Homologs in group_1500

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_09680 FBDBKF_09680 100.0 Morganella morganii S1 modF molybdate ABC transporter ATP-binding protein ModF
EHELCC_04480 EHELCC_04480 100.0 Morganella morganii S2 modF molybdate ABC transporter ATP-binding protein ModF
LHKJJB_14150 LHKJJB_14150 100.0 Morganella morganii S3 modF molybdate ABC transporter ATP-binding protein ModF
HKOGLL_12385 HKOGLL_12385 100.0 Morganella morganii S5 modF molybdate ABC transporter ATP-binding protein ModF
F4V73_RS00660 F4V73_RS00660 78.1 Morganella psychrotolerans modF molybdate ABC transporter ATP-binding protein ModF
PMI_RS02915 PMI_RS02915 62.7 Proteus mirabilis HI4320 modF molybdate ABC transporter ATP-binding protein ModF

Distribution of the homologs in the orthogroup group_1500

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1500

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P31060 0.0 654 64 3 489 2 modF ABC transporter ATP-binding protein ModF Escherichia coli (strain K12)
Q9UT95 3.15e-54 192 28 13 479 3 SPAC323.04 Uncharacterized ABC transporter ATP-binding protein C323.04 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9UT95 4.33e-06 52 24 6 173 3 SPAC323.04 Uncharacterized ABC transporter ATP-binding protein C323.04 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q12298 3.41e-36 144 27 12 407 1 YDR061W Uncharacterized ABC transporter ATP-binding protein YDR061W Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q02151 2.53e-28 116 34 3 197 3 ymeB Uncharacterized ABC transporter ATP-binding protein YmeB Lactococcus lactis subsp. lactis (strain IL1403)
Q02151 5.86e-07 54 25 5 172 3 ymeB Uncharacterized ABC transporter ATP-binding protein YmeB Lactococcus lactis subsp. lactis (strain IL1403)
O31723 8.98e-27 112 33 3 212 2 ylmA Uncharacterized ABC transporter ATP-binding protein YlmA Bacillus subtilis (strain 168)
O31723 6.53e-08 57 25 5 214 2 ylmA Uncharacterized ABC transporter ATP-binding protein YlmA Bacillus subtilis (strain 168)
Q87G35 3.89e-24 109 27 18 491 3 VPA1482 Putative ABC transporter ATP-binding protein VPA1482 Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q87G35 8.07e-06 52 26 6 203 3 VPA1482 Putative ABC transporter ATP-binding protein VPA1482 Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
O34338 2.18e-23 102 30 5 232 2 mntB Manganese transport system ATP-binding protein MntB Bacillus subtilis (strain 168)
O34338 3e-11 67 27 4 175 2 mntB Manganese transport system ATP-binding protein MntB Bacillus subtilis (strain 168)
Q88ZZ2 6.16e-23 105 27 18 489 3 lp_0149 Putative ABC transporter ATP-binding protein lp_0149 Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q88ZZ2 4.62e-11 68 26 5 212 3 lp_0149 Putative ABC transporter ATP-binding protein lp_0149 Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q97SA3 8e-23 105 25 14 479 3 SP_0483 Putative ABC transporter ATP-binding protein SP_0483 Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q97SA3 1.04e-05 51 26 6 219 3 SP_0483 Putative ABC transporter ATP-binding protein SP_0483 Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
P72477 2.35e-22 99 32 4 194 3 abcX Putative ABC transporter ATP-binding protein Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
P72477 8.06e-05 47 24 5 172 3 abcX Putative ABC transporter ATP-binding protein Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
P96117 8.76e-22 98 31 3 200 3 troB Zinc transport system ATP-binding protein TroB Treponema pallidum (strain Nichols)
P96117 1.88e-15 79 26 4 212 3 troB Zinc transport system ATP-binding protein TroB Treponema pallidum (strain Nichols)
Q93D97 1.08e-21 101 26 19 486 3 sdcBA Putative ABC transporter ATP-binding protein SMU_1934c Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q93D97 2.01e-05 50 24 4 200 3 sdcBA Putative ABC transporter ATP-binding protein SMU_1934c Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q8D3Z9 9.58e-21 99 26 18 491 3 VV2_1533 Putative ABC transporter ATP-binding protein VV2_1533 Vibrio vulnificus (strain CMCP6)
Q8D3Z9 2.53e-05 50 25 4 196 3 VV2_1533 Putative ABC transporter ATP-binding protein VV2_1533 Vibrio vulnificus (strain CMCP6)
Q8D3Z9 9.64e-05 48 25 6 204 3 VV2_1533 Putative ABC transporter ATP-binding protein VV2_1533 Vibrio vulnificus (strain CMCP6)
Q9KD30 1.67e-20 94 28 3 202 3 mntB Manganese transport system ATP-binding protein MntB Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q9KD30 2.37e-08 58 22 7 229 3 mntB Manganese transport system ATP-binding protein MntB Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q8DQY5 2.6e-20 97 25 14 480 3 spr0430 Putative ABC transporter ATP-binding protein spr0430 Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q8DQY5 2.48e-07 57 26 4 217 3 spr0430 Putative ABC transporter ATP-binding protein spr0430 Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q92AF9 4.6e-20 92 29 4 194 3 mntB Manganese transport system ATP-binding protein MntB Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q92AF9 8.83e-08 56 22 3 198 3 mntB Manganese transport system ATP-binding protein MntB Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q5WC31 7.48e-20 95 26 14 448 3 rbsA Ribose import ATP-binding protein RbsA Shouchella clausii (strain KSM-K16)
Q5WC31 1.31e-09 63 28 5 208 3 rbsA Ribose import ATP-binding protein RbsA Shouchella clausii (strain KSM-K16)
Q5WC31 7.89e-08 58 21 5 219 3 rbsA Ribose import ATP-binding protein RbsA Shouchella clausii (strain KSM-K16)
Q65E55 1.48e-19 94 24 16 477 3 rbsA Ribose import ATP-binding protein RbsA Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q65E55 1.03e-08 61 25 3 202 3 rbsA Ribose import ATP-binding protein RbsA Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q65E55 0.000551 46 25 0 81 3 rbsA Ribose import ATP-binding protein RbsA Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q8DY60 1.49e-19 95 24 16 514 3 SAG1633 Putative ABC transporter ATP-binding protein SAG1633 Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8Y651 2.94e-19 90 29 4 194 3 mntB Manganese transport system ATP-binding protein MntB Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q8Y651 4.77e-09 60 23 3 198 3 mntB Manganese transport system ATP-binding protein MntB Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q99QV7 3.11e-19 94 24 19 502 3 SAV2684 Putative ABC transporter ATP-binding protein SAV2684 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q7A342 3.11e-19 94 24 19 502 3 SA2476 Putative ABC transporter ATP-binding protein SA2476 Staphylococcus aureus (strain N315)
Q5HCL3 3.35e-19 94 24 19 502 3 SACOL2708 Putative ABC transporter ATP-binding protein SACOL2708 Staphylococcus aureus (strain COL)
Q8E3S6 3.77e-19 94 24 16 514 3 gbs1680 Putative ABC transporter ATP-binding protein gbs1680 Streptococcus agalactiae serotype III (strain NEM316)
A1WXT0 4.25e-19 90 31 5 213 3 znuC Zinc import ATP-binding protein ZnuC Halorhodospira halophila (strain DSM 244 / SL1)
A1WXT0 5.2e-07 54 25 7 232 3 znuC Zinc import ATP-binding protein ZnuC Halorhodospira halophila (strain DSM 244 / SL1)
Q7MFH3 5.25e-19 93 26 17 492 3 VVA0347 Putative ABC transporter ATP-binding protein VVA0347 Vibrio vulnificus (strain YJ016)
Q7MFH3 2.67e-05 50 25 4 196 3 VVA0347 Putative ABC transporter ATP-binding protein VVA0347 Vibrio vulnificus (strain YJ016)
Q7MFH3 0.000169 47 23 4 200 3 VVA0347 Putative ABC transporter ATP-binding protein VVA0347 Vibrio vulnificus (strain YJ016)
Q8NUH8 5.29e-19 93 24 19 502 3 MW2603 Putative ABC transporter ATP-binding protein MW2603 Staphylococcus aureus (strain MW2)
Q6G5Z1 5.29e-19 93 24 19 502 3 SAS2569 Putative ABC transporter ATP-binding protein SAS2569 Staphylococcus aureus (strain MSSA476)
Q8ES39 5.52e-19 93 26 15 387 3 OB0804 Putative ABC transporter ATP-binding protein OB0804 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q8ES39 7.36e-10 64 23 6 230 3 OB0804 Putative ABC transporter ATP-binding protein OB0804 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q8ES39 3.07e-05 50 25 6 224 3 OB0804 Putative ABC transporter ATP-binding protein OB0804 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q8XK20 1.16e-18 92 23 16 488 3 CPE1583 Putative ABC transporter ATP-binding protein CPE1583 Clostridium perfringens (strain 13 / Type A)
Q8XK20 1.98e-09 63 25 6 207 3 CPE1583 Putative ABC transporter ATP-binding protein CPE1583 Clostridium perfringens (strain 13 / Type A)
Q81HW8 1.42e-18 91 24 13 464 3 rbsA Ribose import ATP-binding protein RbsA Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q81HW8 1.09e-11 70 28 5 198 3 rbsA Ribose import ATP-binding protein RbsA Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q81HW8 3.21e-05 50 23 4 198 3 rbsA Ribose import ATP-binding protein RbsA Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q6GDC0 1.81e-18 91 24 20 505 3 SAR2766 Putative ABC transporter ATP-binding protein SAR2766 Staphylococcus aureus (strain MRSA252)
Q6LQ00 3.47e-18 90 24 18 486 3 PBPRA2240 Putative ABC transporter ATP-binding protein PBPRA2240 Photobacterium profundum (strain SS9)
Q6LQ00 0.000151 48 23 6 207 3 PBPRA2240 Putative ABC transporter ATP-binding protein PBPRA2240 Photobacterium profundum (strain SS9)
Q1CJG3 5.34e-18 87 30 5 221 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis bv. Antiqua (strain Nepal516)
Q1CJG3 2.53e-08 58 29 6 171 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis bv. Antiqua (strain Nepal516)
Q7CIC2 5.34e-18 87 30 5 221 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis
Q7CIC2 2.53e-08 58 29 6 171 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis
Q1C812 5.34e-18 87 30 5 221 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis bv. Antiqua (strain Antiqua)
Q1C812 2.53e-08 58 29 6 171 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis bv. Antiqua (strain Antiqua)
Q66AT7 5.44e-18 87 30 5 221 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pseudotuberculosis serotype I (strain IP32953)
Q66AT7 2.58e-08 58 29 6 171 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pseudotuberculosis serotype I (strain IP32953)
Q9K6J9 6.88e-18 89 26 12 439 3 rbsA Ribose import ATP-binding protein RbsA Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q9K6J9 5.35e-11 68 28 5 206 3 rbsA Ribose import ATP-binding protein RbsA Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q9K6J9 9.8e-07 54 28 0 84 3 rbsA Ribose import ATP-binding protein RbsA Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q8TQ05 9.1e-18 89 26 17 481 3 MA_1747 Putative ABC transporter ATP-binding protein MA_1747 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q8TQ05 1.17e-06 54 25 5 209 3 MA_1747 Putative ABC transporter ATP-binding protein MA_1747 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
O52618 5.54e-17 85 32 6 203 3 nodI Nod factor export ATP-binding protein I Rhizobium meliloti (strain 1021)
O52618 7.88e-07 54 27 3 169 3 nodI Nod factor export ATP-binding protein I Rhizobium meliloti (strain 1021)
Q21PQ7 6.98e-17 84 29 5 223 3 znuC Zinc import ATP-binding protein ZnuC Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q21PQ7 6.41e-08 57 24 2 173 3 znuC Zinc import ATP-binding protein ZnuC Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q87RE5 8.75e-17 83 29 3 199 3 znuC Zinc import ATP-binding protein ZnuC Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q87RE5 1.93e-07 55 25 2 159 3 znuC Zinc import ATP-binding protein ZnuC Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
P77509 1.04e-16 86 23 20 493 3 yphE Uncharacterized ABC transporter ATP-binding protein YphE Escherichia coli (strain K12)
P77509 2.19e-07 57 27 8 223 3 yphE Uncharacterized ABC transporter ATP-binding protein YphE Escherichia coli (strain K12)
Q74I62 1.11e-16 86 24 19 516 3 LJ_1704 Putative ABC transporter ATP-binding protein LJ_1704 Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q74I62 1e-06 55 20 4 222 3 LJ_1704 Putative ABC transporter ATP-binding protein LJ_1704 Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q6HNE7 1.85e-16 85 23 13 464 3 rbsA Ribose import ATP-binding protein RbsA Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q6HNE7 2.64e-12 72 28 5 207 3 rbsA Ribose import ATP-binding protein RbsA Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q6HNE7 8.05e-05 48 23 4 198 3 rbsA Ribose import ATP-binding protein RbsA Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q81V36 1.85e-16 85 23 13 464 3 rbsA Ribose import ATP-binding protein RbsA Bacillus anthracis
Q81V36 2.64e-12 72 28 5 207 3 rbsA Ribose import ATP-binding protein RbsA Bacillus anthracis
Q81V36 8.05e-05 48 23 4 198 3 rbsA Ribose import ATP-binding protein RbsA Bacillus anthracis
Q89AJ0 1.97e-16 82 25 3 217 3 znuC Zinc import ATP-binding protein ZnuC Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q89AJ0 6.07e-06 51 23 6 206 3 znuC Zinc import ATP-binding protein ZnuC Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q63FX9 1.99e-16 85 24 13 457 3 rbsA Ribose import ATP-binding protein RbsA Bacillus cereus (strain ZK / E33L)
Q63FX9 2.67e-12 72 28 5 207 3 rbsA Ribose import ATP-binding protein RbsA Bacillus cereus (strain ZK / E33L)
Q63FX9 0.000192 47 22 4 198 3 rbsA Ribose import ATP-binding protein RbsA Bacillus cereus (strain ZK / E33L)
Q6LTB1 2.08e-16 82 29 3 193 3 znuC Zinc import ATP-binding protein ZnuC Photobacterium profundum (strain SS9)
Q6LTB1 3.24e-05 48 28 3 160 3 znuC Zinc import ATP-binding protein ZnuC Photobacterium profundum (strain SS9)
Q73DH7 2.45e-16 85 24 13 457 3 rbsA Ribose import ATP-binding protein RbsA Bacillus cereus (strain ATCC 10987 / NRS 248)
Q73DH7 1.1e-11 70 28 5 207 3 rbsA Ribose import ATP-binding protein RbsA Bacillus cereus (strain ATCC 10987 / NRS 248)
