Homologs in group_1512

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_09780 FBDBKF_09780 81.1 Morganella morganii S1 lysR DNA-binding transcriptional regulator, LysR family
EHELCC_04580 EHELCC_04580 81.1 Morganella morganii S2 lysR DNA-binding transcriptional regulator, LysR family
NLDBIP_04580 NLDBIP_04580 81.1 Morganella morganii S4 lysR DNA-binding transcriptional regulator, LysR family
LHKJJB_14050 LHKJJB_14050 81.1 Morganella morganii S3 lysR DNA-binding transcriptional regulator, LysR family
HKOGLL_12485 HKOGLL_12485 81.1 Morganella morganii S5 lysR DNA-binding transcriptional regulator, LysR family
PMI_RS02835 PMI_RS02835 44.9 Proteus mirabilis HI4320 - LysR family transcriptional regulator

Distribution of the homologs in the orthogroup group_1512

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1512

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P30864 8.66e-40 144 30 4 295 3 yafC Uncharacterized HTH-type transcriptional regulator YafC Escherichia coli (strain K12)
Q9JPU9 2.74e-36 135 29 5 300 1 crgA HTH-type transcriptional regulator CrgA Neisseria meningitidis serogroup C (strain 8013)
Q9JXW7 6.22e-35 131 29 5 300 1 crgA HTH-type transcriptional regulator CrgA Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
A0A0H2ZDG9 5.41e-34 129 29 3 298 3 PA14_22550 HTH-type transcriptional repressor PA14_22550 Pseudomonas aeruginosa (strain UCBPP-PA14)
P43011 4.05e-30 118 29 3 285 3 HI_1364 Uncharacterized HTH-type transcriptional regulator HI_1364 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P72131 2.73e-28 114 30 3 295 1 ptxR HTH-type transcriptional regulator PtxR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P67662 4.2e-27 110 27 3 302 3 aaeR HTH-type transcriptional activator AaeR Escherichia coli (strain K12)
P67663 4.2e-27 110 27 3 302 3 aaeR HTH-type transcriptional activator AaeR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P67664 4.2e-27 110 27 3 302 3 aaeR HTH-type transcriptional activator AaeR Escherichia coli O157:H7
P77333 3.03e-25 105 25 5 297 1 pgrR HTH-type transcriptional regulator PgrR Escherichia coli (strain K12)
P76250 4.9e-25 105 28 5 300 1 dmlR HTH-type transcriptional regulator DmlR Escherichia coli (strain K12)
P75836 3.36e-22 97 26 3 289 3 ycaN Uncharacterized HTH-type transcriptional regulator YcaN Escherichia coli (strain K12)
P37641 1.69e-21 95 26 2 296 3 yhjC Uncharacterized HTH-type transcriptional regulator YhjC Escherichia coli (strain K12)
P39647 5.83e-19 88 24 6 285 1 cysL HTH-type transcriptional regulator CysL Bacillus subtilis (strain 168)
P52689 2.57e-18 87 23 3 282 3 ltrA Probable HTH-type transcriptional regulator LtrA Klebsiella pneumoniae
Q1R6S1 7.97e-17 82 27 0 171 3 ttdR HTH-type transcriptional activator TtdR Escherichia coli (strain UTI89 / UPEC)
Q8FDH0 7.97e-17 82 27 0 171 3 ttdR HTH-type transcriptional activator TtdR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P45463 9.98e-17 82 27 0 171 3 ttdR HTH-type transcriptional activator TtdR Escherichia coli (strain K12)
Q0TD46 1.08e-16 82 30 0 139 3 ttdR HTH-type transcriptional activator TtdR Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q8XBK9 2.43e-16 81 27 0 171 3 ttdR HTH-type transcriptional activator TtdR Escherichia coli O157:H7
Q01610 3.02e-14 75 31 0 145 3 PA2220 Putative transcriptional regulator Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P37459 1.09e-13 73 30 5 172 3 sinR Probable HTH-type transcriptional regulator SinR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P14145 1.11e-13 73 24 4 258 3 ampR HTH-type transcriptional activator AmpR Rhodobacter capsulatus
