Homologs in group_1512

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_09780 FBDBKF_09780 100.0 Morganella morganii S1 lysR DNA-binding transcriptional regulator, LysR family
EHELCC_04580 EHELCC_04580 100.0 Morganella morganii S2 lysR DNA-binding transcriptional regulator, LysR family
LHKJJB_14050 LHKJJB_14050 100.0 Morganella morganii S3 lysR DNA-binding transcriptional regulator, LysR family
HKOGLL_12485 HKOGLL_12485 100.0 Morganella morganii S5 lysR DNA-binding transcriptional regulator, LysR family
F4V73_RS00565 F4V73_RS00565 81.1 Morganella psychrotolerans - LysR family transcriptional regulator
PMI_RS02835 PMI_RS02835 43.2 Proteus mirabilis HI4320 - LysR family transcriptional regulator

Distribution of the homologs in the orthogroup group_1512

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1512

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q9JXW7 6.07e-37 136 31 5 300 1 crgA HTH-type transcriptional regulator CrgA Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9JPU9 1.59e-36 135 30 5 300 1 crgA HTH-type transcriptional regulator CrgA Neisseria meningitidis serogroup C (strain 8013)
P30864 1.04e-33 128 29 4 297 3 yafC Uncharacterized HTH-type transcriptional regulator YafC Escherichia coli (strain K12)
P72131 4.95e-30 118 29 3 295 1 ptxR HTH-type transcriptional regulator PtxR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P43011 5.39e-30 117 28 3 283 3 HI_1364 Uncharacterized HTH-type transcriptional regulator HI_1364 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A0A0H2ZDG9 1.4e-29 117 28 6 302 3 PA14_22550 HTH-type transcriptional repressor PA14_22550 Pseudomonas aeruginosa (strain UCBPP-PA14)
P67662 1.52e-26 108 27 5 303 3 aaeR HTH-type transcriptional activator AaeR Escherichia coli (strain K12)
P67663 1.52e-26 108 27 5 303 3 aaeR HTH-type transcriptional activator AaeR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P67664 1.52e-26 108 27 5 303 3 aaeR HTH-type transcriptional activator AaeR Escherichia coli O157:H7
P77333 1.02e-25 106 27 4 287 1 pgrR HTH-type transcriptional regulator PgrR Escherichia coli (strain K12)
P52689 6.81e-23 99 26 3 283 3 ltrA Probable HTH-type transcriptional regulator LtrA Klebsiella pneumoniae
P76250 1.88e-22 97 28 4 296 1 dmlR HTH-type transcriptional regulator DmlR Escherichia coli (strain K12)
P75836 2.55e-20 92 26 4 288 3 ycaN Uncharacterized HTH-type transcriptional regulator YcaN Escherichia coli (strain K12)
P37641 2.07e-19 89 26 3 293 3 yhjC Uncharacterized HTH-type transcriptional regulator YhjC Escherichia coli (strain K12)
P37459 2.2e-16 81 31 5 178 3 sinR Probable HTH-type transcriptional regulator SinR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P39647 8.09e-16 79 23 6 285 1 cysL HTH-type transcriptional regulator CysL Bacillus subtilis (strain 168)
Q1R6S1 7.05e-15 77 23 5 298 3 ttdR HTH-type transcriptional activator TtdR Escherichia coli (strain UTI89 / UPEC)
Q8FDH0 7.05e-15 77 23 5 298 3 ttdR HTH-type transcriptional activator TtdR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P45463 7.47e-15 77 23 5 298 3 ttdR HTH-type transcriptional activator TtdR Escherichia coli (strain K12)
Q0TD46 8.48e-15 76 23 5 298 3 ttdR HTH-type transcriptional activator TtdR Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q8XBK9 1.31e-14 76 23 5 298 3 ttdR HTH-type transcriptional activator TtdR Escherichia coli O157:H7
P33634 1.16e-13 73 27 11 282 3 yfiE Uncharacterized HTH-type transcriptional regulator YfiE Escherichia coli (strain K12)
Q01610 2.44e-13 72 29 2 169 3 PA2220 Putative transcriptional regulator Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P52669 5.59e-13 71 30 1 143 3 ttuA HTH-type transcriptional regulator TtuA Agrobacterium vitis