Q73DH7 0.000823 45 22 4 198 3 rbsA Ribose import ATP-binding protein RbsA Bacillus cereus (strain ATCC 10987 / NRS 248)
Q6YRJ4 2.61e-16 85 22 15 499 3 PAM_020 Putative ABC transporter ATP-binding protein PAM_020 Onion yellows phytoplasma (strain OY-M)
Q6YRJ4 1.15e-11 70 24 4 213 3 PAM_020 Putative ABC transporter ATP-binding protein PAM_020 Onion yellows phytoplasma (strain OY-M)
Q9XDA6 3.61e-16 81 30 11 236 3 zurA Zinc uptake system ATP-binding protein ZurA Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q9XDA6 5.94e-08 57 25 4 176 3 zurA Zinc uptake system ATP-binding protein ZurA Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
A1JRI2 4.42e-16 81 29 6 222 3 znuC Zinc import ATP-binding protein ZnuC Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A1JRI2 4.03e-07 54 29 6 171 3 znuC Zinc import ATP-binding protein ZnuC Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q97WT4 4.89e-16 84 24 18 499 3 SSO2030 Putative ABC transporter ATP-binding protein SSO2030 Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q97WT4 6.07e-09 62 26 7 216 3 SSO2030 Putative ABC transporter ATP-binding protein SSO2030 Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q926D8 5.23e-16 81 30 12 239 3 zurA Zinc uptake system ATP-binding protein ZurA Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q926D8 9.13e-09 59 26 4 176 3 zurA Zinc uptake system ATP-binding protein ZurA Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q1J3P2 5.32e-16 84 25 16 472 3 rbsA Ribose import ATP-binding protein RbsA Deinococcus geothermalis (strain DSM 11300 / CIP 105573 / AG-3a)
Q1J3P2 1.67e-06 54 37 0 77 3 rbsA Ribose import ATP-binding protein RbsA Deinococcus geothermalis (strain DSM 11300 / CIP 105573 / AG-3a)
Q57554 5.47e-16 81 33 5 190 3 MJ0089 Uncharacterized ABC transporter ATP-binding protein MJ0089 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q3JSQ0 5.83e-16 82 31 6 206 3 nodI Nod factor export ATP-binding protein I Burkholderia pseudomallei (strain 1710b)
Q3JSQ0 0.000272 46 45 0 55 3 nodI Nod factor export ATP-binding protein I Burkholderia pseudomallei (strain 1710b)
Q62K72 5.83e-16 82 31 6 206 3 nodI Nod factor export ATP-binding protein I Burkholderia mallei (strain ATCC 23344)
Q62K72 0.000272 46 45 0 55 3 nodI Nod factor export ATP-binding protein I Burkholderia mallei (strain ATCC 23344)
Q8ENB3 5.99e-16 83 22 16 465 3 rbsA Ribose import ATP-binding protein RbsA Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q8ENB3 5.55e-10 65 23 6 214 3 rbsA Ribose import ATP-binding protein RbsA Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q8ENB3 0.000175 47 30 0 69 3 rbsA Ribose import ATP-binding protein RbsA Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q6HG98 6.32e-16 84 23 14 489 3 BT9727_3105 Putative ABC transporter ATP-binding protein BT9727_3105 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q63TX3 6.4e-16 82 31 6 206 3 nodI Nod factor export ATP-binding protein I Burkholderia pseudomallei (strain K96243)
Q63TX3 0.000282 46 45 0 55 3 nodI Nod factor export ATP-binding protein I Burkholderia pseudomallei (strain K96243)
Q8UBN2 7.05e-16 83 22 14 466 3 Atu2819 Putative ribose/galactose/methyl galactoside import ATP-binding protein 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8UBN2 1.26e-05 51 25 5 200 3 Atu2819 Putative ribose/galactose/methyl galactoside import ATP-binding protein 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8GNH6 1.22e-15 81 31 8 226 3 nodI Nod factor export ATP-binding protein I Rhizobium meliloti
Q8GNH6 7.94e-06 51 25 4 172 3 nodI Nod factor export ATP-binding protein I Rhizobium meliloti
Q31I51 1.36e-15 80 29 6 226 3 znuC Zinc import ATP-binding protein ZnuC Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q31I51 7.28e-08 57 25 2 159 3 znuC Zinc import ATP-binding protein ZnuC Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q5E6M2 1.41e-15 80 28 4 193 3 znuC1 Zinc import ATP-binding protein ZnuC 1 Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q5E6M2 1.1e-05 50 26 2 160 3 znuC1 Zinc import ATP-binding protein ZnuC 1 Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q1IGY7 1.53e-15 79 28 7 215 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas entomophila (strain L48)
Q1IGY7 9.81e-07 53 27 4 159 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas entomophila (strain L48)
Q2SVP3 1.57e-15 80 31 6 206 3 nodI Nod factor export ATP-binding protein I Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q2SVP3 0.000662 45 45 0 55 3 nodI Nod factor export ATP-binding protein I Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q73F67 1.58e-15 80 29 7 202 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q87H79 1.59e-15 82 23 17 494 3 rbsA Ribose import ATP-binding protein RbsA Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q87H79 9.25e-05 48 27 0 69 3 rbsA Ribose import ATP-binding protein RbsA Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q6LH11 1.95e-15 82 24 15 473 3 rbsA Ribose import ATP-binding protein RbsA Photobacterium profundum (strain SS9)
Q6LH11 0.000114 48 27 0 69 3 rbsA Ribose import ATP-binding protein RbsA Photobacterium profundum (strain SS9)
Q88RL1 2.03e-15 79 28 7 215 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q88RL1 1.06e-06 53 27 4 159 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q03ZQ0 2.51e-15 80 30 8 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
Q03ZQ0 5.78e-07 55 26 4 174 3 potA Spermidine/putrescine import ATP-binding protein PotA Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
Q8G847 2.64e-15 81 23 14 460 1 fruK Fructose import ATP-binding protein FruK Bifidobacterium longum (strain NCC 2705)
Q8G847 1.28e-11 70 28 7 230 1 fruK Fructose import ATP-binding protein FruK Bifidobacterium longum (strain NCC 2705)
Q5KYS1 2.64e-15 81 22 17 483 3 xylG Xylose import ATP-binding protein XylG Geobacillus kaustophilus (strain HTA426)
Q5KYS1 1.08e-10 67 30 7 193 3 xylG Xylose import ATP-binding protein XylG Geobacillus kaustophilus (strain HTA426)
Q5KYS1 3.5e-05 50 29 0 82 3 xylG Xylose import ATP-binding protein XylG Geobacillus kaustophilus (strain HTA426)
Q664G2 2.73e-15 81 23 14 474 3 rbsA Ribose import ATP-binding protein RbsA Yersinia pseudotuberculosis serotype I (strain IP32953)
Q664G2 6.04e-06 52 26 8 212 3 rbsA Ribose import ATP-binding protein RbsA Yersinia pseudotuberculosis serotype I (strain IP32953)
Q6HPN0 2.86e-15 79 28 7 202 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q81VQ2 2.86e-15 79 28 7 202 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus anthracis
A0R8K8 2.86e-15 79 28 7 202 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus thuringiensis (strain Al Hakam)
Q832R5 2.92e-15 82 24 18 486 3 EF_2153 Putative ABC transporter ATP-binding protein EF_2153 Enterococcus faecalis (strain ATCC 700802 / V583)
Q832R5 3.32e-06 53 23 6 213 3 EF_2153 Putative ABC transporter ATP-binding protein EF_2153 Enterococcus faecalis (strain ATCC 700802 / V583)
Q832R5 1.26e-05 51 23 3 228 3 EF_2153 Putative ABC transporter ATP-binding protein EF_2153 Enterococcus faecalis (strain ATCC 700802 / V583)
A0LCH8 2.93e-15 79 28 7 235 3 znuC Zinc import ATP-binding protein ZnuC Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
A0LCH8 1.99e-05 49 25 3 158 3 znuC Zinc import ATP-binding protein ZnuC Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
Q48PV0 3.02e-15 79 27 6 215 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q81J16 3.14e-15 79 28 6 199 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q87UN0 3.18e-15 79 27 6 220 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q87UN0 1.16e-06 53 26 4 184 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
P72335 3.31e-15 79 29 7 204 3 nodI Nod factor export ATP-binding protein I Rhizobium sp. (strain N33)
P72335 6.05e-07 54 29 9 206 3 nodI Nod factor export ATP-binding protein I Rhizobium sp. (strain N33)
Q63H62 3.59e-15 79 28 7 202 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus cereus (strain ZK / E33L)
Q0S9A4 3.63e-15 81 23 15 481 3 rbsA Ribose import ATP-binding protein RbsA Rhodococcus jostii (strain RHA1)
Q0S9A4 0.000393 46 25 1 108 3 rbsA Ribose import ATP-binding protein RbsA Rhodococcus jostii (strain RHA1)
Q3YVK8 3.74e-15 81 23 13 461 3 rbsA Ribose import ATP-binding protein RbsA Shigella sonnei (strain Ss046)
Q3YVK8 4.3e-06 52 26 6 200 3 rbsA Ribose import ATP-binding protein RbsA Shigella sonnei (strain Ss046)
Q3YVK8 9.01e-05 48 28 0 69 3 rbsA Ribose import ATP-binding protein RbsA Shigella sonnei (strain Ss046)
Q1CDJ0 3.91e-15 81 23 14 474 3 rbsA Ribose import ATP-binding protein RbsA Yersinia pestis bv. Antiqua (strain Nepal516)
Q1CDJ0 6.14e-06 52 26 8 212 3 rbsA Ribose import ATP-binding protein RbsA Yersinia pestis bv. Antiqua (strain Nepal516)
Q7CG00 3.91e-15 81 23 14 474 3 rbsA Ribose import ATP-binding protein RbsA Yersinia pestis
Q7CG00 6.14e-06 52 26 8 212 3 rbsA Ribose import ATP-binding protein RbsA Yersinia pestis
Q1C1B8 3.91e-15 81 23 14 474 3 rbsA Ribose import ATP-binding protein RbsA Yersinia pestis bv. Antiqua (strain Antiqua)
Q1C1B8 6.14e-06 52 26 8 212 3 rbsA Ribose import ATP-binding protein RbsA Yersinia pestis bv. Antiqua (strain Antiqua)
Q02XM9 4.23e-15 81 22 16 463 3 rbsA Ribose import ATP-binding protein RbsA Lactococcus lactis subsp. cremoris (strain SK11)
Q02XM9 3.42e-06 53 24 5 206 3 rbsA Ribose import ATP-binding protein RbsA Lactococcus lactis subsp. cremoris (strain SK11)
Q4ZZS2 5.08e-15 78 27 6 220 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas syringae pv. syringae (strain B728a)
Q4ZZS2 2.95e-06 52 26 4 173 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas syringae pv. syringae (strain B728a)
Q57HW1 5.69e-15 80 24 14 466 3 rbsA Ribose import ATP-binding protein RbsA Salmonella choleraesuis (strain SC-B67)
Q57HW1 2.72e-07 56 27 6 194 3 rbsA Ribose import ATP-binding protein RbsA Salmonella choleraesuis (strain SC-B67)
Q57HW1 8.26e-05 48 22 6 218 3 rbsA Ribose import ATP-binding protein RbsA Salmonella choleraesuis (strain SC-B67)
A1B9K8 5.74e-15 78 29 6 213 3 znuC Zinc import ATP-binding protein ZnuC Paracoccus denitrificans (strain Pd 1222)
A1B9K8 9.96e-06 50 27 5 180 3 znuC Zinc import ATP-binding protein ZnuC Paracoccus denitrificans (strain Pd 1222)
Q9HT73 7.21e-15 78 29 7 215 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9HT73 1.65e-09 62 28 4 181 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02DK9 7.21e-15 78 29 7 215 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas aeruginosa (strain UCBPP-PA14)
Q02DK9 1.65e-09 62 28 4 181 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas aeruginosa (strain UCBPP-PA14)
Q1M7W6 7.72e-15 78 30 5 203 3 nodI Nod factor export ATP-binding protein I Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q1M7W6 2.85e-06 52 26 4 170 3 nodI Nod factor export ATP-binding protein I Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q7MMN0 7.87e-15 77 28 3 192 3 znuC Zinc import ATP-binding protein ZnuC Vibrio vulnificus (strain YJ016)
Q7MMN0 2.34e-07 55 27 3 168 3 znuC Zinc import ATP-binding protein ZnuC Vibrio vulnificus (strain YJ016)
Q8DFQ4 7.87e-15 77 28 3 192 3 znuC Zinc import ATP-binding protein ZnuC Vibrio vulnificus (strain CMCP6)
Q8DFQ4 2.34e-07 55 27 3 168 3 znuC Zinc import ATP-binding protein ZnuC Vibrio vulnificus (strain CMCP6)
Q13LX0 8.03e-15 80 24 14 463 3 rbsA Ribose import ATP-binding protein RbsA Paraburkholderia xenovorans (strain LB400)
Q13LX0 3.71e-10 65 29 6 217 3 rbsA Ribose import ATP-binding protein RbsA Paraburkholderia xenovorans (strain LB400)
Q13LX0 9.19e-07 55 27 6 213 3 rbsA Ribose import ATP-binding protein RbsA Paraburkholderia xenovorans (strain LB400)
Q57399 8.48e-15 77 27 3 218 1 molC Molybdate import ATP-binding protein MolC Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q1BWI2 8.9e-15 78 31 6 206 3 nodI Nod factor export ATP-binding protein I Burkholderia orbicola (strain AU 1054)
Q1BWI2 0.000489 45 43 0 55 3 nodI Nod factor export ATP-binding protein I Burkholderia orbicola (strain AU 1054)
Q4KKK4 8.98e-15 77 28 7 215 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q4KKK4 7.69e-09 60 28 4 159 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q39GT7 9.32e-15 78 32 9 208 3 nodI Nod factor export ATP-binding protein I Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q39GT7 1.75e-05 50 27 4 172 3 nodI Nod factor export ATP-binding protein I Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q9CF44 9.62e-15 80 22 14 459 3 rbsA Ribose import ATP-binding protein RbsA Lactococcus lactis subsp. lactis (strain IL1403)
Q9CF44 4.66e-07 55 24 5 206 3 rbsA Ribose import ATP-binding protein RbsA Lactococcus lactis subsp. lactis (strain IL1403)
P04983 1.07e-14 79 24 14 460 1 rbsA Ribose import ATP-binding protein RbsA Escherichia coli (strain K12)
P04983 1.06e-06 54 26 6 200 1 rbsA Ribose import ATP-binding protein RbsA Escherichia coli (strain K12)
P04983 9.41e-05 48 28 0 69 1 rbsA Ribose import ATP-binding protein RbsA Escherichia coli (strain K12)
Q0TAW0 1.07e-14 79 24 14 460 3 rbsA Ribose import ATP-binding protein RbsA Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q0TAW0 1.06e-06 54 26 6 200 3 rbsA Ribose import ATP-binding protein RbsA Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q0TAW0 9.41e-05 48 28 0 69 3 rbsA Ribose import ATP-binding protein RbsA Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q8D7T7 1.12e-14 79 25 19 474 3 rbsA Ribose import ATP-binding protein RbsA Vibrio vulnificus (strain CMCP6)
Q8D7T7 8.93e-05 48 27 0 69 3 rbsA Ribose import ATP-binding protein RbsA Vibrio vulnificus (strain CMCP6)