P52669 8.9e-13 70 30 1 143 3 ttuA HTH-type transcriptional regulator TtuA Agrobacterium vitis
P52658 1.07e-12 70 27 1 159 3 ampR HTH-type transcriptional activator AmpR Citrobacter koseri
P0A2Q4 1.32e-12 70 28 9 249 3 metR HTH-type transcriptional regulator MetR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2Q5 1.32e-12 70 28 9 249 3 metR HTH-type transcriptional regulator MetR Salmonella typhi
P05051 1.65e-12 70 28 7 248 3 ampR HTH-type transcriptional activator AmpR Enterobacter cloacae
P12529 1.67e-12 70 29 9 255 1 ampR HTH-type transcriptional activator AmpR Citrobacter freundii
P33634 1.81e-12 70 26 11 297 3 yfiE Uncharacterized HTH-type transcriptional regulator YfiE Escherichia coli (strain K12)
P45099 2.72e-12 69 29 3 157 3 gcvA Glycine cleavage system transcriptional activator homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9X725 3.63e-12 69 22 7 305 3 oxyR Hydrogen peroxide-inducible genes activator Dickeya chrysanthemi
P0A9F6 1.49e-11 67 32 3 150 1 gcvA Glycine cleavage system transcriptional activator Escherichia coli (strain K12)
P0A9F7 1.49e-11 67 32 3 150 3 gcvA Glycine cleavage system transcriptional activator Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9F8 1.49e-11 67 32 3 150 3 gcvA Glycine cleavage system transcriptional activator Escherichia coli O157:H7
P42507 2.38e-11 66 22 9 295 3 hvrB AhcY transcriptional activator HvrB Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
Q8X4M5 2.57e-11 66 33 2 138 3 cynR HTH-type transcriptional regulator CynR Escherichia coli O157:H7
P0A9G1 3.73e-11 66 28 9 249 3 metR HTH-type transcriptional regulator MetR Shigella flexneri
P0A9F9 3.73e-11 66 28 9 249 1 metR HTH-type transcriptional regulator MetR Escherichia coli (strain K12)
P0A9G0 3.73e-11 66 28 9 249 3 metR HTH-type transcriptional regulator MetR Escherichia coli O157:H7
P27111 4.36e-11 65 32 2 138 1 cynR HTH-type transcriptional regulator CynR Escherichia coli (strain K12)
P55576 5.96e-11 65 33 1 122 3 NGR_a02420 Uncharacterized HTH-type transcriptional regulator y4mQ Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P46068 6.79e-11 65 25 5 260 2 dsdC HTH-type transcriptional regulator DsdC Escherichia coli (strain K12)
Q57083 2.1e-10 63 36 1 108 1 perR HTH-type transcriptional regulator PerR Escherichia coli (strain K12)
P71318 3.08e-10 63 22 7 305 3 oxyR Hydrogen peroxide-inducible genes activator Pectobacterium carotovorum subsp. carotovorum
Q4G384 3.75e-10 63 35 4 118 3 rbcR Probable RuBisCO transcriptional regulator Emiliania huxleyi
P0ACQ4 3.86e-10 63 23 9 299 1 oxyR DNA-binding transcriptional dual regulator OxyR Escherichia coli (strain K12)
P0ACQ5 3.86e-10 63 23 9 299 3 oxyR Hydrogen peroxide-inducible genes activator Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0ACQ6 3.86e-10 63 23 9 299 3 oxyR Hydrogen peroxide-inducible genes activator Escherichia coli O157:H7
A2CI69 4.02e-10 63 35 2 115 3 rbcR Probable RuBisCO transcriptional regulator Chlorokybus atmophyticus
P52696 4.04e-10 63 25 4 177 3 ybhD Uncharacterized HTH-type transcriptional regulator YbhD Escherichia coli (strain K12)
P16931 8.3e-10 62 26 7 245 3 dgdR HTH-type transcriptional regulator DgdR Burkholderia cepacia
Q47005 1.06e-09 62 32 4 143 3 nac Nitrogen assimilation regulatory protein nac Escherichia coli (strain K12)
P24734 1.17e-09 61 27 2 160 1 ampR HTH-type transcriptional activator AmpR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P96725 1.33e-09 61 24 6 270 3 ywqM Uncharacterized HTH-type transcriptional regulator YwqM Bacillus subtilis (strain 168)
P52660 1.42e-09 61 27 1 129 3 blaA HTH-type transcriptional regulator BlaA Proteus vulgaris