P0A9F6 1.13e-12 70 34 3 150 1 gcvA Glycine cleavage system transcriptional activator Escherichia coli (strain K12)
P0A9F7 1.13e-12 70 34 3 150 3 gcvA Glycine cleavage system transcriptional activator Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9F8 1.13e-12 70 34 3 150 3 gcvA Glycine cleavage system transcriptional activator Escherichia coli O157:H7
P45099 2.06e-12 69 27 1 165 3 gcvA Glycine cleavage system transcriptional activator homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P12529 5.36e-12 68 25 3 241 1 ampR HTH-type transcriptional activator AmpR Citrobacter freundii
P52696 7.79e-12 68 24 1 166 3 ybhD Uncharacterized HTH-type transcriptional regulator YbhD Escherichia coli (strain K12)
P42507 7.85e-12 67 24 1 187 3 hvrB AhcY transcriptional activator HvrB Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
P05051 8.56e-12 67 25 3 241 3 ampR HTH-type transcriptional activator AmpR Enterobacter cloacae
Q57S50 2.37e-11 66 27 6 249 3 allS HTH-type transcriptional activator AllS Salmonella choleraesuis (strain SC-B67)
Q9S4Y7 2.83e-11 66 27 6 249 3 allS HTH-type transcriptional activator AllS Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q5PCH2 2.83e-11 66 27 6 249 3 allS HTH-type transcriptional activator AllS Salmonella paratyphi A (strain ATCC 9150 / SARB42)
P55576 4.87e-11 65 35 1 120 3 NGR_a02420 Uncharacterized HTH-type transcriptional regulator y4mQ Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P14145 6.57e-11 65 23 4 252 3 ampR HTH-type transcriptional activator AmpR Rhodobacter capsulatus
Q8Z8R3 7.91e-11 65 27 6 249 3 allS HTH-type transcriptional activator AllS Salmonella typhi
P27111 9.87e-11 64 33 0 115 1 cynR HTH-type transcriptional regulator CynR Escherichia coli (strain K12)
Q8X4M5 1.29e-10 64 33 0 115 3 cynR HTH-type transcriptional regulator CynR Escherichia coli O157:H7
O34685 1.45e-10 64 30 3 153 1 yofA HTH-type transcriptional regulator YofA Bacillus subtilis (strain 168)
P52666 2.42e-10 63 31 5 161 3 budR HTH-type transcriptional regulator BudR Raoultella terrigena
P0ACR0 2.44e-10 63 27 8 265 1 allS HTH-type transcriptional activator AllS Escherichia coli (strain K12)
P0ACR1 2.44e-10 63 27 8 265 3 allS HTH-type transcriptional activator AllS Escherichia coli O157:H7
Q8FK66 2.54e-10 63 27 8 265 3 allS HTH-type transcriptional activator AllS Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TKD7 2.54e-10 63 27 8 265 3 allS HTH-type transcriptional activator AllS Escherichia coli O6:K15:H31 (strain 536 / UPEC)
O06703 3.1e-10 63 27 8 266 3 bbuR HTH-type transcriptional regulator BbuR Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q57083 3.22e-10 63 35 2 115 1 perR HTH-type transcriptional regulator PerR Escherichia coli (strain K12)
Q1RF30 3.27e-10 63 27 8 265 3 allS HTH-type transcriptional activator AllS Escherichia coli (strain UTI89 / UPEC)
A1A8H0 3.27e-10 63 27 8 265 3 allS HTH-type transcriptional activator AllS Escherichia coli O1:K1 / APEC
P52658 4.1e-10 62 26 1 152 3 ampR HTH-type transcriptional activator AmpR Citrobacter koseri
P52683 4.2e-10 62 29 1 129 3 smeR Carbapenem-hydrolyzing beta-lactamase transcriptional activator Serratia marcescens
P52676 8.13e-10 62 30 1 130 3 nmcR Carbapenem-hydrolyzing beta-lactamase transcriptional activator Enterobacter cloacae
P46068 8.72e-10 62 26 1 177 2 dsdC HTH-type transcriptional regulator DsdC Escherichia coli (strain K12)
Q04778 1.18e-09 61 27 3 172 3 alsR HTH-type transcriptional regulator AlsR Bacillus subtilis (strain 168)
P96194 1.25e-09 58 35 0 97 3 None Uncharacterized HTH-type transcriptional regulator in ibpB-leuC intergenic region Azotobacter vinelandii
P0ACR8 1.49e-09 61 36 4 125 3 yfeR Uncharacterized HTH-type transcriptional regulator YfeR Shigella flexneri