Q9KQB8 1.5e-14 77 29 4 194 3 znuC Zinc import ATP-binding protein ZnuC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9KQB8 0.000134 47 27 4 159 3 znuC Zinc import ATP-binding protein ZnuC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q1R4I3 1.91e-14 79 24 14 460 3 rbsA Ribose import ATP-binding protein RbsA Escherichia coli (strain UTI89 / UPEC)
Q1R4I3 1.08e-06 54 26 6 200 3 rbsA Ribose import ATP-binding protein RbsA Escherichia coli (strain UTI89 / UPEC)
Q1R4I3 9.33e-05 48 28 0 69 3 rbsA Ribose import ATP-binding protein RbsA Escherichia coli (strain UTI89 / UPEC)
Q8ZKV9 1.93e-14 79 24 15 465 3 rbsA Ribose import ATP-binding protein RbsA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8ZKV9 5.82e-07 55 27 6 194 3 rbsA Ribose import ATP-binding protein RbsA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8ZKV9 7.84e-05 48 22 6 218 3 rbsA Ribose import ATP-binding protein RbsA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
O34362 1.96e-14 79 23 15 477 1 ykoD Putative HMP/thiamine import ATP-binding protein YkoD Bacillus subtilis (strain 168)
O34362 8.53e-09 61 24 5 209 1 ykoD Putative HMP/thiamine import ATP-binding protein YkoD Bacillus subtilis (strain 168)
Q81CT8 1.96e-14 79 24 19 493 3 BC_2655 Putative ABC transporter ATP-binding protein BC_2655 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q81CT8 8.89e-10 64 24 6 197 3 BC_2655 Putative ABC transporter ATP-binding protein BC_2655 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q55281 1.99e-14 76 30 4 169 3 mntA Manganese transport system ATP-binding protein MntA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q55281 6.08e-07 54 25 5 203 3 mntA Manganese transport system ATP-binding protein MntA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q81N53 2.03e-14 79 23 14 472 3 BA_3364 Putative ABC transporter ATP-binding protein BA_3364/GBAA_3364/BAS3118 Bacillus anthracis
Q8XAW7 2.15e-14 79 24 14 460 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Escherichia coli O157:H7
Q8XAW7 1.06e-06 54 27 6 194 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Escherichia coli O157:H7
Q8XAW7 9.17e-05 48 28 0 69 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Escherichia coli O157:H7
Q4W575 2.28e-14 77 31 7 203 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q4W575 2.99e-05 49 30 6 180 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9JVH1 2.28e-14 77 31 7 203 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q9JVH1 2.99e-05 49 30 6 180 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
P37624 2.29e-14 79 25 8 350 1 rbbA Ribosome-associated ATPase Escherichia coli (strain K12)
P37624 3.56e-09 63 28 4 205 1 rbbA Ribosome-associated ATPase Escherichia coli (strain K12)
P37624 0.000107 48 25 6 198 1 rbbA Ribosome-associated ATPase Escherichia coli (strain K12)
Q8RD43 2.48e-14 78 23 13 469 3 rbsA Ribose import ATP-binding protein RbsA Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q8RD43 2.84e-05 50 23 7 196 3 rbsA Ribose import ATP-binding protein RbsA Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q8FBS3 2.52e-14 78 24 14 460 3 rbsA Ribose import ATP-binding protein RbsA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8FBS3 7.45e-06 52 26 6 200 3 rbsA Ribose import ATP-binding protein RbsA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8FBS3 9.92e-05 48 28 0 69 3 rbsA Ribose import ATP-binding protein RbsA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q2RGX2 3.06e-14 78 22 16 483 3 xylG Xylose import ATP-binding protein XylG Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q2RGX2 1.02e-05 51 28 2 110 3 xylG Xylose import ATP-binding protein XylG Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q3KKA1 3.42e-14 75 28 7 215 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas fluorescens (strain Pf0-1)
Q3KKA1 9.09e-09 59 27 4 172 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas fluorescens (strain Pf0-1)
Q7MEV1 3.53e-14 78 25 19 474 3 rbsA Ribose import ATP-binding protein RbsA Vibrio vulnificus (strain YJ016)
Q7MEV1 8.78e-05 48 27 0 69 3 rbsA Ribose import ATP-binding protein RbsA Vibrio vulnificus (strain YJ016)
Q8RD07 4.01e-14 75 29 6 193 3 TTE0246 Putative ABC transporter ATP-binding protein TTE0246 Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q8RD07 1.11e-06 53 28 5 183 3 TTE0246 Putative ABC transporter ATP-binding protein TTE0246 Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q02QM1 4.22e-14 75 31 9 212 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Pseudomonas aeruginosa (strain UCBPP-PA14)
Q9X051 4.43e-14 78 23 15 447 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q9X051 2.17e-09 63 26 6 202 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q9X051 8.52e-05 48 28 1 104 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q1WVI7 4.85e-14 77 26 6 227 3 potA Spermidine/putrescine import ATP-binding protein PotA Ligilactobacillus salivarius (strain UCC118)
Q8Z2R4 5.09e-14 77 24 15 465 3 rbsA Ribose import ATP-binding protein RbsA Salmonella typhi
Q8Z2R4 5.77e-07 55 27 6 194 3 rbsA Ribose import ATP-binding protein RbsA Salmonella typhi
Q8Z2R4 5.68e-05 49 22 6 218 3 rbsA Ribose import ATP-binding protein RbsA Salmonella typhi
Q3IWB5 5.12e-14 75 30 5 213 3 znuC Zinc import ATP-binding protein ZnuC Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q3IWB5 3.2e-11 67 30 5 180 3 znuC Zinc import ATP-binding protein ZnuC Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q9HYL7 5.44e-14 75 29 10 237 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q82B58 5.83e-14 77 30 7 220 3 SAV_5847 Putative ABC transporter ATP-binding protein SAV_5847 Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q830W6 5.89e-14 76 28 6 209 3 potA Spermidine/putrescine import ATP-binding protein PotA Enterococcus faecalis (strain ATCC 700802 / V583)
A3DJK3 5.9e-14 75 28 8 212 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q8G838 5.95e-14 78 24 15 491 3 BL0043 Putative ABC transporter ATP-binding protein BL0043 Bifidobacterium longum (strain NCC 2705)
Q8G838 1.69e-11 70 31 7 194 3 BL0043 Putative ABC transporter ATP-binding protein BL0043 Bifidobacterium longum (strain NCC 2705)
Q81PZ8 6.2e-14 77 23 17 495 3 BA_2641 Putative ABC transporter ATP-binding protein BA_2641/GBAA_2641/BAS2461 Bacillus anthracis
Q81PZ8 3.27e-13 75 25 4 194 3 BA_2641 Putative ABC transporter ATP-binding protein BA_2641/GBAA_2641/BAS2461 Bacillus anthracis
Q73R11 6.26e-14 77 24 14 441 3 TDE_0282 Putative ABC transporter ATP-binding protein TDE_0282 Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q8REE1 7.12e-14 77 20 12 469 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q03PF2 7.48e-14 76 29 7 211 3 potA Spermidine/putrescine import ATP-binding protein PotA Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
Q03PF2 0.000743 45 23 4 189 3 potA Spermidine/putrescine import ATP-binding protein PotA Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
Q737I0 7.54e-14 77 22 17 495 3 BCE_2668 Putative ABC transporter ATP-binding protein BCE_2668 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q737I0 6.43e-09 62 23 6 197 3 BCE_2668 Putative ABC transporter ATP-binding protein BCE_2668 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q4QN44 7.77e-14 77 23 14 462 3 rbsA Ribose import ATP-binding protein RbsA Haemophilus influenzae (strain 86-028NP)
Q4QN44 3.55e-05 50 30 0 70 3 rbsA Ribose import ATP-binding protein RbsA Haemophilus influenzae (strain 86-028NP)
P26050 7.93e-14 75 30 6 207 3 nodI Nod factor export ATP-binding protein I Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
P26050 2.2e-06 53 27 6 205 3 nodI Nod factor export ATP-binding protein I Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q0S0X2 8.02e-14 75 27 4 218 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Rhodococcus jostii (strain RHA1)
Q0S0X2 1.12e-05 50 25 5 192 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Rhodococcus jostii (strain RHA1)
Q5PJX5 8.08e-14 77 23 14 466 3 rbsA Ribose import ATP-binding protein RbsA Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q5PJX5 1.72e-06 53 27 7 196 3 rbsA Ribose import ATP-binding protein RbsA Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q5PJX5 8.55e-05 48 22 6 218 3 rbsA Ribose import ATP-binding protein RbsA Salmonella paratyphi A (strain ATCC 9150 / SARB42)
P08720 8.22e-14 75 30 5 203 3 nodI Nod factor export ATP-binding protein I Rhizobium leguminosarum bv. viciae
P08720 6.05e-06 51 26 4 170 3 nodI Nod factor export ATP-binding protein I Rhizobium leguminosarum bv. viciae
Q5FA19 8.74e-14 76 30 7 208 1 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q5FA19 3.38e-06 52 31 7 183 1 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q7N545 8.75e-14 74 28 6 221 3 znuC Zinc import ATP-binding protein ZnuC Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q7N545 4.37e-07 54 28 4 159 3 znuC Zinc import ATP-binding protein ZnuC Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q6BEX0 9.89e-14 77 23 15 460 1 ytfR Galactofuranose transporter ATP-binding protein YtfR Escherichia coli (strain K12)
Q6BEX0 0.000126 48 29 0 78 1 ytfR Galactofuranose transporter ATP-binding protein YtfR Escherichia coli (strain K12)
A0KPH6 1.04e-13 74 26 4 219 3 znuC Zinc import ATP-binding protein ZnuC Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
A0KPH6 5.12e-09 60 29 4 160 3 znuC Zinc import ATP-binding protein ZnuC Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q6HI76 1.05e-13 77 23 18 495 3 BT9727_2424 Putative ABC transporter ATP-binding protein BT9727_2424 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q6HI76 3.7e-13 75 25 4 194 3 BT9727_2424 Putative ABC transporter ATP-binding protein BT9727_2424 Bacillus thuringiensis subsp. konkukian (strain 97-27)
P63299 1.09e-13 76 23 15 460 3 ytfR Galactofuranose transporter ATP-binding protein YtfR Escherichia coli O157:H7
P63299 3.2e-08 59 28 6 207 3 ytfR Galactofuranose transporter ATP-binding protein YtfR Escherichia coli O157:H7
P63299 0.000128 48 29 0 78 3 ytfR Galactofuranose transporter ATP-binding protein YtfR Escherichia coli O157:H7
Q734T1 1.15e-13 77 24 17 509 3 BCE_3323 Putative ABC transporter ATP-binding protein BCE_3323 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q60AB3 1.15e-13 73 26 7 212 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q9KAG5 1.19e-13 76 21 13 464 3 BH2322 Putative ribose/galactose/methyl galactoside import ATP-binding protein Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q9KAG5 0.000303 47 22 4 204 3 BH2322 Putative ribose/galactose/methyl galactoside import ATP-binding protein Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q6D4A8 1.23e-13 74 28 6 221 3 znuC Zinc import ATP-binding protein ZnuC Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q6D4A8 2.7e-08 58 30 5 168 3 znuC Zinc import ATP-binding protein ZnuC Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q6LG59 1.32e-13 76 22 14 476 3 mglA2 Galactose/methyl galactoside import ATP-binding protein MglA 2 Photobacterium profundum (strain SS9)
P94440 1.35e-13 75 29 5 202 1 lnrL Linearmycin resistance ATP-binding protein LnrL Bacillus subtilis (strain 168)
P94440 1.3e-07 57 23 4 189 1 lnrL Linearmycin resistance ATP-binding protein LnrL Bacillus subtilis (strain 168)
Q8Z5W6 1.39e-13 73 30 6 205 3 znuC Zinc import ATP-binding protein ZnuC Salmonella typhi
Q8Z5W6 0.000539 45 42 0 49 3 znuC Zinc import ATP-binding protein ZnuC Salmonella typhi
Q5PIA5 1.45e-13 73 28 7 225 3 znuC Zinc import ATP-binding protein ZnuC Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q5PIA5 0.000116 47 26 2 166 3 znuC Zinc import ATP-binding protein ZnuC Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q57NA5 1.45e-13 73 28 7 225 3 znuC Zinc import ATP-binding protein ZnuC Salmonella choleraesuis (strain SC-B67)
Q57NA5 0.000116 47 26 2 166 3 znuC Zinc import ATP-binding protein ZnuC Salmonella choleraesuis (strain SC-B67)
P36947 1.46e-13 76 22 14 477 3 rbsA Ribose import ATP-binding protein RbsA Bacillus subtilis (strain 168)
P36947 2.18e-11 69 25 6 204 3 rbsA Ribose import ATP-binding protein RbsA Bacillus subtilis (strain 168)
P36947 0.000302 47 28 0 71 3 rbsA Ribose import ATP-binding protein RbsA Bacillus subtilis (strain 168)
P42360 1.55e-13 73 27 3 172 1 scaC Manganese import ATP-binding protein ScaC Streptococcus gordonii
P42360 5.97e-08 57 22 4 204 1 scaC Manganese import ATP-binding protein ScaC Streptococcus gordonii
Q8RGC8 1.77e-13 75 31 10 218 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
P44735 1.84e-13 75 22 14 465 3 rbsA Ribose import ATP-binding protein RbsA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P44735 1.59e-05 50 29 3 100 3 rbsA Ribose import ATP-binding protein RbsA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q32HA3 1.94e-13 73 28 6 225 3 znuC Zinc import ATP-binding protein ZnuC Shigella dysenteriae serotype 1 (strain Sd197)
Q32HA3 1.91e-05 49 27 3 170 3 znuC Zinc import ATP-binding protein ZnuC Shigella dysenteriae serotype 1 (strain Sd197)
Q8ZNV7 2.03e-13 73 28 6 221 2 znuC Zinc import ATP-binding protein ZnuC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8ZNV7 8.15e-05 47 26 2 166 2 znuC Zinc import ATP-binding protein ZnuC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q9Z3I3 2.3e-13 74 30 7 210 3 nodI Nod factor export ATP-binding protein I Bradyrhizobium sp. (strain SNU001)
Q9Z3I3 5.14e-05 48 26 6 201 3 nodI Nod factor export ATP-binding protein I Bradyrhizobium sp. (strain SNU001)
Q8KLG1 2.5e-13 74 27 6 204 3 nodI Nod factor export ATP-binding protein I Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q8KLG1 3.14e-06 52 26 5 198 3 nodI Nod factor export ATP-binding protein I Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q5WBL0 2.81e-13 73 29 4 202 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Shouchella clausii (strain KSM-K16)