P52693 1.67e-09 61 30 3 149 3 ntcB Probable nitrogen assimilation transcriptional activator Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P45461 1.77e-09 61 26 5 187 3 ampR HTH-type transcriptional activator AmpR Yersinia enterocolitica
P52676 1.92e-09 61 28 1 130 3 nmcR Carbapenem-hydrolyzing beta-lactamase transcriptional activator Enterobacter cloacae
Q04778 1.95e-09 61 26 2 163 3 alsR HTH-type transcriptional regulator AlsR Bacillus subtilis (strain 168)
Q6B936 2e-09 61 33 3 122 3 rbcR Probable RuBisCO transcriptional regulator Gracilaria tenuistipitata var. liui
P52683 2.22e-09 60 29 1 129 3 smeR Carbapenem-hydrolyzing beta-lactamase transcriptional activator Serratia marcescens
P39592 2.89e-09 60 30 0 116 3 ywbI Uncharacterized HTH-type transcriptional regulator YwbI Bacillus subtilis (strain 168)
O32186 3.32e-09 60 25 5 235 3 yusT Uncharacterized HTH-type transcriptional regulator YusT Bacillus subtilis (strain 168)
P48271 6.6e-09 59 30 2 129 3 rbcR Probable RuBisCO transcriptional regulator Cyanophora paradoxa
Q8KA72 7.98e-09 59 25 2 173 3 metR HTH-type transcriptional regulator MetR Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q57748 8.77e-09 59 29 1 132 3 MJ0300 Uncharacterized HTH-type transcriptional regulator MJ0300 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
O32255 9.84e-09 58 26 1 122 3 yvbU Uncharacterized HTH-type transcriptional regulator YvbU Bacillus subtilis (strain 168)
O78432 1.04e-08 58 33 2 119 3 rbcR Probable RuBisCO transcriptional regulator Guillardia theta
Q1XDT2 1.09e-08 58 29 3 132 3 rbcR Probable RuBisCO transcriptional regulator Neopyropia yezoensis
O69772 1.14e-08 58 33 2 136 3 ampR HTH-type transcriptional activator AmpR Providencia stuartii
P55181 1.2e-08 58 26 12 264 3 yxjO Uncharacterized HTH-type transcriptional regulator YxjO Bacillus subtilis (strain 168)
P73123 1.54e-08 58 30 3 132 3 rbcR Probable RuBisCO transcriptional regulator Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P52686 1.94e-08 58 31 2 129 3 sdsB SDS degradation transcriptional activation protein Pseudomonas sp. (strain ATCC 19151)
P51205 2e-08 58 29 3 132 3 rbcR Probable RuBisCO transcriptional regulator Porphyra purpurea
P0ACR0 2.59e-08 57 42 0 73 1 allS HTH-type transcriptional activator AllS Escherichia coli (strain K12)
P0ACR1 2.59e-08 57 42 0 73 3 allS HTH-type transcriptional activator AllS Escherichia coli O157:H7
Q55459 3.11e-08 57 20 6 294 1 cmpR HTH-type transcriptional activator CmpR Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
O34685 3.2e-08 57 27 2 151 1 yofA HTH-type transcriptional regulator YofA Bacillus subtilis (strain 168)
P52666 3.79e-08 57 30 4 160 3 budR HTH-type transcriptional regulator BudR Raoultella terrigena
Q85G62 3.86e-08 57 31 2 129 3 rbcR Probable RuBisCO transcriptional regulator Cyanidioschyzon merolae (strain NIES-3377 / 10D)
Q8FK66 4.3e-08 57 42 0 73 3 allS HTH-type transcriptional activator AllS Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TKD7 4.3e-08 57 42 0 73 3 allS HTH-type transcriptional activator AllS Escherichia coli O6:K15:H31 (strain 536 / UPEC)
P49518 4.36e-08 57 23 9 284 3 rbcR Probable RuBisCO transcriptional regulator Trieres chinensis
P25544 4.53e-08 57 28 3 142 3 rbcR RuBisCO operon transcriptional regulator Allochromatium vinosum
O35038 4.54e-08 57 30 4 134 3 ytlI HTH-type transcriptional regulator YtlI Bacillus subtilis (strain 168)
P96194 4.63e-08 54 43 2 78 3 None Uncharacterized HTH-type transcriptional regulator in ibpB-leuC intergenic region Azotobacter vinelandii