P0ACR7 1.49e-09 61 36 4 125 3 yfeR Uncharacterized HTH-type transcriptional regulator YfeR Escherichia coli (strain K12)
P24734 5.51e-09 59 27 2 164 1 ampR HTH-type transcriptional activator AmpR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P71318 8.27e-09 59 21 6 287 3 oxyR Hydrogen peroxide-inducible genes activator Pectobacterium carotovorum subsp. carotovorum
Q9X725 9.31e-09 58 21 6 287 3 oxyR Hydrogen peroxide-inducible genes activator Dickeya chrysanthemi
P77744 1.44e-08 58 26 0 119 3 abgR HTH-type transcriptional regulator AbgR Escherichia coli (strain K12)
Q6B936 1.57e-08 58 33 3 119 3 rbcR Probable RuBisCO transcriptional regulator Gracilaria tenuistipitata var. liui
P52665 2.47e-08 55 38 0 88 3 budR HTH-type transcriptional regulator BudR (Fragment) Klebsiella aerogenes
Q765S2 2.89e-08 57 41 0 74 3 allS HTH-type transcriptional activator AllS Klebsiella pneumoniae
P23841 5.5e-08 56 41 0 72 3 xapR HTH-type transcriptional regulator XapR Escherichia coli (strain K12)
P0ACQ4 7.4e-08 56 22 5 277 1 oxyR DNA-binding transcriptional dual regulator OxyR Escherichia coli (strain K12)
P0ACQ5 7.4e-08 56 22 5 277 3 oxyR Hydrogen peroxide-inducible genes activator Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0ACQ6 7.4e-08 56 22 5 277 3 oxyR Hydrogen peroxide-inducible genes activator Escherichia coli O157:H7
O69772 7.6e-08 56 33 2 136 3 ampR HTH-type transcriptional activator AmpR Providencia stuartii
Q85G62 7.82e-08 56 32 3 128 3 rbcR Probable RuBisCO transcriptional regulator Cyanidioschyzon merolae (strain NIES-3377 / 10D)
P0A9G1 1.2e-07 55 25 8 260 3 metR HTH-type transcriptional regulator MetR Shigella flexneri
P0A9F9 1.2e-07 55 25 8 260 1 metR HTH-type transcriptional regulator MetR Escherichia coli (strain K12)
P0A9G0 1.2e-07 55 25 8 260 3 metR HTH-type transcriptional regulator MetR Escherichia coli O157:H7
Q55459 1.23e-07 55 26 5 176 1 cmpR HTH-type transcriptional activator CmpR Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P52686 1.28e-07 55 27 5 207 3 sdsB SDS degradation transcriptional activation protein Pseudomonas sp. (strain ATCC 19151)
P52660 1.34e-07 55 26 1 129 3 blaA HTH-type transcriptional regulator BlaA Proteus vulgaris
Q1XDT2 1.34e-07 55 31 4 122 3 rbcR Probable RuBisCO transcriptional regulator Neopyropia yezoensis
O35038 1.35e-07 55 30 3 123 3 ytlI HTH-type transcriptional regulator YtlI Bacillus subtilis (strain 168)
O32186 1.36e-07 55 20 5 283 3 yusT Uncharacterized HTH-type transcriptional regulator YusT Bacillus subtilis (strain 168)
Q8KA72 1.5e-07 55 25 2 172 3 metR HTH-type transcriptional regulator MetR Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
A7Z5E4 1.54e-07 55 26 8 238 3 yofA HTH-type transcriptional regulator YofA Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
Q57748 1.62e-07 55 31 1 110 3 MJ0300 Uncharacterized HTH-type transcriptional regulator MJ0300 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P51205 2.22e-07 55 31 4 122 3 rbcR Probable RuBisCO transcriptional regulator Porphyra purpurea
P25544 2.27e-07 54 26 3 146 3 rbcR RuBisCO operon transcriptional regulator Allochromatium vinosum
P44821 2.72e-07 54 29 0 116 3 ilvY HTH-type transcriptional activator IlvY Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P74422 2.91e-07 54 29 1 119 3 ntcB Probable nitrogen assimilation transcriptional activator Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
A0T0V5 3.05e-07 54 25 9 287 3 rbcR-A Probable RuBisCO transcriptional regulator Thalassiosira pseudonana
P39376 3.17e-07 54 25 8 264 1 yjiE HTH-type transcriptional regulator YjiE Escherichia coli (strain K12)
P39127 3.22e-07 54 23 11 312 3 citR HTH-type transcriptional regulator CitR Bacillus subtilis (strain 168)