Q5WBL0 0.000141 47 24 7 203 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Shouchella clausii (strain KSM-K16)
Q6D2F6 2.94e-13 74 30 8 199 3 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q57243 3.58e-13 73 27 6 212 3 HI_1272 Uncharacterized ABC transporter ATP-binding protein HI_1272 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q882S0 3.61e-13 73 29 8 209 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q0B1U4 3.62e-13 75 22 14 478 3 xylG Xylose import ATP-binding protein XylG Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q6VMN4 3.79e-13 75 20 14 481 3 xylG Xylose import ATP-binding protein XylG Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
Q6VMN4 0.000108 48 28 0 76 3 xylG Xylose import ATP-binding protein XylG Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
Q38VW6 4.08e-13 74 30 7 214 3 potA Spermidine/putrescine import ATP-binding protein PotA Latilactobacillus sakei subsp. sakei (strain 23K)
Q03CA4 4.55e-13 74 24 15 440 3 rbsA Ribose import ATP-binding protein RbsA Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
Q03CA4 4.15e-09 62 25 5 199 3 rbsA Ribose import ATP-binding protein RbsA Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
Q9WXX8 4.57e-13 72 26 4 208 3 TM_0124 Probable metal transport system ATP-binding protein TM_0124 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q9WXX8 1.57e-07 55 24 3 196 3 TM_0124 Probable metal transport system ATP-binding protein TM_0124 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
P50332 4.94e-13 73 30 8 234 3 nodI Nod factor export ATP-binding protein I Neorhizobium galegae
P50332 1.36e-06 53 28 3 169 3 nodI Nod factor export ATP-binding protein I Neorhizobium galegae
Q8DMX9 5.2e-13 72 30 5 189 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q97N50 5.2e-13 72 30 5 189 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q04HV7 5.2e-13 72 30 5 189 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q3Z2L6 5.35e-13 72 28 6 225 3 znuC Zinc import ATP-binding protein ZnuC Shigella sonnei (strain Ss046)
Q3Z2L6 1.23e-05 50 27 2 166 3 znuC Zinc import ATP-binding protein ZnuC Shigella sonnei (strain Ss046)
Q322E8 5.35e-13 72 28 6 225 3 znuC Zinc import ATP-binding protein ZnuC Shigella boydii serotype 4 (strain Sb227)
Q322E8 1.23e-05 50 27 2 166 3 znuC Zinc import ATP-binding protein ZnuC Shigella boydii serotype 4 (strain Sb227)
Q1RAS6 5.35e-13 72 28 6 225 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli (strain UTI89 / UPEC)
Q1RAS6 1.23e-05 50 27 2 166 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli (strain UTI89 / UPEC)
P0A9X1 5.35e-13 72 28 6 225 1 znuC Zinc import ATP-binding protein ZnuC Escherichia coli (strain K12)
P0A9X1 1.23e-05 50 27 2 166 1 znuC Zinc import ATP-binding protein ZnuC Escherichia coli (strain K12)
P0A9X2 5.35e-13 72 28 6 225 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9X2 1.23e-05 50 27 2 166 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TGX4 5.35e-13 72 28 6 225 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q0TGX4 1.23e-05 50 27 2 166 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AC19 5.35e-13 72 28 6 225 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O1:K1 / APEC
A1AC19 1.23e-05 50 27 2 166 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O1:K1 / APEC
P0A9X3 5.35e-13 72 28 6 225 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O157:H7
P0A9X3 1.23e-05 50 27 2 166 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O157:H7
Q8A883 5.69e-13 74 30 6 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q1RGL1 6.03e-13 71 25 4 210 3 znuC Zinc import ATP-binding protein ZnuC Rickettsia bellii (strain RML369-C)
Q5E4V6 6.06e-13 74 23 14 476 3 rbsA Ribose import ATP-binding protein RbsA Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q5E4V6 0.000129 48 27 0 69 3 rbsA Ribose import ATP-binding protein RbsA Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q2PBM0 6.16e-13 74 23 11 367 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Photorhabdus luminescens
Q1LNM0 6.68e-13 72 30 7 208 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q1LNM0 6.64e-06 51 27 7 215 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
O68106 6.86e-13 72 34 7 201 1 cbiO Cobalt import ATP-binding protein CbiO Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
O68106 3.71e-06 52 29 4 184 1 cbiO Cobalt import ATP-binding protein CbiO Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
Q9WXX0 6.87e-13 74 22 15 447 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q9WXX0 4.36e-11 68 28 5 191 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q8RBQ1 6.87e-13 74 20 12 469 3 TTE0763 Putative ribose/galactose/methyl galactoside import ATP-binding protein Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q8RBQ1 4.49e-06 52 21 4 195 3 TTE0763 Putative ribose/galactose/methyl galactoside import ATP-binding protein Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q92XW1 8.38e-13 73 28 6 208 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Rhizobium meliloti (strain 1021)
Q0I4A9 8.67e-13 72 28 3 192 3 znuC Zinc import ATP-binding protein ZnuC Histophilus somni (strain 129Pt)
Q30V33 8.93e-13 73 29 8 205 3 potA Spermidine/putrescine import ATP-binding protein PotA Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
Q97X60 8.98e-13 73 22 14 485 3 SSO1893 Putative ABC transporter ATP-binding protein SSO1893 Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q97X60 5.23e-08 58 27 5 192 3 SSO1893 Putative ABC transporter ATP-binding protein SSO1893 Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q8E7N9 9.07e-13 73 23 14 455 3 rbsA Ribose import ATP-binding protein RbsA Streptococcus agalactiae serotype III (strain NEM316)
Q8E7N9 1.34e-08 60 26 7 204 3 rbsA Ribose import ATP-binding protein RbsA Streptococcus agalactiae serotype III (strain NEM316)
Q8E7N9 0.000504 46 31 0 69 3 rbsA Ribose import ATP-binding protein RbsA Streptococcus agalactiae serotype III (strain NEM316)
Q3K3R2 9.07e-13 73 23 16 468 3 rbsA Ribose import ATP-binding protein RbsA Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q3K3R2 1.29e-08 60 26 7 204 3 rbsA Ribose import ATP-binding protein RbsA Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q3K3R2 0.000504 46 31 0 69 3 rbsA Ribose import ATP-binding protein RbsA Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q0K9I2 9.08e-13 72 32 8 204 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q0K9I2 1.04e-05 50 26 6 222 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
P23703 9.1e-13 72 28 8 204 3 nodI Nod factor export ATP-binding protein I Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
P23703 2.64e-05 50 27 7 206 3 nodI Nod factor export ATP-binding protein I Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q9KXJ6 9.9e-13 73 31 6 202 3 SCO2324 Putative ABC transporter ATP-binding protein SCO2324 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q83KR7 9.95e-13 71 28 6 225 3 znuC Zinc import ATP-binding protein ZnuC Shigella flexneri
Q83KR7 2.34e-05 49 27 2 166 3 znuC Zinc import ATP-binding protein ZnuC Shigella flexneri
Q0T3U8 9.95e-13 71 28 6 225 3 znuC Zinc import ATP-binding protein ZnuC Shigella flexneri serotype 5b (strain 8401)
Q0T3U8 2.34e-05 49 27 2 166 3 znuC Zinc import ATP-binding protein ZnuC Shigella flexneri serotype 5b (strain 8401)
Q65P77 1.04e-12 72 29 5 189 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
O69063 1.05e-12 72 31 5 185 3 htxD Hypophosphite import ATP-binding protein HtxD Stutzerimonas stutzeri
A3CRB9 1.08e-12 72 29 7 213 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus sanguinis (strain SK36)
Q50966 1.14e-12 72 28 5 203 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria gonorrhoeae
Q50966 9.98e-06 51 29 5 184 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria gonorrhoeae
P0A9V4 1.15e-12 71 27 6 220 1 lptB Lipopolysaccharide export system ATP-binding protein LptB Shigella flexneri
P0A9V4 0.000405 45 22 2 205 1 lptB Lipopolysaccharide export system ATP-binding protein LptB Shigella flexneri
P0A9V1 1.15e-12 71 27 6 220 1 lptB Lipopolysaccharide export system ATP-binding protein LptB Escherichia coli (strain K12)
P0A9V1 0.000405 45 22 2 205 1 lptB Lipopolysaccharide export system ATP-binding protein LptB Escherichia coli (strain K12)
P0A9V2 1.15e-12 71 27 6 220 3 lptB Lipopolysaccharide export system ATP-binding protein LptB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9V2 0.000405 45 22 2 205 3 lptB Lipopolysaccharide export system ATP-binding protein LptB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9V3 1.15e-12 71 27 6 220 3 lptB Lipopolysaccharide export system ATP-binding protein LptB Escherichia coli O157:H7
P0A9V3 0.000405 45 22 2 205 3 lptB Lipopolysaccharide export system ATP-binding protein LptB Escherichia coli O157:H7
Q8TIX0 1.15e-12 72 27 8 236 3 MA_4020 Putative ABC transporter ATP-binding protein MA_4020 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q8TIX0 3.33e-05 49 28 7 201 3 MA_4020 Putative ABC transporter ATP-binding protein MA_4020 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q03AH0 1.17e-12 72 29 7 216 3 potA Spermidine/putrescine import ATP-binding protein PotA Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
O34392 1.17e-12 70 30 6 195 2 ytrE ABC transporter ATP-binding protein YtrE Bacillus subtilis (strain 168)
O34392 5.84e-05 48 23 5 182 2 ytrE ABC transporter ATP-binding protein YtrE Bacillus subtilis (strain 168)
Q2SPI3 1.27e-12 71 26 4 221 3 znuC1 Zinc import ATP-binding protein ZnuC 1 Hahella chejuensis (strain KCTC 2396)
Q2SPI3 3.48e-08 58 29 7 212 3 znuC1 Zinc import ATP-binding protein ZnuC 1 Hahella chejuensis (strain KCTC 2396)
Q1GL85 1.28e-12 71 28 5 215 3 znuC Zinc import ATP-binding protein ZnuC Ruegeria sp. (strain TM1040)
Q1GL85 1.19e-07 56 26 5 215 3 znuC Zinc import ATP-binding protein ZnuC Ruegeria sp. (strain TM1040)
Q04G50 1.29e-12 72 28 8 213 3 potA Spermidine/putrescine import ATP-binding protein PotA Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
Q04G50 0.00085 45 26 7 185 3 potA Spermidine/putrescine import ATP-binding protein PotA Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
Q7N2D9 1.33e-12 73 22 12 383 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q0A9E2 1.34e-12 71 30 6 214 3 znuC Zinc import ATP-binding protein ZnuC Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q0A9E2 5.92e-07 54 31 2 144 3 znuC Zinc import ATP-binding protein ZnuC Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q5M243 1.38e-12 71 31 6 199 1 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q5LXJ3 1.38e-12 71 31 6 199 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus thermophilus (strain CNRZ 1066)
Q8U9B0 1.43e-12 73 22 14 478 3 Atu3818 Putative ribose/galactose/methyl galactoside import ATP-binding protein 3 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8U9B0 1.84e-06 53 31 0 80 3 Atu3818 Putative ribose/galactose/methyl galactoside import ATP-binding protein 3 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8PUE7 1.46e-12 73 24 9 325 3 MM_2387 Putative ABC transporter ATP-binding protein MM_2387 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q8PUE7 1.39e-06 54 25 6 196 3 MM_2387 Putative ABC transporter ATP-binding protein MM_2387 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q8PUE7 0.000719 45 29 6 178 3 MM_2387 Putative ABC transporter ATP-binding protein MM_2387 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q8PP41 1.47e-12 70 27 4 190 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Xanthomonas axonopodis pv. citri (strain 306)
Q8PP41 3.65e-09 60 29 4 175 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Xanthomonas axonopodis pv. citri (strain 306)
Q92G36 1.51e-12 70 25 4 210 3 znuC Zinc import ATP-binding protein ZnuC Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q8E281 1.52e-12 73 23 16 468 3 rbsA Ribose import ATP-binding protein RbsA Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E281 2e-08 60 26 7 204 3 rbsA Ribose import ATP-binding protein RbsA Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E281 0.000555 46 31 0 69 3 rbsA Ribose import ATP-binding protein RbsA Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
P55476 1.57e-12 72 31 7 207 3 nodI Nod factor export ATP-binding protein I Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P55476 0.000673 45 26 4 171 3 nodI Nod factor export ATP-binding protein I Sinorhizobium fredii (strain NBRC 101917 / NGR234)
O34979 1.71e-12 70 30 8 221 3 yvrO Uncharacterized ABC transporter ATP-binding protein YvrO Bacillus subtilis (strain 168)
O34979 9.42e-06 50 29 0 78 3 yvrO Uncharacterized ABC transporter ATP-binding protein YvrO Bacillus subtilis (strain 168)
Q87ZE0 1.79e-12 73 23 17 475 3 PSPTO_3489 Putative ribose/galactose/methyl galactoside import ATP-binding protein Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q87ZE0 6.93e-05 48 25 6 197 3 PSPTO_3489 Putative ribose/galactose/methyl galactoside import ATP-binding protein Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q668Q3 1.98e-12 72 29 8 204 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Yersinia pseudotuberculosis serotype I (strain IP32953)
Q668Q3 0.000392 46 22 7 235 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Yersinia pseudotuberculosis serotype I (strain IP32953)
P32721 1.99e-12 72 20 10 471 3 alsA D-allose import ATP-binding protein AlsA Escherichia coli (strain K12)
Q2GFZ6 2.07e-12 70 25 4 209 3 znuC Zinc import ATP-binding protein ZnuC Ehrlichia chaffeensis (strain ATCC CRL-10679 / Arkansas)
Q1CJS9 2.17e-12 71 29 8 204 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Yersinia pestis bv. Antiqua (strain Nepal516)