Q8YQ82 5.23e-08 57 33 3 118 3 rbcR Probable RuBisCO transcriptional regulator Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q1RF30 5.41e-08 57 42 0 73 3 allS HTH-type transcriptional activator AllS Escherichia coli (strain UTI89 / UPEC)
A1A8H0 5.41e-08 57 42 0 73 3 allS HTH-type transcriptional activator AllS Escherichia coli O1:K1 / APEC
Q3MCB5 5.58e-08 57 33 3 118 3 rbcR Probable RuBisCO transcriptional regulator Trichormus variabilis (strain ATCC 29413 / PCC 7937)
A0T0V5 6.07e-08 56 29 6 168 3 rbcR-A Probable RuBisCO transcriptional regulator Thalassiosira pseudonana
Q9S4Y7 6.27e-08 56 40 0 77 3 allS HTH-type transcriptional activator AllS Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q5PCH2 6.27e-08 56 40 0 77 3 allS HTH-type transcriptional activator AllS Salmonella paratyphi A (strain ATCC 9150 / SARB42)
P0ACR8 6.68e-08 56 33 2 121 3 yfeR Uncharacterized HTH-type transcriptional regulator YfeR Shigella flexneri
P0ACR7 6.68e-08 56 33 2 121 3 yfeR Uncharacterized HTH-type transcriptional regulator YfeR Escherichia coli (strain K12)
Q57S50 6.8e-08 56 40 0 77 3 allS HTH-type transcriptional activator AllS Salmonella choleraesuis (strain SC-B67)
A0T0G2 1.1e-07 55 24 7 250 3 rbcR Probable RuBisCO transcriptional regulator Phaeodactylum tricornutum (strain CCAP 1055/1)
A0R8S0 1.31e-07 55 30 4 149 3 czcR HTH-type transcriptional regulator CzcR Bacillus thuringiensis (strain Al Hakam)
P70785 1.42e-07 55 30 0 128 3 ttuA HTH-type transcriptional regulator TtuA Agrobacterium vitis
O06703 1.47e-07 55 24 10 307 3 bbuR HTH-type transcriptional regulator BbuR Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q8Z8R3 1.69e-07 55 40 0 77 3 allS HTH-type transcriptional activator AllS Salmonella typhi
P74422 1.7e-07 55 30 2 130 3 ntcB Probable nitrogen assimilation transcriptional activator Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P94501 1.78e-07 55 31 3 123 1 gltR HTH-type transcriptional regulator GltR Bacillus subtilis (strain 168)
Q765S2 1.8e-07 55 41 0 73 3 allS HTH-type transcriptional activator AllS Klebsiella pneumoniae
P23841 2.78e-07 54 37 0 79 3 xapR HTH-type transcriptional regulator XapR Escherichia coli (strain K12)
O19892 2.82e-07 54 33 2 115 3 rbcR Probable RuBisCO transcriptional regulator Cyanidium caldarium
P44821 3.11e-07 54 32 6 143 3 ilvY HTH-type transcriptional activator IlvY Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q81IX0 4.47e-07 53 33 4 132 3 czcR HTH-type transcriptional regulator CzcR Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q63H01 4.86e-07 53 33 4 132 3 czcR HTH-type transcriptional regulator CzcR Bacillus cereus (strain ZK / E33L)
Q73EY2 4.86e-07 53 33 4 132 3 czcR HTH-type transcriptional regulator CzcR Bacillus cereus (strain ATCC 10987 / NRS 248)
Q6HPH4 4.95e-07 53 33 4 132 3 czcR HTH-type transcriptional regulator CzcR Bacillus thuringiensis subsp. konkukian (strain 97-27)
P52665 5.2e-07 51 36 0 91 3 budR HTH-type transcriptional regulator BudR (Fragment) Klebsiella aerogenes
Q81VJ1 5.78e-07 53 33 4 132 3 czcR HTH-type transcriptional regulator CzcR Bacillus anthracis
P77700 1.1e-06 52 36 1 85 1 yahB Uncharacterized HTH-type transcriptional regulator YahB Escherichia coli (strain K12)
P45349 1.18e-06 52 26 2 130 3 metR HTH-type transcriptional regulator MetR Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P94403 1.41e-06 52 22 4 167 3 bsdA HTH-type transcriptional regulator BsdA Bacillus subtilis (strain 168)
P52691 1.52e-06 52 31 0 122 3 lrrA Probable HTH-type transcriptional regulator LrrA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P39376 1.61e-06 52 25 8 262 1 yjiE HTH-type transcriptional regulator YjiE Escherichia coli (strain K12)