P52691 3.52e-07 54 32 0 116 3 lrrA Probable HTH-type transcriptional regulator LrrA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P0ACR4 4.29e-07 53 24 7 291 1 yeiE Uncharacterized HTH-type transcriptional regulator YeiE Escherichia coli (strain K12)
P0ACR5 4.29e-07 53 24 7 291 3 yeiE Uncharacterized HTH-type transcriptional regulator YeiE Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0ACR6 4.29e-07 53 24 7 291 3 yeiE Uncharacterized HTH-type transcriptional regulator YeiE Escherichia coli O157:H7
P44418 4.29e-07 53 22 10 279 3 oxyR Hydrogen peroxide-inducible genes activator Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P49518 4.83e-07 53 24 10 282 3 rbcR Probable RuBisCO transcriptional regulator Trieres chinensis
P48271 5.3e-07 53 28 3 129 3 rbcR Probable RuBisCO transcriptional regulator Cyanophora paradoxa
P0C6D1 5.68e-07 53 23 9 287 3 irgB Iron-regulated virulence regulatory protein IrgB Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F9F9 5.84e-07 53 23 9 287 3 irgB Iron-regulated virulence regulatory protein IrgB Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
P96725 6.99e-07 53 23 9 281 3 ywqM Uncharacterized HTH-type transcriptional regulator YwqM Bacillus subtilis (strain 168)
P55181 7.58e-07 53 23 10 263 3 yxjO Uncharacterized HTH-type transcriptional regulator YxjO Bacillus subtilis (strain 168)
P73123 1.06e-06 53 32 4 122 3 rbcR Probable RuBisCO transcriptional regulator Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
O19892 1.1e-06 52 33 3 115 3 rbcR Probable RuBisCO transcriptional regulator Cyanidium caldarium
P45461 1.18e-06 52 21 4 242 3 ampR HTH-type transcriptional activator AmpR Yersinia enterocolitica
P42722 1.98e-06 52 28 3 125 3 cfxR HTH-type transcriptional regulator CfxR Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
O78432 2.27e-06 52 31 3 119 3 rbcR Probable RuBisCO transcriptional regulator Guillardia theta
Q3MCB5 2.33e-06 52 33 2 104 3 rbcR Probable RuBisCO transcriptional regulator Trichormus variabilis (strain ATCC 29413 / PCC 7937)
P0A2Q4 2.4e-06 52 25 10 258 3 metR HTH-type transcriptional regulator MetR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2Q5 2.4e-06 52 25 10 258 3 metR HTH-type transcriptional regulator MetR Salmonella typhi
P70785 2.62e-06 51 25 7 254 3 ttuA HTH-type transcriptional regulator TtuA Agrobacterium vitis
Q8YQ82 2.62e-06 51 33 2 104 3 rbcR Probable RuBisCO transcriptional regulator Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
P94387 2.94e-06 51 34 2 105 3 ycgK Uncharacterized HTH-type transcriptional regulator YcgK Bacillus subtilis (strain 168)
O32255 3.13e-06 51 27 4 123 3 yvbU Uncharacterized HTH-type transcriptional regulator YvbU Bacillus subtilis (strain 168)
P77559 3.32e-06 51 29 3 146 3 ynfL Uncharacterized HTH-type transcriptional regulator YnfL Escherichia coli (strain K12)
P52044 3.59e-06 51 35 1 77 3 ygfI Uncharacterized HTH-type transcriptional regulator YgfI Escherichia coli (strain K12)
Q9I6Z9 3.93e-06 51 34 0 72 3 bauR HTH-type transcriptional activator BauR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q6HPH4 5.84e-06 50 33 3 114 3 czcR HTH-type transcriptional regulator CzcR Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q81IX0 6.23e-06 50 33 3 114 3 czcR HTH-type transcriptional regulator CzcR Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q63H01 6.52e-06 50 33 3 114 3 czcR HTH-type transcriptional regulator CzcR Bacillus cereus (strain ZK / E33L)
Q73EY2 6.52e-06 50 33 3 114 3 czcR HTH-type transcriptional regulator CzcR Bacillus cereus (strain ATCC 10987 / NRS 248)
Q81VJ1 6.7e-06 50 33 3 114 3 czcR HTH-type transcriptional regulator CzcR Bacillus anthracis