Q1CJS9 0.000378 46 22 7 235 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZCM2 2.17e-12 71 29 8 204 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Yersinia pestis
Q8ZCM2 0.000378 46 22 7 235 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Yersinia pestis
Q1C607 2.17e-12 71 29 8 204 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Yersinia pestis bv. Antiqua (strain Antiqua)
Q1C607 0.000378 46 22 7 235 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Yersinia pestis bv. Antiqua (strain Antiqua)
P48334 2.36e-12 70 25 3 199 3 None Probable ABC transporter ATP-binding protein in ycf23-apcF intergenic region Cyanophora paradoxa
P48334 1.19e-08 59 26 5 182 3 None Probable ABC transporter ATP-binding protein in ycf23-apcF intergenic region Cyanophora paradoxa
A1B9Q7 2.56e-12 71 30 5 203 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Paracoccus denitrificans (strain Pd 1222)
Q0B6I6 2.95e-12 71 30 8 236 3 metN2 Methionine import ATP-binding protein MetN 2 Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
O84421 3.33e-12 69 29 4 200 3 CT_416 Probable metal transport system ATP-binding protein CT_416 Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
Q8YDN0 3.37e-12 72 24 10 374 3 xylG Xylose import ATP-binding protein XylG Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q8YDN0 7.81e-09 61 28 6 204 3 xylG Xylose import ATP-binding protein XylG Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q65UW1 3.77e-12 72 22 18 474 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q65UW1 0.000832 45 23 1 106 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q7MG07 3.8e-12 72 22 19 495 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Vibrio vulnificus (strain YJ016)
Q9WY65 3.86e-12 70 30 9 205 1 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q9WY65 0.000379 45 32 0 74 1 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q4L885 4.09e-12 70 26 5 187 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Staphylococcus haemolyticus (strain JCSC1435)
Q8D4H4 4.15e-12 71 22 19 495 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Vibrio vulnificus (strain CMCP6)
P47425 4.22e-12 70 28 10 206 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q5FM63 4.23e-12 70 26 5 198 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
Q13LD8 4.27e-12 71 31 9 232 3 metN2 Methionine import ATP-binding protein MetN 2 Paraburkholderia xenovorans (strain LB400)
Q9CP98 4.58e-12 71 22 17 484 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Pasteurella multocida (strain Pm70)
Q9CP98 4.28e-06 52 24 6 197 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Pasteurella multocida (strain Pm70)
Q825P1 4.69e-12 71 24 13 448 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q825P1 1.63e-05 50 23 5 241 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q03JH1 4.92e-12 70 28 5 200 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q6RCE0 4.92e-12 69 29 8 210 3 phnC Phosphonates import ATP-binding protein PhnC Stutzerimonas stutzeri
Q8PYH5 5.04e-12 70 27 10 258 3 MM_0887 Putative ABC transporter ATP-binding protein MM_0887 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q1BJW2 5.06e-12 71 27 6 222 3 araG2 Arabinose import ATP-binding protein AraG 2 Burkholderia orbicola (strain AU 1054)
Q1BJW2 2.47e-09 63 22 13 461 3 araG2 Arabinose import ATP-binding protein AraG 2 Burkholderia orbicola (strain AU 1054)
Q1BJW2 0.000737 45 29 1 99 3 araG2 Arabinose import ATP-binding protein AraG 2 Burkholderia orbicola (strain AU 1054)
A0B3Z7 5.06e-12 71 27 6 222 3 araG2 Arabinose import ATP-binding protein AraG 2 Burkholderia cenocepacia (strain HI2424)
A0B3Z7 2.47e-09 63 22 13 461 3 araG2 Arabinose import ATP-binding protein AraG 2 Burkholderia cenocepacia (strain HI2424)
A0B3Z7 0.000737 45 29 1 99 3 araG2 Arabinose import ATP-binding protein AraG 2 Burkholderia cenocepacia (strain HI2424)
Q39AT4 5.24e-12 70 30 8 236 3 metN2 Methionine import ATP-binding protein MetN 2 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q5LYN4 5.84e-12 70 28 5 200 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus thermophilus (strain CNRZ 1066)
Q5M397 5.95e-12 70 28 5 200 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
A0LM36 6.36e-12 71 27 6 217 3 macB Macrolide export ATP-binding/permease protein MacB Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
P44692 6.73e-12 69 28 5 227 3 znuC Zinc import ATP-binding protein ZnuC Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A0PY57 6.8e-12 70 28 7 207 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium novyi (strain NT)
Q03I82 6.81e-12 69 30 7 211 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q13ZJ1 6.97e-12 69 30 6 200 3 nodI Nod factor export ATP-binding protein I Paraburkholderia xenovorans (strain LB400)
Q13ZJ1 0.00041 45 40 0 59 3 nodI Nod factor export ATP-binding protein I Paraburkholderia xenovorans (strain LB400)
Q4KC87 7.07e-12 70 28 6 194 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q4KC87 0.000201 47 25 7 182 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q13RB6 7.26e-12 71 22 14 489 3 xylG Xylose import ATP-binding protein XylG Paraburkholderia xenovorans (strain LB400)
Q13RB6 8.66e-12 70 29 6 209 3 xylG Xylose import ATP-binding protein XylG Paraburkholderia xenovorans (strain LB400)
Q13RB6 4.42e-05 49 22 4 205 3 xylG Xylose import ATP-binding protein XylG Paraburkholderia xenovorans (strain LB400)
Q1CI46 7.67e-12 68 30 7 193 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZFR4 7.67e-12 68 30 7 193 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Yersinia pestis
Q1C6Q8 7.67e-12 68 30 7 193 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Yersinia pestis bv. Antiqua (strain Antiqua)
Q11C01 7.92e-12 70 24 15 456 3 rbsA Ribose import ATP-binding protein RbsA Chelativorans sp. (strain BNC1)
Q4ZU82 7.92e-12 69 29 8 209 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Pseudomonas syringae pv. syringae (strain B728a)
Q146E7 8.49e-12 68 27 4 204 3 tauB1 Taurine import ATP-binding protein TauB 1 Paraburkholderia xenovorans (strain LB400)
Q73P71 8.69e-12 68 26 6 217 3 phnC Phosphonates import ATP-binding protein PhnC Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q73P71 0.000156 47 23 3 180 3 phnC Phosphonates import ATP-binding protein PhnC Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q1LKJ2 8.85e-12 69 29 6 200 3 nodI Nod factor export ATP-binding protein I Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q1LKJ2 6.54e-06 51 26 3 168 3 nodI Nod factor export ATP-binding protein I Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q1BR30 8.88e-12 70 30 8 236 3 metN2 Methionine import ATP-binding protein MetN 2 Burkholderia orbicola (strain AU 1054)
A0B344 8.88e-12 70 30 8 236 3 metN2 Methionine import ATP-binding protein MetN 2 Burkholderia cenocepacia (strain HI2424)
Q28VN1 9.01e-12 68 27 5 211 3 znuC Zinc import ATP-binding protein ZnuC Jannaschia sp. (strain CCS1)
Q28VN1 1.31e-07 56 29 4 157 3 znuC Zinc import ATP-binding protein ZnuC Jannaschia sp. (strain CCS1)
Q160Y9 9.16e-12 68 26 5 206 3 znuC Zinc import ATP-binding protein ZnuC Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q160Y9 1.45e-08 59 31 3 157 3 znuC Zinc import ATP-binding protein ZnuC Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q1BG93 9.46e-12 70 22 15 471 3 xylG Xylose import ATP-binding protein XylG Burkholderia orbicola (strain AU 1054)
Q1BG93 0.000133 48 30 0 69 3 xylG Xylose import ATP-binding protein XylG Burkholderia orbicola (strain AU 1054)
A0KE53 9.46e-12 70 22 15 471 3 xylG Xylose import ATP-binding protein XylG Burkholderia cenocepacia (strain HI2424)
A0KE53 0.000133 48 30 0 69 3 xylG Xylose import ATP-binding protein XylG Burkholderia cenocepacia (strain HI2424)
Q2RWI9 9.88e-12 70 30 5 176 3 modC Molybdenum import ATP-binding protein ModC Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q2RWI9 0.000187 47 32 3 127 3 modC Molybdenum import ATP-binding protein ModC Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q4UJW5 1.04e-11 68 24 5 210 3 znuC Zinc import ATP-binding protein ZnuC Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q1LQB5 1.04e-11 68 32 8 175 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q4FMG5 1.06e-11 68 25 5 214 3 tauB Taurine import ATP-binding protein TauB Pelagibacter ubique (strain HTCC1062)
O84071 1.07e-11 68 26 3 194 3 CT_068 Probable metal transport system ATP-binding protein CT_068 Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
O84071 7.56e-08 57 25 4 187 3 CT_068 Probable metal transport system ATP-binding protein CT_068 Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
Q8ELR4 1.13e-11 69 28 4 196 3 potA Spermidine/putrescine import ATP-binding protein PotA Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q1GJU0 1.16e-11 68 28 5 183 3 hmuV Hemin import ATP-binding protein HmuV Ruegeria sp. (strain TM1040)
Q669P3 1.16e-11 68 30 7 193 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Yersinia pseudotuberculosis serotype I (strain IP32953)
Q07756 1.21e-11 69 31 6 192 3 nodI Nod factor export ATP-binding protein I Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q07756 1.58e-06 53 25 4 178 3 nodI Nod factor export ATP-binding protein I Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q6FFL0 1.21e-11 68 26 5 208 3 znuC Zinc import ATP-binding protein ZnuC Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q6FFL0 9.58e-09 59 29 5 167 3 znuC Zinc import ATP-binding protein ZnuC Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q4QND5 1.23e-11 68 28 5 227 3 znuC Zinc import ATP-binding protein ZnuC Haemophilus influenzae (strain 86-028NP)
Q72FW5 1.32e-11 69 27 7 208 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q0K2U3 1.35e-11 68 26 7 236 3 tauB Taurine import ATP-binding protein TauB Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q9KSD1 1.35e-11 70 21 13 454 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9KSD1 0.000703 45 26 0 75 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q5HQ70 1.43e-11 69 28 6 202 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q71WH7 1.45e-11 68 28 5 202 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Listeria monocytogenes serotype 4b (strain F2365)
Q576H3 1.54e-11 70 22 14 477 3 xylG Xylose import ATP-binding protein XylG Brucella abortus biovar 1 (strain 9-941)
Q576H3 1.62e-09 63 28 6 204 3 xylG Xylose import ATP-binding protein XylG Brucella abortus biovar 1 (strain 9-941)
Q2YJE7 1.54e-11 70 22 14 477 3 xylG Xylose import ATP-binding protein XylG Brucella abortus (strain 2308)
Q2YJE7 1.62e-09 63 28 6 204 3 xylG Xylose import ATP-binding protein XylG Brucella abortus (strain 2308)
Q58429 1.54e-11 68 26 7 214 3 MJ1023 Uncharacterized ABC transporter ATP-binding protein MJ1023 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q58429 2.44e-06 52 31 0 87 3 MJ1023 Uncharacterized ABC transporter ATP-binding protein MJ1023 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q5WXF0 1.57e-11 69 28 5 214 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila (strain Lens)
P37774 1.59e-11 67 29 6 171 1 tcyN L-cystine transport system ATP-binding protein TcyN Escherichia coli (strain K12)
Q042G7 1.63e-11 69 29 10 216 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
Q972J5 1.7e-11 69 23 17 484 3 STK_11360 Putative ABC transporter ATP-binding protein STK_11360 Sulfurisphaera tokodaii (strain DSM 16993 / JCM 10545 / NBRC 100140 / 7)
Q5ZWE4 1.71e-11 69 28 5 214 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
P36879 1.72e-11 68 27 5 204 1 yadG Uncharacterized ABC transporter ATP-binding protein YadG Escherichia coli (strain K12)
P36879 1.87e-10 65 28 3 194 1 yadG Uncharacterized ABC transporter ATP-binding protein YadG Escherichia coli (strain K12)
Q5KUX3 1.74e-11 69 22 14 450 3 rbsA Ribose import ATP-binding protein RbsA Geobacillus kaustophilus (strain HTA426)
Q5KUX3 3.89e-09 62 27 6 209 3 rbsA Ribose import ATP-binding protein RbsA Geobacillus kaustophilus (strain HTA426)
Q5KUX3 0.000386 46 30 0 72 3 rbsA Ribose import ATP-binding protein RbsA Geobacillus kaustophilus (strain HTA426)
Q56953 1.74e-11 68 24 4 210 3 yfeB Chelated iron transport system membrane protein YfeB Yersinia pestis
Q56953 7.18e-10 63 23 5 214 3 yfeB Chelated iron transport system membrane protein YfeB Yersinia pestis
Q6HLQ9 1.74e-11 68 27 4 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q63E84 1.79e-11 68 27 4 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ZK / E33L)
Q73BM0 1.79e-11 68 27 4 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ATCC 10987 / NRS 248)
A0RBB0 1.79e-11 68 27 4 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus thuringiensis (strain Al Hakam)
Q65UG3 1.8e-11 68 27 4 222 3 znuC Zinc import ATP-binding protein ZnuC Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q56342 1.86e-11 69 23 16 492 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Treponema pallidum (strain Nichols)
Q74K65 1.97e-11 68 29 10 216 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q9PJX9 2.08e-11 67 30 1 133 3 TC_0697 Probable metal transport system ATP-binding protein TC_0697 Chlamydia muridarum (strain MoPn / Nigg)
Q92VJ2 2.27e-11 68 29 7 201 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Rhizobium meliloti (strain 1021)
Q50294 2.29e-11 67 25 6 197 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q50294 6.12e-05 48 22 3 183 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q4QP85 2.42e-11 68 28 7 199 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Haemophilus influenzae (strain 86-028NP)
Q4QP85 7.9e-06 51 24 7 206 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Haemophilus influenzae (strain 86-028NP)
Q471U2 2.42e-11 67 27 4 225 3 tauB Taurine import ATP-binding protein TauB Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