Q47141 1.62e-06 52 31 5 166 1 hcaR Hca operon transcriptional activator HcaR Escherichia coli (strain K12)
P77559 2.02e-06 52 26 8 262 3 ynfL Uncharacterized HTH-type transcriptional regulator YnfL Escherichia coli (strain K12)
A4QH19 2.14e-06 52 30 3 146 1 shiR HTH-type transcriptional regulator ShiR Corynebacterium glutamicum (strain R)
P39127 5.18e-06 50 22 10 312 3 citR HTH-type transcriptional regulator CitR Bacillus subtilis (strain 168)
Q9HWH8 5.3e-06 50 28 4 160 3 nmoR HTH-type transcriptional regulator NmoR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
O68014 5.94e-06 50 30 2 119 1 benM HTH-type transcriptional regulator BenM Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
P77744 7.27e-06 50 25 0 120 3 abgR HTH-type transcriptional regulator AbgR Escherichia coli (strain K12)
P20668 7.28e-06 50 26 0 117 1 gltC Transcriptional dual regulator GltC Bacillus subtilis (strain 168)
P44418 8.53e-06 50 21 10 279 3 oxyR Hydrogen peroxide-inducible genes activator Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9I6Z9 1.06e-05 50 32 1 90 3 bauR HTH-type transcriptional activator BauR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A7Z5E4 2.14e-05 48 28 11 245 3 yofA HTH-type transcriptional regulator YofA Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
Q5N5I5 2.22e-05 48 28 4 127 3 cmpR HTH-type transcriptional activator CmpR Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q9F1R2 2.22e-05 48 28 4 127 1 cmpR HTH-type transcriptional activator CmpR Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P42722 2.34e-05 48 30 0 92 3 cfxR HTH-type transcriptional regulator CfxR Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
O33812 2.49e-05 48 23 10 257 3 None Uncharacterized HTH-type transcriptional regulator in lacR 5'region (Fragment) Staphylococcus xylosus
P0DUU5 4.59e-05 47 32 0 98 1 aceR HTH-type transcriptional regulator AceR Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
P77309 4.9e-05 47 23 9 246 3 yneJ Uncharacterized HTH-type transcriptional regulator YneJ Escherichia coli (strain K12)
O69055 5.15e-05 47 26 5 172 3 ptxE Putative HTH-type transcriptional regulator protein PtxE (Fragment) Stutzerimonas stutzeri
Q8RQM5 5.16e-05 47 28 7 194 3 lysG Lysine export transcriptional regulatory protein LysG Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
P42427 5.25e-05 47 27 1 111 3 tfdT HTH-type transcriptional regulator TfdT Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
P36771 5.29e-05 47 24 8 253 1 lrhA Probable HTH-type transcriptional regulator LrhA Escherichia coli (strain K12)
P52659 6.94e-05 47 26 10 261 3 abaB HTH-type transcriptional regulator AbaB Streptomyces antibioticus
Q8VWE6 8.32e-05 47 24 8 253 3 lrhA Probable HTH-type transcriptional regulator LrhA Escherichia coli O157:H7
P52595 0.000117 46 27 6 168 3 cbbR HTH-type transcriptional regulator CbbR Rhodospirillum rubrum
P94387 0.000147 46 29 0 106 3 ycgK Uncharacterized HTH-type transcriptional regulator YcgK Bacillus subtilis (strain 168)
B1JQ39 0.000158 46 28 2 143 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66G51 0.000158 46 28 2 143 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TRF4 0.000158 46 28 2 143 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pestis (strain Pestoides F)
Q1CNN4 0.000158 46 28 2 143 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pestis bv. Antiqua (strain Nepal516)
A9R8E7 0.000158 46 28 2 143 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pestis bv. Antiqua (strain Angola)
Q8ZAA7 0.000158 46 28 2 143 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pestis
