Homologs in group_561

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_01425 FBDBKF_01425 100.0 Morganella morganii S1 lepA translation elongation factor 4
EHELCC_00120 EHELCC_00120 100.0 Morganella morganii S2 lepA translation elongation factor 4
LHKJJB_04855 LHKJJB_04855 100.0 Morganella morganii S3 lepA translation elongation factor 4
HKOGLL_02190 HKOGLL_02190 100.0 Morganella morganii S5 lepA translation elongation factor 4
F4V73_RS01970 F4V73_RS01970 96.1 Morganella psychrotolerans lepA translation elongation factor 4
PMI_RS09330 PMI_RS09330 90.1 Proteus mirabilis HI4320 lepA translation elongation factor 4

Distribution of the homologs in the orthogroup group_561

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_561

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
A6TCI3 0 1139 93 0 597 3 lepA Elongation factor 4 Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
C6DC02 0 1136 92 0 597 3 lepA Elongation factor 4 Pectobacterium carotovorum subsp. carotovorum (strain PC1)
A4WDE0 0 1136 93 0 597 3 lepA Elongation factor 4 Enterobacter sp. (strain 638)
B5XNG8 0 1134 93 0 597 3 lepA Elongation factor 4 Klebsiella pneumoniae (strain 342)
A7MH13 0 1130 92 0 597 3 lepA Elongation factor 4 Cronobacter sakazakii (strain ATCC BAA-894)
Q6D217 0 1130 91 0 597 3 lepA Elongation factor 4 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A8GI27 0 1128 91 0 597 3 lepA Elongation factor 4 Serratia proteamaculans (strain 568)
Q3YYU7 0 1125 92 0 597 3 lepA Elongation factor 4 Shigella sonnei (strain Ss046)
A4TKY0 0 1120 91 0 597 3 lepA Elongation factor 4 Yersinia pestis (strain Pestoides F)
B1JRC5 0 1118 91 0 597 3 lepA Elongation factor 4 Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q667U9 0 1118 91 0 597 3 lepA Elongation factor 4 Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CKE6 0 1118 91 0 597 3 lepA Elongation factor 4 Yersinia pestis bv. Antiqua (strain Nepal516)
A9R400 0 1118 91 0 597 3 lepA Elongation factor 4 Yersinia pestis bv. Antiqua (strain Angola)
Q8ZD74 0 1118 91 0 597 3 lepA Elongation factor 4 Yersinia pestis
B2KA49 0 1118 91 0 597 3 lepA Elongation factor 4 Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C557 0 1118 91 0 597 3 lepA Elongation factor 4 Yersinia pestis bv. Antiqua (strain Antiqua)
A7FFT7 0 1118 91 0 597 3 lepA Elongation factor 4 Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q7N1X3 0 1116 91 0 597 3 lepA Elongation factor 4 Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
P0A1W4 0 1110 92 0 597 3 lepA Elongation factor 4 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A1W5 0 1110 92 0 597 3 lepA Elongation factor 4 Salmonella typhi
B4TS16 0 1110 92 0 597 3 lepA Elongation factor 4 Salmonella schwarzengrund (strain CVM19633)
C0PYG5 0 1110 92 0 597 3 lepA Elongation factor 4 Salmonella paratyphi C (strain RKS4594)
B4T1G0 0 1110 92 0 597 3 lepA Elongation factor 4 Salmonella newport (strain SL254)
B4TE17 0 1110 92 0 597 3 lepA Elongation factor 4 Salmonella heidelberg (strain SL476)
B5QTV0 0 1110 92 0 597 3 lepA Elongation factor 4 Salmonella enteritidis PT4 (strain P125109)
B5FRC7 0 1110 92 0 597 3 lepA Elongation factor 4 Salmonella dublin (strain CT_02021853)
Q57LC8 0 1110 92 0 597 3 lepA Elongation factor 4 Salmonella choleraesuis (strain SC-B67)
B5F1G3 0 1110 92 0 597 3 lepA Elongation factor 4 Salmonella agona (strain SL483)