P25885 2.46e-11 67 27 5 210 3 R00382 Uncharacterized ABC transporter ATP-binding protein R00382 Rhizobium meliloti (strain 1021)
P25885 0.000847 44 22 3 188 3 R00382 Uncharacterized ABC transporter ATP-binding protein R00382 Rhizobium meliloti (strain 1021)
A0ALT7 2.51e-11 67 28 5 202 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q0I3Y9 2.53e-11 68 29 6 242 3 potA Spermidine/putrescine import ATP-binding protein PotA Histophilus somni (strain 129Pt)
A1TXH7 2.57e-11 68 27 7 205 3 potA Spermidine/putrescine import ATP-binding protein PotA Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q987E7 2.62e-11 69 22 11 468 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q987E7 4.33e-06 52 26 7 236 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
O06980 2.74e-11 67 29 8 225 3 yvcR Uncharacterized ABC transporter ATP-binding protein YvcR Bacillus subtilis (strain 168)
Q8FUR8 2.83e-11 69 23 10 374 3 xylG Xylose import ATP-binding protein XylG Brucella suis biovar 1 (strain 1330)
Q8FUR8 2.11e-09 63 28 6 204 3 xylG Xylose import ATP-binding protein XylG Brucella suis biovar 1 (strain 1330)
Q329G7 2.83e-11 69 21 15 481 3 rbsA Ribose import ATP-binding protein RbsA Shigella dysenteriae serotype 1 (strain Sd197)
Q329G7 8.42e-05 48 27 9 192 3 rbsA Ribose import ATP-binding protein RbsA Shigella dysenteriae serotype 1 (strain Sd197)
Q329G7 0.000704 45 24 5 222 3 rbsA Ribose import ATP-binding protein RbsA Shigella dysenteriae serotype 1 (strain Sd197)
P63400 2.85e-11 69 26 15 429 3 BQ2027_MB2353C Uncharacterized ABC transporter ATP-binding protein Mb2353c Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P63400 0.000827 45 28 6 206 3 BQ2027_MB2353C Uncharacterized ABC transporter ATP-binding protein Mb2353c Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WQI7 2.85e-11 69 26 15 429 1 Rv2326c Uncharacterized ABC transporter ATP-binding protein Rv2326c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQI7 0.000827 45 28 6 206 1 Rv2326c Uncharacterized ABC transporter ATP-binding protein Rv2326c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQI6 2.85e-11 69 26 15 429 3 MT2388 Uncharacterized ABC transporter ATP-binding protein MT2388 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P9WQI6 0.000827 45 28 6 206 3 MT2388 Uncharacterized ABC transporter ATP-binding protein MT2388 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q2YKZ7 3.04e-11 68 27 6 195 3 BAB2_0493 Putative ATP-binding protein BAB2_0493 Brucella abortus (strain 2308)
Q578M5 3.04e-11 68 27 6 195 3 BruAb2_0487 Putative ATP-binding protein BruAb2_0487 Brucella abortus biovar 1 (strain 9-941)
Q5YZY9 3.16e-11 68 29 5 171 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nocardia farcinica (strain IFM 10152)
Q2NU23 3.27e-11 66 30 7 193 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Sodalis glossinidius (strain morsitans)
Q663Y5 3.28e-11 68 22 15 475 3 xylG Xylose import ATP-binding protein XylG Yersinia pseudotuberculosis serotype I (strain IP32953)
Q663Y5 0.000277 47 28 0 70 3 xylG Xylose import ATP-binding protein XylG Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CDC0 3.28e-11 68 22 15 475 3 xylG Xylose import ATP-binding protein XylG Yersinia pestis bv. Antiqua (strain Nepal516)
Q1CDC0 0.000277 47 28 0 70 3 xylG Xylose import ATP-binding protein XylG Yersinia pestis bv. Antiqua (strain Nepal516)
Q7CFR2 3.28e-11 68 22 15 475 3 xylG Xylose import ATP-binding protein XylG Yersinia pestis
Q7CFR2 0.000277 47 28 0 70 3 xylG Xylose import ATP-binding protein XylG Yersinia pestis
Q1C0D5 3.28e-11 68 22 15 475 3 xylG Xylose import ATP-binding protein XylG Yersinia pestis bv. Antiqua (strain Antiqua)
Q1C0D5 0.000277 47 28 0 70 3 xylG Xylose import ATP-binding protein XylG Yersinia pestis bv. Antiqua (strain Antiqua)
Q92UI2 3.48e-11 68 23 13 468 3 rbsA3 Ribose import ATP-binding protein RbsA 3 Rhizobium meliloti (strain 1021)
Q92UI2 0.000278 47 25 7 200 3 rbsA3 Ribose import ATP-binding protein RbsA 3 Rhizobium meliloti (strain 1021)
P0AAF9 3.53e-11 66 31 8 200 3 artP Arginine transport ATP-binding protein ArtP Shigella flexneri
P0AAF6 3.53e-11 66 31 8 200 1 artP Arginine transport ATP-binding protein ArtP Escherichia coli (strain K12)
P0AAF7 3.53e-11 66 31 8 200 3 artP Arginine transport ATP-binding protein ArtP Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AAF8 3.53e-11 66 31 8 200 3 artP Arginine transport ATP-binding protein ArtP Escherichia coli O157:H7
Q8XXY9 3.58e-11 67 27 6 199 3 nodI Nod factor export ATP-binding protein I Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q8FVT0 3.58e-11 68 27 6 195 3 BRA0745 Putative ATP-binding protein BRA0745/BS1330_II0738 Brucella suis biovar 1 (strain 1330)
Q8UH62 3.58e-11 68 27 4 202 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q2T4S8 3.59e-11 68 27 7 225 3 araG2 Arabinose import ATP-binding protein AraG 2 Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q2T4S8 1.4e-07 57 22 17 487 3 araG2 Arabinose import ATP-binding protein AraG 2 Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q2T4S8 0.000374 46 27 1 99 3 araG2 Arabinose import ATP-binding protein AraG 2 Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q8X5I6 3.75e-11 67 27 7 203 3 tauB Taurine import ATP-binding protein TauB Escherichia coli O157:H7
Q8X5I6 0.000392 45 26 4 173 3 tauB Taurine import ATP-binding protein TauB Escherichia coli O157:H7
Q57855 3.93e-11 67 23 3 201 3 MJ0412 Uncharacterized ABC transporter ATP-binding protein MJ0412 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q5PB72 4.08e-11 66 23 4 215 3 znuC Zinc import ATP-binding protein ZnuC Anaplasma marginale (strain St. Maries)
Q5PB72 8.06e-06 50 24 6 185 3 znuC Zinc import ATP-binding protein ZnuC Anaplasma marginale (strain St. Maries)
Q9I3N7 4.19e-11 66 28 4 181 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8A1M1 4.29e-11 65 29 6 171 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q8A1M1 8.1e-06 50 32 1 80 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q81TH8 4.38e-11 67 27 4 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus anthracis
Q8Y454 4.42e-11 67 27 6 230 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
P40735 4.43e-11 67 27 8 209 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus subtilis (strain 168)
P40735 1.16e-06 53 27 4 195 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus subtilis (strain 168)
Q8XPK6 4.46e-11 68 32 7 195 3 xylG Xylose import ATP-binding protein XylG Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q8XPK6 8.65e-08 58 21 14 482 3 xylG Xylose import ATP-binding protein XylG Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q8XPK6 1.83e-05 50 23 4 205 3 xylG Xylose import ATP-binding protein XylG Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q8RHL0 4.74e-11 66 24 7 224 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q8RHL0 0.000286 46 26 5 196 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q5LBT4 5.06e-11 68 29 6 197 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
Q927N8 5.08e-11 67 27 6 230 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q0RYP7 5.15e-11 67 27 5 197 3 fbpC3 Fe(3+) ions import ATP-binding protein FbpC 3 Rhodococcus jostii (strain RHA1)
Q0RYP7 0.000176 47 31 2 88 3 fbpC3 Fe(3+) ions import ATP-binding protein FbpC 3 Rhodococcus jostii (strain RHA1)
Q64SQ6 5.2e-11 68 29 6 197 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides fragilis (strain YCH46)
Q03PY5 5.27e-11 66 26 6 219 1 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
Q03PY5 0.000602 45 27 3 160 1 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
Q7NTN6 5.29e-11 68 24 14 358 3 rbsA Ribose import ATP-binding protein RbsA Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q2NTI7 5.45e-11 66 29 7 225 3 znuC Zinc import ATP-binding protein ZnuC Sodalis glossinidius (strain morsitans)
Q9WYI7 5.48e-11 65 30 8 204 3 TM_0352 Uncharacterized ABC transporter ATP-binding protein TM_0352 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q9WYI7 4.68e-05 48 25 4 182 3 TM_0352 Uncharacterized ABC transporter ATP-binding protein TM_0352 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
P0C0E9 5.57e-11 66 30 8 209 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Streptococcus pyogenes
P0CZ29 5.57e-11 66 30 8 209 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M3 (strain SSI-1)
A2RH11 5.57e-11 66 30 8 209 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M5 (strain Manfredo)
Q1J449 5.57e-11 66 30 8 209 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q1JEC8 5.57e-11 66 30 8 209 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q7CMM7 5.57e-11 66 30 8 209 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q5X9B5 5.57e-11 66 30 8 209 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
P0CZ28 5.57e-11 66 30 8 209 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q1J982 5.67e-11 66 30 8 209 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M12 (strain MGAS2096)
Q48QM2 5.72e-11 66 30 8 209 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M28 (strain MGAS6180)
Q1JJC9 5.72e-11 66 30 8 209 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M12 (strain MGAS9429)
P0C0E8 5.72e-11 66 30 8 209 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M1
Q8TQW9 5.76e-11 68 24 13 331 3 MA_1418 Putative ABC transporter ATP-binding protein MA_1418 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q6MCV4 5.82e-11 67 26 5 218 3 potA Spermidine/putrescine import ATP-binding protein PotA Protochlamydia amoebophila (strain UWE25)
Q92WJ0 5.84e-11 67 28 6 214 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Rhizobium meliloti (strain 1021)
Q48HL2 5.92e-11 66 28 8 209 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
P45171 5.94e-11 67 29 7 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q1M360 6.12e-11 68 23 13 432 3 rbsA3 Ribose import ATP-binding protein RbsA 3 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q032H4 6.2e-11 66 27 5 184 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Lactococcus lactis subsp. cremoris (strain SK11)
A2RI01 6.2e-11 66 27 5 184 1 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Lactococcus lactis subsp. cremoris (strain MG1363)
P44513 6.33e-11 67 28 7 198 1 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P44513 5.73e-06 52 24 7 206 1 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q4QK57 6.56e-11 67 29 7 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus influenzae (strain 86-028NP)
Q1GBJ0 6.66e-11 66 25 7 211 1 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
Q82WT5 6.92e-11 67 29 5 196 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q13IS7 7e-11 66 27 4 206 3 tauB3 Taurine import ATP-binding protein TauB 3 Paraburkholderia xenovorans (strain LB400)
Q6FFZ1 7.08e-11 66 26 4 234 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q6FFZ1 0.00077 45 28 9 198 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
P38045 7.33e-11 68 34 6 161 1 nrtC Nitrate import ATP-binding protein NrtC Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P38045 0.000257 47 25 7 239 1 nrtC Nitrate import ATP-binding protein NrtC Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q8UBB7 7.48e-11 67 29 6 195 3 ugpC2 sn-glycerol-3-phosphate import ATP-binding protein UgpC 2 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q5NHP2 7.78e-11 65 27 5 192 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q2A4V5 7.78e-11 65 27 5 192 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Francisella tularensis subsp. holarctica (strain LVS)
Q14J44 7.78e-11 65 27 5 192 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Francisella tularensis subsp. tularensis (strain FSC 198)
Q3J1N0 7.94e-11 67 32 8 190 3 metN Methionine import ATP-binding protein MetN Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q62H59 7.94e-11 66 30 6 171 3 phnC Phosphonates import ATP-binding protein PhnC Burkholderia mallei (strain ATCC 23344)
Q88YN5 8.01e-11 65 30 6 181 3 phnC Phosphonates import ATP-binding protein PhnC Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q88YN5 3.19e-05 48 24 3 174 3 phnC Phosphonates import ATP-binding protein PhnC Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
P42246 8.08e-11 66 25 4 193 3 ycbN Uncharacterized ABC transporter ATP-binding protein YcbN Bacillus subtilis (strain 168)
P42246 9.49e-07 54 21 8 246 3 ycbN Uncharacterized ABC transporter ATP-binding protein YcbN Bacillus subtilis (strain 168)
P75370 8.27e-11 65 24 6 212 3 p29 Probable ABC transporter ATP-binding protein p29 Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q6LUY1 8.31e-11 67 22 10 483 3 xylG Xylose import ATP-binding protein XylG Photobacterium profundum (strain SS9)
Q6LUY1 1.67e-09 63 24 5 221 3 xylG Xylose import ATP-binding protein XylG Photobacterium profundum (strain SS9)
Q6LUY1 0.000106 48 27 0 73 3 xylG Xylose import ATP-binding protein XylG Photobacterium profundum (strain SS9)
Q0K1N8 8.41e-11 66 30 8 205 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q891M1 8.42e-11 67 22 10 344 3 rbsA Ribose import ATP-binding protein RbsA Clostridium tetani (strain Massachusetts / E88)
Q891M1 2.12e-07 57 24 5 191 3 rbsA Ribose import ATP-binding protein RbsA Clostridium tetani (strain Massachusetts / E88)
Q891M1 1.43e-05 51 20 6 241 3 rbsA Ribose import ATP-binding protein RbsA Clostridium tetani (strain Massachusetts / E88)
Q6D201 8.47e-11 66 30 7 205 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q9CP24 8.8e-11 65 28 3 202 3 znuC Zinc import ATP-binding protein ZnuC Pasteurella multocida (strain Pm70)
