 338 38 6 502 3 lysX Lysylphosphatidylglycerol biosynthesis bifunctional protein LysX Mycobacterium tuberculosis (strain F11)
A5U2Z7 1.06e-103 338 38 6 502 3 lysX Lysylphosphatidylglycerol biosynthesis bifunctional protein LysX Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
Q5Z3P6 2.12e-103 337 39 5 446 3 lysX Lysylphosphatidylglycerol biosynthesis bifunctional protein LysX Nocardia farcinica (strain IFM 10152)
C1ANR3 2.56e-103 337 38 6 502 3 lysX Lysylphosphatidylglycerol biosynthesis bifunctional protein LysX Mycobacterium bovis (strain BCG / Tokyo 172 / ATCC 35737 / TMC 1019)
A1KJ57 2.56e-103 337 38 6 502 3 lysX Lysylphosphatidylglycerol biosynthesis bifunctional protein LysX Mycobacterium bovis (strain BCG / Pasteur 1173P2)
C1B7Z5 3.9e-103 336 37 8 503 3 lysX Lysylphosphatidylglycerol biosynthesis bifunctional protein LysX Rhodococcus opacus (strain B4)
Q7VEV7 6.32e-103 337 38 6 502 3 lysX Lysylphosphatidylglycerol biosynthesis bifunctional protein LysX Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q0SAA3 1.8e-102 334 37 8 503 3 lysX Lysylphosphatidylglycerol biosynthesis bifunctional protein LysX Rhodococcus jostii (strain RHA1)
B1MAX9 5.12e-98 322 36 8 493 3 lysX Lysylphosphatidylglycerol biosynthesis bifunctional protein LysX Mycobacteroides abscessus (strain ATCC 19977 / DSM 44196 / CCUG 20993 / CIP 104536 / JCM 13569 / NCTC 13031 / TMC 1543 / L948)
Q9CC23 2.98e-97 320 37 8 504 3 lysX Lysylphosphatidylglycerol biosynthesis bifunctional protein LysX Mycobacterium leprae (strain TN)
B8ZRJ4 2.98e-97 320 37 8 504 3 lysX Lysylphosphatidylglycerol biosynthesis bifunctional protein LysX Mycobacterium leprae (strain Br4923)
O74858 6.17e-82 267 35 12 460 3 msk1 Lysine--tRNA ligase, mitochondrial Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P32048 1.02e-50 185 30 14 484 1 MSK1 Lysine--tRNA ligase, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
C6DFN3 1.53e-43 159 32 9 333 3 epmA Elongation factor P--(R)-beta-lysine ligase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
P57642 4.11e-43 158 30 6 323 3 epmA Elongation factor P--(R)-beta-lysine ligase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
B5R9A5 1.01e-42 157 32 10 325 3 epmA Elongation factor P--(R)-beta-lysine ligase Salmonella gallinarum (strain 287/91 / NCTC 13346)
Q89A27 2.66e-42 156 33 7 318 3 epmA Elongation factor P--(R)-beta-lysine ligase Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
B5FRL4 3.86e-42 156 32 8 325 3 epmA Elongation factor P--(R)-beta-lysine ligase Salmonella dublin (strain CT_02021853)
B8D8A2 5.63e-42 155 30 6 323 3 epmA Elongation factor P--(R)-beta-lysine ligase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain Tuc7)
B8D8E5 5.63e-42 155 30 6 323 3 epmA Elongation factor P--(R)-beta-lysine ligase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain 5A)
Q9ZJ12 6.94e-42 155 32 8 327 1 epmA Elongation factor P--(R)-beta-lysine ligase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TF92 6.94e-42 155 32 8 327 3 epmA Elongation factor P--(R)-beta-lysine ligase Salmonella heidelberg (strain SL476)
B5R019 6.94e-42 155 32 8 327 3 epmA Elongation factor P--(R)-beta-lysine ligase Salmonella enteritidis PT4 (strain P125109)
B5F2M2 6.94e-42 155 32 8 327 3 epmA Elongation factor P--(R)-beta-lysine ligase Salmonella agona (strain SL483)
Q8Z197 1.12e-41 154 32 8 325 3 epmA Elongation factor P--(R)-beta-lysine ligase Salmonella typhi
B4TSD9 1.73e-41 154 31 8 327 3 epmA Elongation factor P--(R)-beta-lysine ligase Salmonella schwarzengrund (strain CVM19633)