B5RD51 0 1107 92 0 597 3 lepA Elongation factor 4 Salmonella gallinarum (strain 287/91 / NCTC 13346)
A9MGX5 0 1107 92 0 597 3 lepA Elongation factor 4 Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B5BAS8 0 1106 92 0 597 3 lepA Elongation factor 4 Salmonella paratyphi A (strain AKU_12601)
Q5PNC0 0 1106 92 0 597 3 lepA Elongation factor 4 Salmonella paratyphi A (strain ATCC 9150 / SARB42)
A1JKK1 0 1106 92 0 597 3 lepA Elongation factor 4 Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
C5BAI0 0 1105 90 0 597 3 lepA Elongation factor 4 Edwardsiella ictaluri (strain 93-146)
B2VI44 0 1105 92 0 597 3 lepA Elongation factor 4 Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
P60788 0 1103 92 0 597 3 lepA Elongation factor 4 Shigella flexneri
Q0T1T6 0 1103 92 0 597 3 lepA Elongation factor 4 Shigella flexneri serotype 5b (strain 8401)
Q31XR8 0 1103 92 0 597 3 lepA Elongation factor 4 Shigella boydii serotype 4 (strain Sb227)
B2TYI0 0 1103 92 0 597 3 lepA Elongation factor 4 Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B7LUZ5 0 1103 92 0 597 3 lepA Elongation factor 4 Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B1LP82 0 1103 92 0 597 3 lepA Elongation factor 4 Escherichia coli (strain SMS-3-5 / SECEC)
B7N6F7 0 1103 92 0 597 3 lepA Elongation factor 4 Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P60785 0 1103 92 0 597 1 lepA Elongation factor 4 Escherichia coli (strain K12)
B1IVQ8 0 1103 92 0 597 3 lepA Elongation factor 4 Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P60786 0 1103 92 0 597 3 lepA Elongation factor 4 Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TER9 0 1103 92 0 597 3 lepA Elongation factor 4 Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A8A379 0 1103 92 0 597 3 lepA Elongation factor 4 Escherichia coli O9:H4 (strain HS)
B1XB43 0 1103 92 0 597 3 lepA Elongation factor 4 Escherichia coli (strain K12 / DH10B)
C4ZYJ2 0 1103 92 0 597 3 lepA Elongation factor 4 Escherichia coli (strain K12 / MC4100 / BW2952)
B7NRM2 0 1103 92 0 597 3 lepA Elongation factor 4 Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5Z143 0 1103 92 0 597 3 lepA Elongation factor 4 Escherichia coli O157:H7 (strain EC4115 / EHEC)
P60787 0 1103 92 0 597 3 lepA Elongation factor 4 Escherichia coli O157:H7
B7LDG2 0 1103 92 0 597 3 lepA Elongation factor 4 Escherichia coli (strain 55989 / EAEC)
A7ZQ13 0 1103 92 0 597 3 lepA Elongation factor 4 Escherichia coli O139:H28 (strain E24377A / ETEC)
Q32CV2 0 1102 92 0 597 3 lepA Elongation factor 4 Shigella dysenteriae serotype 1 (strain Sd197)
B7M8I2 0 1102 92 0 597 3 lepA Elongation factor 4 Escherichia coli O8 (strain IAI1)
Q2NS11 0 1101 90 0 597 3 lepA Elongation factor 4 Sodalis glossinidius (strain morsitans)
B6I5E3 0 1101 92 0 597 3 lepA Elongation factor 4 Escherichia coli (strain SE11)
B4F049 0 1101 90 0 597 3 lepA Elongation factor 4 Proteus mirabilis (strain HI4320)
Q1R8G3 0 1100 92 0 597 3 lepA Elongation factor 4 Escherichia coli (strain UTI89 / UPEC)
A1AE99 0 1100 92 0 597 3 lepA Elongation factor 4 Escherichia coli O1:K1 / APEC
B7MYK1 0 1100 92 0 597 3 lepA Elongation factor 4 Escherichia coli O81 (strain ED1a)
B7MIQ4 0 1100 92 0 597 3 lepA Elongation factor 4 Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UH09 0 1100 92 0 597 3 lepA Elongation factor 4 Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A8AD16 0 1100 92 0 597 3 lepA Elongation factor 4 Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q65VN2 0 1093 88 0 597 3 lepA Elongation factor 4 Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