Q57538 8.9e-11 67 25 9 278 1 HI_0664 Probable ABC transporter ATP-binding/permease protein HI_0664 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q92UX0 8.95e-11 65 27 7 223 3 tauB Taurine import ATP-binding protein TauB Rhizobium meliloti (strain 1021)
Q47C66 9.01e-11 65 31 7 195 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Dechloromonas aromatica (strain RCB)
Q47C66 0.000566 45 25 5 191 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Dechloromonas aromatica (strain RCB)
Q8CPN0 9.25e-11 67 28 6 202 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q03ZL6 9.32e-11 65 26 5 211 1 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
Q03ZL6 8.48e-06 50 25 1 162 1 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
Q32I01 9.51e-11 64 30 4 166 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Shigella dysenteriae serotype 1 (strain Sd197)
Q32I01 1.98e-06 52 27 4 170 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Shigella dysenteriae serotype 1 (strain Sd197)
Q8DRS0 9.62e-11 65 30 8 196 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q8DRS0 5.22e-07 54 26 9 195 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
D4GPW3 9.78e-11 67 23 6 324 3 tsgD13 Glucose import ATP-binding protein TsgD13 Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
Q0S0Z3 9.79e-11 66 28 7 196 3 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Rhodococcus jostii (strain RHA1)
Q0S0Z3 0.000155 47 31 2 89 3 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Rhodococcus jostii (strain RHA1)
Q8P8M1 9.89e-11 64 30 10 210 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q4UVG2 9.89e-11 64 30 10 210 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Xanthomonas campestris pv. campestris (strain 8004)
Q5H0W2 1.01e-10 64 29 10 220 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q2P3U8 1.01e-10 64 29 10 220 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q2W1R8 1.03e-10 66 28 4 180 3 modC Molybdenum import ATP-binding protein ModC Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q38WL5 1.03e-10 66 28 9 245 3 metN Methionine import ATP-binding protein MetN Latilactobacillus sakei subsp. sakei (strain 23K)
Q0BN75 1.03e-10 65 29 5 166 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Francisella tularensis subsp. holarctica (strain OSU18)
Q3MB44 1.04e-10 67 24 13 466 3 rbsA Ribose import ATP-binding protein RbsA Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q3MB44 9.04e-07 55 26 5 203 3 rbsA Ribose import ATP-binding protein RbsA Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q5F8K2 1.09e-10 65 32 7 200 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q5F8K2 2.42e-06 52 26 7 226 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q83CV2 1.09e-10 65 30 8 194 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
Q1CMQ3 1.14e-10 65 30 6 217 3 thiQ Thiamine import ATP-binding protein ThiQ Yersinia pestis bv. Antiqua (strain Nepal516)
Q0WJE4 1.14e-10 65 30 6 217 3 thiQ Thiamine import ATP-binding protein ThiQ Yersinia pestis
Q1C1Y5 1.14e-10 65 30 6 217 3 thiQ Thiamine import ATP-binding protein ThiQ Yersinia pestis bv. Antiqua (strain Antiqua)
Q31J97 1.16e-10 65 26 6 207 3 hmuV Hemin import ATP-binding protein HmuV Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
O34946 1.17e-10 65 24 4 202 1 znuC High-affinity zinc uptake system ATP-binding protein ZnuC Bacillus subtilis (strain 168)
O34946 7.13e-10 62 24 5 203 1 znuC High-affinity zinc uptake system ATP-binding protein ZnuC Bacillus subtilis (strain 168)
Q63R24 1.17e-10 66 30 6 171 3 phnC Phosphonates import ATP-binding protein PhnC Burkholderia pseudomallei (strain K96243)
Q3JNY2 1.17e-10 66 30 6 171 3 phnC Phosphonates import ATP-binding protein PhnC Burkholderia pseudomallei (strain 1710b)
Q8H1R4 1.17e-10 65 29 5 194 1 ABCI10 ABC transporter I family member 10 Arabidopsis thaliana
Q6LKD4 1.18e-10 66 28 6 214 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Photobacterium profundum (strain SS9)
Q1MQ44 1.18e-10 66 26 5 208 3 potA Spermidine/putrescine import ATP-binding protein PotA Lawsonia intracellularis (strain PHE/MN1-00)
Q035B2 1.2e-10 65 33 6 169 1 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
Q0B5V4 1.21e-10 67 27 7 218 3 araG2 Arabinose import ATP-binding protein AraG 2 Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q0B5V4 0.000487 46 29 1 99 3 araG2 Arabinose import ATP-binding protein AraG 2 Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q5FL41 1.23e-10 66 28 8 214 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
Q9CL63 1.24e-10 67 22 14 463 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Pasteurella multocida (strain Pm70)
Q9CL63 7.48e-06 52 24 5 185 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Pasteurella multocida (strain Pm70)
Q9CL63 9.67e-05 48 26 7 217 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Pasteurella multocida (strain Pm70)
Q4L9P7 1.37e-10 65 33 7 167 3 phnC Phosphonates import ATP-binding protein PhnC Staphylococcus haemolyticus (strain JCSC1435)
Q9CP06 1.37e-10 66 28 6 235 3 potA Spermidine/putrescine import ATP-binding protein PotA Pasteurella multocida (strain Pm70)
Q897I2 1.38e-10 67 28 7 191 3 CTC_00753 Putative ABC transporter ATP-binding protein CTC_00753 Clostridium tetani (strain Massachusetts / E88)
Q897I2 1.34e-08 60 26 6 179 3 CTC_00753 Putative ABC transporter ATP-binding protein CTC_00753 Clostridium tetani (strain Massachusetts / E88)
Q3KDW2 1.39e-10 67 22 7 328 3 xylG Xylose import ATP-binding protein XylG Pseudomonas fluorescens (strain Pf0-1)
Q3KDW2 6.3e-08 58 24 5 217 3 xylG Xylose import ATP-binding protein XylG Pseudomonas fluorescens (strain Pf0-1)
Q3KDW2 0.000189 47 28 0 69 3 xylG Xylose import ATP-binding protein XylG Pseudomonas fluorescens (strain Pf0-1)
Q97N51 1.4e-10 65 27 5 199 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q97N51 1.83e-07 56 27 5 207 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q3B2U2 1.42e-10 64 28 6 194 3 lolD1 Lipoprotein-releasing system ATP-binding protein LolD 1 Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
Q3B2U2 2.8e-05 48 30 0 98 3 lolD1 Lipoprotein-releasing system ATP-binding protein LolD 1 Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
Q3Z542 1.42e-10 65 28 6 203 3 tauB Taurine import ATP-binding protein TauB Shigella sonnei (strain Ss046)
Q3Z542 0.000501 45 26 4 173 3 tauB Taurine import ATP-binding protein TauB Shigella sonnei (strain Ss046)
Q47538 1.42e-10 65 28 6 203 2 tauB Taurine import ATP-binding protein TauB Escherichia coli (strain K12)
Q47538 0.000501 45 26 4 173 2 tauB Taurine import ATP-binding protein TauB Escherichia coli (strain K12)
Q04BY7 1.46e-10 65 25 7 211 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
A3CRB8 1.47e-10 65 27 6 225 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Streptococcus sanguinis (strain SK36)
A3CRB8 7.32e-07 54 26 6 203 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Streptococcus sanguinis (strain SK36)
Q8DB62 1.49e-10 64 29 5 166 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Vibrio vulnificus (strain CMCP6)
Q88XV2 1.5e-10 65 30 7 213 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q3KFY6 1.51e-10 64 26 4 192 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Pseudomonas fluorescens (strain Pf0-1)
P55662 1.53e-10 65 25 7 243 3 NGR_a01510 Probable amino-acid ABC transporter ATP-binding protein y4tH Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q8NR12 1.53e-10 67 22 13 457 3 rbsA Ribose import ATP-binding protein RbsA Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q8NR12 8.25e-09 61 28 6 206 3 rbsA Ribose import ATP-binding protein RbsA Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q0B775 1.54e-10 67 23 15 458 3 Bamb_4447 Putative ribose/galactose/methyl galactoside import ATP-binding protein 3 Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q0B775 0.000761 45 22 4 200 3 Bamb_4447 Putative ribose/galactose/methyl galactoside import ATP-binding protein 3 Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q04BG2 1.56e-10 66 25 7 227 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q8RLB6 1.56e-10 64 24 4 220 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Delftia acidovorans
Q8RLB6 0.000246 46 26 3 164 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Delftia acidovorans
Q6D664 1.57e-10 64 28 6 191 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q6D664 0.000742 44 23 3 196 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q64Z80 1.61e-10 64 29 6 171 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Bacteroides fragilis (strain YCH46)
Q5LI72 1.61e-10 64 29 6 171 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
Q7MIR0 1.61e-10 63 29 5 166 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Vibrio vulnificus (strain YJ016)
Q03EE4 1.67e-10 65 26 6 200 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Pediococcus pentosaceus (strain ATCC 25745 / CCUG 21536 / LMG 10740 / 183-1w)
Q8R7Y4 1.71e-10 65 25 4 195 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q87MK8 1.74e-10 63 30 7 169 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q9CIS9 1.75e-10 65 25 5 192 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Lactococcus lactis subsp. lactis (strain IL1403)
Q3JHC9 1.75e-10 66 29 5 194 3 metN2 Methionine import ATP-binding protein MetN 2 Burkholderia pseudomallei (strain 1710b)
Q0SBZ1 1.78e-10 65 27 4 193 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Rhodococcus jostii (strain RHA1)
Q0SBZ1 0.000293 46 36 2 66 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Rhodococcus jostii (strain RHA1)
Q8CMU4 1.82e-10 64 32 7 167 3 phnC Phosphonates import ATP-binding protein PhnC Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HKQ8 1.82e-10 64 32 7 167 3 phnC Phosphonates import ATP-binding protein PhnC Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P21630 1.85e-10 64 29 3 162 3 braG High-affinity branched-chain amino acid transport ATP-binding protein BraG Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P21630 0.000242 46 25 4 213 3 braG High-affinity branched-chain amino acid transport ATP-binding protein BraG Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q2GE91 1.85e-10 64 30 5 162 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Neorickettsia sennetsu (strain ATCC VR-367 / Miyayama)
Q0VR80 1.86e-10 64 27 6 214 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q68Y13 1.9e-10 64 23 4 213 3 znuC Zinc import ATP-binding protein ZnuC Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q1GB17 1.95e-10 65 25 7 227 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
P78363 1.96e-10 67 27 7 213 1 ABCA4 Retinal-specific phospholipid-transporting ATPase ABCA4 Homo sapiens
P78363 1.48e-06 55 28 6 198 1 ABCA4 Retinal-specific phospholipid-transporting ATPase ABCA4 Homo sapiens
O54187 2e-10 65 28 8 207 3 SCO5958 Putative ABC transporter ATP-binding protein SCO5958 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
O54187 2.16e-07 55 28 3 200 3 SCO5958 Putative ABC transporter ATP-binding protein SCO5958 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q1BG75 2e-10 65 25 3 218 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Burkholderia orbicola (strain AU 1054)
A0KE71 2e-10 65 25 3 218 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Burkholderia cenocepacia (strain HI2424)
Q325N3 2.03e-10 64 28 6 203 3 tauB Taurine import ATP-binding protein TauB Shigella boydii serotype 4 (strain Sb227)
Q325N3 0.000558 45 26 4 173 3 tauB Taurine import ATP-binding protein TauB Shigella boydii serotype 4 (strain Sb227)
Q9CGD4 2.06e-10 66 29 9 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactococcus lactis subsp. lactis (strain IL1403)
Q032D0 2.06e-10 64 30 10 199 3 phnC Phosphonates import ATP-binding protein PhnC Lactococcus lactis subsp. cremoris (strain SK11)
Q63NI4 2.07e-10 66 29 5 194 3 metN2 Methionine import ATP-binding protein MetN 2 Burkholderia pseudomallei (strain K96243)
Q2JPW6 2.13e-10 64 26 7 225 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Synechococcus sp. (strain JA-2-3B'a(2-13))
Q3YSK9 2.13e-10 64 25 4 191 3 znuC Zinc import ATP-binding protein ZnuC Ehrlichia canis (strain Jake)
Q38UT9 2.15e-10 65 29 6 194 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Latilactobacillus sakei subsp. sakei (strain 23K)
Q38UT9 3.75e-05 48 27 5 181 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Latilactobacillus sakei subsp. sakei (strain 23K)
P57403 2.22e-10 64 26 4 219 3 znuC Zinc import ATP-binding protein ZnuC Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q88ZJ6 2.23e-10 65 27 7 217 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q62B84 2.27e-10 65 29 5 194 3 metN2 Methionine import ATP-binding protein MetN 2 Burkholderia mallei (strain ATCC 23344)
Q7ULB5 2.38e-10 66 29 5 199 3 macB Macrolide export ATP-binding/permease protein MacB Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
Q7ULB5 8.54e-05 48 26 6 181 3 macB Macrolide export ATP-binding/permease protein MacB Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
Q8U648 2.4e-10 64 27 6 218 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8REG7 2.4e-10 64 27 8 200 3 phnC Phosphonates import ATP-binding protein PhnC Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q8REG7 2.2e-05 49 25 7 207 3 phnC Phosphonates import ATP-binding protein PhnC Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q97KD5 2.43e-10 65 25 4 208 3 metN Methionine import ATP-binding protein MetN Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
O85818 2.46e-10 65 27 6 242 3 potA Spermidine/putrescine import ATP-binding protein PotA Aggregatibacter actinomycetemcomitans
Q97KS6 2.46e-10 65 29 8 213 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q3BSL0 2.47e-10 63 29 10 222 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)