B2JZG4 0.000158 46 28 2 143 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1CBT5 0.000158 46 28 2 143 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pestis bv. Antiqua (strain Antiqua)
A7FD20 0.000158 46 28 2 143 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
P37499 0.000163 46 21 1 142 3 yybE Uncharacterized HTH-type transcriptional regulator YybE Bacillus subtilis (strain 168)
P52044 0.000165 46 31 1 77 3 ygfI Uncharacterized HTH-type transcriptional regulator YgfI Escherichia coli (strain K12)
P52685 0.000235 45 23 1 146 3 mauR Mau operon transcriptional activator Paracoccus denitrificans
A1JI47 0.000255 45 29 1 124 3 hdfR HTH-type transcriptional regulator HdfR Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
P94632 0.0003 45 35 1 68 1 lysG Lysine export transcriptional regulatory protein LysG Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
P94678 0.000442 45 27 0 123 1 tsaR HTH-type transcriptional regulator TsaR Comamonas testosteroni
Q87LL6 0.000658 44 24 8 258 3 argP HTH-type transcriptional regulator ArgP Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
O34827 0.000789 44 19 6 237 3 ykuM Uncharacterized HTH-type transcriptional regulator YkuM Bacillus subtilis (strain 168)
P33651 0.000851 44 29 0 87 3 blaA HTH-type transcriptional regulator BlaA Streptomyces cacaoi
B4F0Q1 0.000857 43 27 16 301 3 argP HTH-type transcriptional regulator ArgP Proteus mirabilis (strain HI4320)
O33945 0.001 43 37 0 59 3 None Probable cat1 operon transcriptional activator Acinetobacter lwoffii
Q2NRD9 0.001 43 29 13 250 3 argP HTH-type transcriptional regulator ArgP Sodalis glossinidius (strain morsitans)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS00565
Feature type CDS
Gene -
Product LysR family transcriptional regulator
Location 121333 - 122271 (strand: -1)
Length 939 (nucleotides) / 312 (amino acids)

Contig

Accession term accessions NZ_VXKB01000001 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1512
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00126 Bacterial regulatory helix-turn-helix protein, lysR family
PF03466 LysR substrate binding domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0583 Transcription (K) K DNA-binding transcriptional regulator, LysR family

Protein Sequence

MRQYKQYCLVKLNKPMLTSVEKINTFIYVVDTGSFTRAATRLNLSKSMVSLHIKALETELNTTLLHRTTRQFTLTESGHALYQQFRPLLQQFDRALDAVMAGTTQPQGTLRFSATAEFGGQFLLPQLPAFRMQYPLIQLDYRVDHTLSDLIAQKLDVVLRLGTLSDSGLRYRRLADFPVCYVATPDFIRRYQVTDNSDPALLPFIANSNLLSQSAWRQHLPASDNTAFVSNSIQAIRTMTLAHQGYSLLPVWYIREQLIQEELVPVFTQRDTPDQSINMVFPPAAHLAQKVRVFIDYFVRYFSENAEQLRYP

Flanking regions ( +/- flanking 50bp)

TCATAATTTCCTCCGGTCAGCAGTGTAAAAGTTGTTGACCTGCGGCGTCTATGCGTCAATATAAACAATATTGTTTGGTAAAATTAAACAAACCTATGCTGACATCTGTTGAAAAAATTAATACCTTTATATACGTGGTGGATACCGGGTCATTTACCCGCGCGGCAACCCGTCTGAATTTAAGCAAGTCGATGGTGAGTCTGCATATCAAAGCCCTGGAAACGGAGCTGAACACCACACTGCTGCACAGGACAACACGCCAGTTTACCCTGACTGAGTCCGGTCATGCGCTGTATCAGCAATTCAGACCGCTGTTACAACAGTTTGACAGGGCGCTTGACGCGGTAATGGCGGGCACAACTCAGCCACAGGGCACTCTGCGTTTCAGTGCCACTGCTGAATTTGGCGGGCAGTTTCTGCTGCCGCAGCTTCCGGCATTCCGGATGCAGTATCCGCTTATTCAGCTGGATTACCGGGTCGATCATACCCTGAGTGATTTGATTGCCCAGAAACTGGATGTGGTACTGCGGCTCGGCACACTGAGCGACAGCGGGTTGCGTTACCGCAGACTGGCTGATTTTCCGGTATGTTATGTGGCAACACCGGACTTTATCCGCCGCTATCAGGTAACGGATAACAGCGATCCCGCTTTACTGCCGTTTATCGCCAACAGTAATCTGTTAAGTCAGAGCGCCTGGCGTCAGCATCTGCCTGCCTCTGACAATACCGCGTTTGTGTCCAATTCGATTCAGGCCATCCGCACCATGACACTGGCACATCAGGGATACAGCCTGCTGCCGGTCTGGTATATAAGAGAGCAATTGATACAGGAAGAATTAGTGCCGGTCTTTACACAGCGGGATACGCCGGATCAAAGCATCAATATGGTATTCCCGCCTGCGGCACATCTGGCGCAGAAAGTGCGGGTATTTATCGACTATTTTGTCCGGTATTTCAGTGAGAATGCAGAGCAGCTGCGCTATCCGTGAGACAAAAAAAAGCCGTTCAGATGAACGGCTTTTTTAATGAAAAACGACTT