A0R8S0 7.25e-06 50 33 3 114 3 czcR HTH-type transcriptional regulator CzcR Bacillus thuringiensis (strain Al Hakam)
A1JI47 7.92e-06 50 30 1 124 3 hdfR HTH-type transcriptional regulator HdfR Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q5N5I5 8.51e-06 50 28 3 131 3 cmpR HTH-type transcriptional activator CmpR Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q9F1R2 8.51e-06 50 28 3 131 1 cmpR HTH-type transcriptional activator CmpR Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q47141 1.2e-05 49 32 6 146 1 hcaR Hca operon transcriptional activator HcaR Escherichia coli (strain K12)
P77700 1.92e-05 48 40 0 60 1 yahB Uncharacterized HTH-type transcriptional regulator YahB Escherichia coli (strain K12)
O33812 2.41e-05 48 26 9 246 3 None Uncharacterized HTH-type transcriptional regulator in lacR 5'region (Fragment) Staphylococcus xylosus
P77309 3.5e-05 48 25 2 151 3 yneJ Uncharacterized HTH-type transcriptional regulator YneJ Escherichia coli (strain K12)
B1JQ39 3.57e-05 48 30 1 124 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66G51 3.57e-05 48 30 1 124 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TRF4 3.57e-05 48 30 1 124 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pestis (strain Pestoides F)
Q1CNN4 3.57e-05 48 30 1 124 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pestis bv. Antiqua (strain Nepal516)
A9R8E7 3.57e-05 48 30 1 124 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pestis bv. Antiqua (strain Angola)
Q8ZAA7 3.57e-05 48 30 1 124 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pestis
B2JZG4 3.57e-05 48 30 1 124 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1CBT5 3.57e-05 48 30 1 124 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pestis bv. Antiqua (strain Antiqua)
A7FD20 3.57e-05 48 30 1 124 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
P52659 4.06e-05 48 32 2 112 3 abaB HTH-type transcriptional regulator AbaB Streptomyces antibioticus
A4QH19 4.81e-05 47 31 2 117 1 shiR HTH-type transcriptional regulator ShiR Corynebacterium glutamicum (strain R)
P94632 5.36e-05 47 25 7 250 1 lysG Lysine export transcriptional regulatory protein LysG Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
P94678 0.000102 46 26 0 123 1 tsaR HTH-type transcriptional regulator TsaR Comamonas testosteroni
Q9HWH8 0.000108 46 28 4 164 3 nmoR HTH-type transcriptional regulator NmoR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
O33945 0.000116 46 32 2 104 3 None Probable cat1 operon transcriptional activator Acinetobacter lwoffii
P33651 0.00013 46 30 0 90 3 blaA HTH-type transcriptional regulator BlaA Streptomyces cacaoi
P42427 0.000137 45 31 0 70 3 tfdT HTH-type transcriptional regulator TfdT Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q8RQM5 0.000139 46 37 1 66 3 lysG Lysine export transcriptional regulatory protein LysG Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
P0DUU5 0.000165 46 23 9 294 1 aceR HTH-type transcriptional regulator AceR Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
P20667 0.000287 45 26 4 166 3 catR HTH-type transcriptional regulator CatR Pseudomonas putida
Q9X5P2 0.000344 45 32 0 76 2 oxyR Probable hydrogen peroxide-inducible genes activator Streptomyces viridosporus
P0A2Q2 0.000563 44 37 0 59 3 ilvY HTH-type transcriptional activator IlvY Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2Q3 0.000563 44 37 0 59 3 ilvY HTH-type transcriptional activator IlvY Salmonella typhi
P05827 0.000614 44 37 0 59 3 ilvY HTH-type transcriptional regulator IlvY Escherichia coli (strain K12)
B2TU26 0.000621 44 34 1 97 3 hdfR HTH-type transcriptional regulator HdfR Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q1R4H3 0.000718 43 34 1 97 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain UTI89 / UPEC)