C0Q6B6 1.73e-41 154 31 8 327 3 epmA Elongation factor P--(R)-beta-lysine ligase Salmonella paratyphi C (strain RKS4594)
A9N413 1.73e-41 154 31 8 327 3 epmA Elongation factor P--(R)-beta-lysine ligase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4T2Q3 1.73e-41 154 31 8 327 3 epmA Elongation factor P--(R)-beta-lysine ligase Salmonella newport (strain SL254)
Q57GN3 1.73e-41 154 31 8 327 3 epmA Elongation factor P--(R)-beta-lysine ligase Salmonella choleraesuis (strain SC-B67)
B5BKG8 1.75e-41 154 31 8 327 3 epmA Elongation factor P--(R)-beta-lysine ligase Salmonella paratyphi A (strain AKU_12601)
Q5PLH2 1.75e-41 154 31 8 327 3 epmA Elongation factor P--(R)-beta-lysine ligase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
A1JIQ4 2.33e-41 154 31 10 326 3 epmA Elongation factor P--(R)-beta-lysine ligase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
B7LLT9 2.51e-41 154 31 8 329 3 epmA Elongation factor P--(R)-beta-lysine ligase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q3IFP4 3.97e-41 153 30 7 343 3 epmA Elongation factor P--(R)-beta-lysine ligase Pseudoalteromonas translucida (strain TAC 125)
Q58950 6.46e-41 155 29 17 458 3 aspS Aspartate--tRNA(Asp/Asn) ligase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
A8AMP1 8.08e-41 152 31 8 327 3 epmA Elongation factor P--(R)-beta-lysine ligase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
A9MFQ6 8.68e-41 152 31 8 327 3 epmA Elongation factor P--(R)-beta-lysine ligase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
A4W5Q2 9.72e-41 152 30 8 324 3 epmA Elongation factor P--(R)-beta-lysine ligase Enterobacter sp. (strain 638)
A6TH74 2.68e-40 151 32 8 325 3 epmA Elongation factor P--(R)-beta-lysine ligase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q7VPM9 2.81e-40 151 29 5 330 3 epmA Elongation factor P--(R)-beta-lysine ligase Haemophilus ducreyi (strain 35000HP / ATCC 700724)
C4K3U1 3.33e-40 150 28 5 332 3 epmA Elongation factor P--(R)-beta-lysine ligase Hamiltonella defensa subsp. Acyrthosiphon pisum (strain 5AT)
B5Y345 3.76e-40 150 31 8 326 3 epmA Elongation factor P--(R)-beta-lysine ligase Klebsiella pneumoniae (strain 342)
B4EWY8 5.11e-40 150 31 5 323 3 epmA Elongation factor P--(R)-beta-lysine ligase Proteus mirabilis (strain HI4320)
B1ITP1 7.47e-40 150 31 8 329 3 epmA Elongation factor P--(R)-beta-lysine ligase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P0A8P0 7.62e-40 149 31 8 329 3 epmA Elongation factor P--(R)-beta-lysine ligase Shigella flexneri
Q0SXC1 7.62e-40 149 31 8 329 3 epmA Elongation factor P--(R)-beta-lysine ligase Shigella flexneri serotype 5b (strain 8401)
B2TY33 7.62e-40 149 31 8 329 3 epmA Elongation factor P--(R)-beta-lysine ligase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q1R3A2 7.62e-40 149 31 8 329 3 epmA Elongation factor P--(R)-beta-lysine ligase Escherichia coli (strain UTI89 / UPEC)
B1LQH8 7.62e-40 149 31 8 329 3 epmA Elongation factor P--(R)-beta-lysine ligase Escherichia coli (strain SMS-3-5 / SECEC)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS09900
Feature type CDS
Gene lysS
Product lysine--tRNA ligase
Location 2147151 - 2148665 (strand: -1)
Length 1515 (nucleotides) / 504 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_814
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00152 tRNA synthetases class II (D, K and N)
PF01336 OB-fold nucleic acid binding domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1190 Translation, ribosomal structure and biogenesis (J) J Lysyl-tRNA synthetase (class II)