  • Number of RefSeq hits:

General

Source Morganella morganii S4
Locus tag NLDBIP_04480
Feature type CDS
Gene modF
Product molybdate ABC transporter ATP-binding protein ModF
Location 226344 - 227795 (strand: 1)
Length 1452 (nucleotides) / 483 (amino acids)

Contig

Accession ZDB_520
Length 336657 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1500
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00005 ABC transporter

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1119 Inorganic ion transport and metabolism (P) P ABC-type molybdenum transport system, ATPase component ModF/photorepair protein PhrA

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K05776 molybdate transport system ATP-binding protein ABC transporters -

Protein Sequence

MAHLHITQGVFRLSADKQLSVPSLQLESGQHHAFIGTNGSGKSALARALIQKLPLLSGEMSNTFRRPVLVAFEKLQALIDEEWNRNNTDLMDGDDTDNGRTTAEIIQAEHRDNERCLQLAAQFGISDRLSRRFKYLSTGETRKTLLCQALMTEPDLLVLDEPYDGLDTDSRRMLSEMLAELAEGGLTVVLILNRFSDIPGFITRAGLLTDCVLAPADTLSALLQAQLARSEQTEHLTLPERDDPSAERLAPDIPRVILNHGCVSYNDKPILNDLTWQVLPGEHWQITGENGAGKSTLLSLITGDHPQGYSNDLTLFGRRRGSGETVWDIKRHIGYVSNSIHLSYRVNISVRNTLISGYFDSVGLYQKPSDRQVKLADEWLALLGLKAYRDAPFHSLSWGQQRLILIARALVKHPAMLILDEPLQGLDTLNRLLVLRFIDIMISRGDTQLLFVSHHSEDTPACINRRLAFIPDNGSYRYEINTL

Flanking regions ( +/- flanking 50bp)

GTTCCGCTTATTTCTGGGGAATAATTAAACTAATAATAAGGCTGTTCACTATGGCACATCTGCACATCACACAAGGGGTCTTCCGGTTAAGCGCGGATAAACAGCTTTCTGTTCCGTCATTACAGCTGGAAAGCGGTCAGCACCACGCCTTTATCGGCACTAACGGCAGCGGAAAATCTGCCCTTGCCCGCGCGCTGATTCAGAAACTTCCGCTGCTTTCCGGGGAGATGAGCAACACTTTCCGCCGTCCGGTTCTGGTCGCGTTTGAGAAATTACAGGCGCTGATTGATGAAGAGTGGAACCGCAATAATACCGACCTGATGGATGGCGATGACACCGATAACGGCCGTACCACCGCTGAGATTATTCAGGCGGAGCATCGTGATAATGAGCGCTGCCTGCAGCTGGCGGCGCAGTTCGGGATTTCTGATCGCCTGTCACGCCGCTTTAAATACCTTTCCACCGGTGAAACCCGCAAAACCCTGCTGTGTCAGGCACTGATGACAGAGCCTGATCTGCTGGTACTGGATGAGCCTTATGACGGGCTGGATACCGATTCCCGCCGTATGCTCAGTGAGATGCTGGCAGAGCTTGCAGAGGGCGGACTGACGGTTGTTCTGATCCTCAACCGTTTCAGCGATATTCCGGGCTTTATCACCCGCGCCGGGCTGCTGACAGACTGTGTGCTGGCACCAGCGGATACCTTATCCGCACTATTACAGGCACAGCTGGCCCGTAGTGAGCAGACAGAGCATCTGACGCTGCCGGAGCGGGATGACCCGTCCGCAGAACGCCTTGCGCCGGATATTCCGCGGGTGATCCTCAATCACGGCTGTGTCAGCTATAACGATAAGCCCATCCTCAATGATCTGACCTGGCAGGTGCTGCCCGGCGAGCACTGGCAAATCACCGGCGAAAACGGTGCGGGTAAATCCACACTGCTCAGTCTGATCACCGGTGATCATCCGCAGGGCTACAGCAATGACCTGACGCTGTTCGGCCGCCGCCGGGGCAGCGGTGAAACGGTGTGGGATATCAAACGCCATATCGGGTATGTCAGTAACAGCATCCACCTCAGTTACCGCGTCAATATCAGTGTGCGTAACACGCTGATTTCCGGTTATTTCGATTCTGTCGGGCTCTATCAGAAACCGTCAGACCGGCAGGTAAAACTGGCGGATGAGTGGCTGGCGCTGCTCGGTCTGAAAGCGTACCGCGATGCTCCGTTCCACAGCCTGTCGTGGGGGCAGCAGCGGCTGATACTGATTGCCAGGGCCCTGGTAAAACACCCTGCAATGCTGATCCTTGATGAGCCGTTACAGGGGCTGGATACACTCAACCGCCTGCTGGTGCTGCGTTTTATCGATATTATGATAAGCCGTGGTGATACCCAGCTGCTGTTTGTCAGCCATCACAGCGAGGATACCCCGGCCTGTATCAACCGGCGGCTGGCATTTATTCCTGATAACGGTAGTTATCGTTACGAAATCAATACGTTGTAATCTTTTTATCAAACGGCTGTTTTACTTTTTTACTGCACCGGAAACAGCCG