P59369 0.000718 43 34 1 97 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TAV4 0.000718 43 34 1 97 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B7N260 0.000718 43 34 1 97 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O81 (strain ED1a)
B7MGH6 0.000718 43 34 1 97 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O45:K1 (strain S88 / ExPEC)
B5FN59 0.000791 43 35 0 80 3 hdfR HTH-type transcriptional regulator HdfR Salmonella dublin (strain CT_02021853)
B7NU32 0.000794 43 34 1 97 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O7:K1 (strain IAI39 / ExPEC)
Q3YVK2 0.000801 43 34 1 97 3 hdfR HTH-type transcriptional regulator HdfR Shigella sonnei (strain Ss046)
P0A8S0 0.000801 43 34 1 97 3 hdfR HTH-type transcriptional regulator HdfR Shigella flexneri
Q0SYV7 0.000801 43 34 1 97 3 hdfR HTH-type transcriptional regulator HdfR Shigella flexneri serotype 5b (strain 8401)
Q31UM0 0.000801 43 34 1 97 3 hdfR HTH-type transcriptional regulator HdfR Shigella boydii serotype 4 (strain Sb227)
B1LLU0 0.000801 43 34 1 97 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain SMS-3-5 / SECEC)
P0A8R9 0.000801 43 34 1 97 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain K12)
B1IWY2 0.000801 43 34 1 97 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A6M0 0.000801 43 34 1 97 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O9:H4 (strain HS)
B1X9Y2 0.000801 43 34 1 97 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain K12 / DH10B)
C4ZZ35 0.000801 43 34 1 97 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain K12 / MC4100 / BW2952)
B7UMM1 0.000801 43 34 1 97 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B4SYF7 0.000827 43 35 0 80 3 hdfR HTH-type transcriptional regulator HdfR Salmonella newport (strain SL254)
Q329U3 0.00083 43 34 1 97 3 hdfR HTH-type transcriptional regulator HdfR Shigella dysenteriae serotype 1 (strain Sd197)
B7LUJ5 0.00083 43 34 1 97 3 hdfR HTH-type transcriptional regulator HdfR Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B6I4A0 0.00083 43 34 1 97 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain SE11)
B7M5B2 0.00083 43 34 1 97 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O8 (strain IAI1)
B5YY14 0.00083 43 34 1 97 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8XAW1 0.00083 43 34 1 97 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O157:H7
B7L8A6 0.00083 43 34 1 97 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain 55989 / EAEC)
A7ZTW7 0.00083 43 34 1 97 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O139:H28 (strain E24377A / ETEC)
P0A2Q0 0.000843 43 35 0 80 3 hdfR HTH-type transcriptional regulator HdfR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2Q1 0.000843 43 35 0 80 3 hdfR HTH-type transcriptional regulator HdfR Salmonella typhi
B5BIR0 0.000843 43 35 0 80 3 hdfR HTH-type transcriptional regulator HdfR Salmonella paratyphi A (strain AKU_12601)
C0Q2U0 0.000843 43 35 0 80 3 hdfR HTH-type transcriptional regulator HdfR Salmonella paratyphi C (strain RKS4594)
A9MXD5 0.000843 43 35 0 80 3 hdfR HTH-type transcriptional regulator HdfR Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PJZ0 0.000843 43 35 0 80 3 hdfR HTH-type transcriptional regulator HdfR Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4TAZ8 0.000843 43 35 0 80 3 hdfR HTH-type transcriptional regulator HdfR Salmonella heidelberg (strain SL476)
B5EZ22 0.000843 43 35 0 80 3 hdfR HTH-type transcriptional regulator HdfR Salmonella agona (strain SL483)
B7NF72 0.000846 43 34 1 97 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B4TNR5 0.000866 43 35 0 80 3 hdfR HTH-type transcriptional regulator HdfR Salmonella schwarzengrund (strain CVM19633)