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K04567 lysyl-tRNA synthetase, class II [EC:6.1.1.6] Aminoacyl-tRNA biosynthesis -

Protein Sequence

MSQQQQGAEQAPDLNNELQTRREKLSALRDNGNAFPNDFRRDAMSDELHQKYDAMSAEELDAANVEVAIAGRMMTRRIMGKASFATLQDMGGRIQLYVSRDDLPEGVYNEQFKKWDLGDILGGRGRVFKTKTGELSIHCTELRLLTKALRPLPDKFHGLADQETRYRQRYLDLISNENSRNTFKIRSKIMSAIRQFMVNKGFMEVETPMMQTIPGGASARPFITHHNALDIDMYLRIAPELYLKRLVVGGFDRVFEINRNFRNEGVSPRHNPEFTMMELYMAYADYRDLIELTEELFRTLTQDVLGSTIVKYGDEEFDFGKPFEKLTMKEAICKYRPETNMADLDDMDKAVAIAQSIGIKIEKSWGLGRVQCEIFEEVAESHLIQPTFIIEYPAEVSPLARRNDDNPFITDRFEFFIGGREIGNGFSELNDAQDQAERFEEQVRQKEAGDDEAMFFDHDYITALEHGLPPTAGLGIGIDRMVMLFTNSHTIRDVILFPAMRPGK

Flanking regions ( +/- flanking 50bp)

CTCGATAAATTTATTGAAGCTAGCTTAAAAGCGGGCCTGTGAGGAAAAACATGTCGCAACAGCAACAAGGTGCGGAGCAGGCACCTGATTTAAATAACGAACTGCAAACTCGCCGCGAAAAATTATCAGCTTTACGTGATAATGGTAACGCATTCCCAAATGATTTCCGCAGAGATGCCATGTCTGACGAATTACATCAAAAATATGATGCAATGAGTGCAGAAGAGTTAGACGCTGCTAATGTGGAAGTTGCTATTGCAGGTCGTATGATGACTCGCCGTATTATGGGGAAAGCATCTTTCGCTACATTGCAAGACATGGGCGGCCGTATCCAGCTTTATGTCTCTCGTGATGATCTGCCTGAAGGCGTTTATAACGAGCAGTTTAAAAAATGGGATCTCGGTGATATTTTAGGTGGCCGTGGCCGTGTATTTAAAACCAAAACAGGCGAACTGAGTATTCATTGTACTGAGTTACGTTTACTGACTAAAGCACTACGTCCGTTACCTGATAAATTCCACGGTCTAGCTGACCAAGAGACACGTTATCGTCAGCGTTATTTAGACCTGATCTCTAATGAAAATTCACGTAATACTTTTAAGATCCGCTCGAAAATCATGTCTGCTATTCGCCAATTTATGGTGAATAAAGGCTTTATGGAAGTAGAAACACCGATGATGCAAACTATCCCAGGTGGAGCAAGTGCACGTCCGTTTATCACTCACCATAACGCGCTAGATATTGATATGTATCTACGTATTGCACCTGAATTATATTTAAAACGTTTAGTTGTTGGTGGGTTTGATCGCGTTTTTGAAATCAACCGTAACTTCCGTAATGAAGGTGTATCACCACGTCATAACCCTGAGTTCACAATGATGGAACTCTATATGGCTTATGCTGATTATCGTGATCTTATCGAATTGACTGAAGAGTTATTCCGTACATTAACTCAAGATGTATTAGGTTCGACTATCGTCAAATATGGTGATGAAGAGTTTGATTTCGGTAAACCGTTTGAAAAACTGACCATGAAAGAAGCTATTTGCAAATATCGTCCAGAAACCAATATGGCTGATCTAGATGATATGGATAAAGCCGTTGCTATTGCTCAATCTATTGGTATTAAGATTGAAAAGAGTTGGGGGTTAGGCCGTGTTCAATGTGAAATTTTTGAAGAAGTAGCTGAAAGTCATTTGATCCAGCCAACTTTTATCATTGAATATCCAGCAGAAGTTTCACCACTGGCTCGCCGTAATGATGATAATCCATTTATTACCGATCGCTTTGAGTTCTTTATTGGTGGTCGTGAAATCGGTAATGGTTTCTCTGAGCTTAATGATGCGCAAGATCAAGCGGAGCGTTTTGAAGAGCAAGTTCGTCAAAAAGAAGCGGGTGACGATGAAGCCATGTTCTTTGATCATGACTATATCACTGCATTAGAGCATGGGTTACCACCTACAGCAGGTTTAGGTATTGGTATTGACCGTATGGTAATGCTATTTACCAATAGTCATACTATTCGTGATGTTATTTTATTCCCAGCGATGCGTCCGGGAAAATAATTATCGAATCACGATAAATACGCTATATGAAAAAAGCCATCGCAAGATGG