  • Number of RefSeq hits:

General

Source Morganella morganii S4
Locus tag NLDBIP_04580
Feature type CDS
Gene lysR
Product DNA-binding transcriptional regulator, LysR family
Location 242139 - 243032 (strand: 1)
Length 894 (nucleotides) / 297 (amino acids)

Contig

Accession ZDB_520
Length 336657 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1512
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00126 Bacterial regulatory helix-turn-helix protein, lysR family
PF03466 LysR substrate binding domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0583 Transcription (K) K DNA-binding transcriptional regulator, LysR family

Protein Sequence

MLTAVEKINTFIYVVDTGSFTRAAARLNLSKSVVSLHIKALESELSTTLLHRTTRQFTLTEAGQALYQQFKPLLQQFDSAMDAVRTGTAQPQGPLSFSAAAEFGGQFLLPQLPAFTKRYPLIRADYRVDHSLSDLIALKLDVVFRLGTLSDSGLRFRKLADFPVCYVATPAFIRQHRVTESSDPAALPFIANSNLTARINWRQHLPAPDNRVFISNSIQAIRTMTLAHQGYSLLPVWYIREQLTEEKLVPVFTRQPVPDQSINMVFPPAAHLPQKVRVFIDYFARFFADNAALLRYP

Flanking regions ( +/- flanking 50bp)

CGTCTATGCATCAAAATAGACAATACTGTTTGAAAAAACGAAACAATCTTATGCTGACAGCCGTTGAGAAGATCAATACCTTTATTTATGTTGTGGATACCGGTTCCTTTACCCGGGCCGCTGCACGCCTGAATCTGAGCAAATCGGTGGTCAGCCTGCATATCAAAGCCCTGGAGTCTGAACTCAGCACCACACTGCTGCACCGGACCACACGGCAGTTTACGCTGACGGAAGCAGGACAGGCGCTGTATCAGCAATTCAAACCACTGTTACAACAATTCGACAGCGCGATGGATGCCGTCAGAACGGGGACAGCACAACCACAGGGGCCGCTGAGTTTCAGTGCCGCCGCAGAATTCGGCGGACAATTTCTGCTGCCGCAGTTGCCTGCTTTCACAAAGCGCTATCCGCTGATCAGAGCAGATTACCGCGTCGATCACAGTCTGAGTGACTTGATTGCCCTGAAACTGGATGTGGTGTTCCGGCTGGGAACGCTGAGTGACAGCGGTCTGCGGTTCCGCAAACTCGCTGACTTTCCGGTCTGTTATGTGGCAACACCGGCGTTTATCCGGCAACACCGCGTGACAGAAAGCAGTGATCCCGCCGCTCTGCCCTTTATCGCCAACAGCAACCTGACCGCCCGTATCAACTGGCGTCAGCATCTGCCCGCGCCGGACAACCGGGTGTTTATCTCTAATTCGATTCAGGCGATCCGCACCATGACACTGGCACATCAGGGTTACAGTCTGCTGCCGGTCTGGTATATCAGAGAGCAACTGACAGAGGAAAAACTGGTTCCGGTATTCACCCGTCAGCCGGTACCGGATCAGAGCATCAATATGGTCTTTCCGCCCGCGGCACATCTGCCGCAGAAGGTCCGGGTGTTTATTGATTATTTTGCCCGCTTTTTTGCAGATAATGCCGCATTACTGCGCTATCCGTGAACCGGAGCGGAAACAGAAAAGAAAAAAAGCCGTTCAGATGAACGGCTTTT