P57806 0 1092 89 0 597 3 lepA Elongation factor 4 Pasteurella multocida (strain Pm70)
P43729 0 1085 88 0 597 3 lepA Elongation factor 4 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A5UFI9 0 1085 88 0 597 3 lepA Elongation factor 4 Haemophilus influenzae (strain PittGG)
A5UBC2 0 1085 88 0 597 3 lepA Elongation factor 4 Haemophilus influenzae (strain PittEE)
Q4QPM8 0 1085 88 0 597 3 lepA Elongation factor 4 Haemophilus influenzae (strain 86-028NP)
B0USR9 0 1080 87 0 597 3 lepA Elongation factor 4 Histophilus somni (strain 2336)
Q0I4Z1 0 1080 87 0 597 3 lepA Elongation factor 4 Histophilus somni (strain 129Pt)
A6VLV6 0 1075 87 0 597 3 lepA Elongation factor 4 Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
C4K3Z1 0 1072 86 0 597 3 lepA Elongation factor 4 Hamiltonella defensa subsp. Acyrthosiphon pisum (strain 5AT)
Q7VL73 0 1066 86 0 597 3 lepA Elongation factor 4 Haemophilus ducreyi (strain 35000HP / ATCC 700724)
C4LBZ6 0 1052 84 0 597 3 lepA Elongation factor 4 Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
A0KGF0 0 1048 83 0 597 3 lepA Elongation factor 4 Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q87LN7 0 1047 84 0 597 3 lepA Elongation factor 4 Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
A4SRD4 0 1047 83 0 597 3 lepA Elongation factor 4 Aeromonas salmonicida (strain A449)
A7MZB0 0 1046 84 0 597 3 lepA Elongation factor 4 Vibrio campbellii (strain ATCC BAA-1116)
C3LR06 0 1033 84 0 597 3 lepA Elongation factor 4 Vibrio cholerae serotype O1 (strain M66-2)
Q9KPB0 0 1033 84 0 597 3 lepA Elongation factor 4 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F5G3 0 1033 84 0 597 3 lepA Elongation factor 4 Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q7MHN6 0 1032 84 0 597 3 lepA Elongation factor 4 Vibrio vulnificus (strain YJ016)
Q8DC78 0 1032 84 0 597 3 lepA Elongation factor 4 Vibrio vulnificus (strain CMCP6)
Q5E312 0 1031 83 0 597 3 lepA Elongation factor 4 Aliivibrio fischeri (strain ATCC 700601 / ES114)
B5FAH2 0 1030 83 0 597 3 lepA Elongation factor 4 Aliivibrio fischeri (strain MJ11)
B7VK81 0 1016 82 0 597 3 lepA Elongation factor 4 Vibrio atlanticus (strain LGP32)
B6EKN1 0 1016 82 0 597 3 lepA Elongation factor 4 Aliivibrio salmonicida (strain LFI1238)
Q0HSI9 0 1009 80 0 596 3 lepA Elongation factor 4 Shewanella sp. (strain MR-7)
Q0HG96 0 1009 80 0 596 3 lepA Elongation factor 4 Shewanella sp. (strain MR-4)
A0KZN4 0 1008 80 0 596 3 lepA Elongation factor 4 Shewanella sp. (strain ANA-3)
Q8EH83 0 1007 80 0 596 3 lepA Elongation factor 4 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
A3QBS5 0 1006 81 0 596 3 lepA Elongation factor 4 Shewanella loihica (strain ATCC BAA-1088 / PV-4)
A8FSD4 0 1004 79 0 594 3 lepA Elongation factor 4 Shewanella sediminis (strain HAW-EB3)
A4Y4K2 0 1004 79 0 596 3 lepA Elongation factor 4 Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
Q6LMS0 0 1004 83 0 596 3 lepA Elongation factor 4 Photobacterium profundum (strain SS9)
A1RMC9 0 1003 79 0 596 3 lepA Elongation factor 4 Shewanella sp. (strain W3-18-1)
Q12KH9 0 999 80 0 592 3 lepA Elongation factor 4 Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
B4RVA8 0 999 80 0 598 3 lepA Elongation factor 4 Alteromonas mediterranea (strain DSM 17117 / CIP 110805 / LMG 28347 / Deep ecotype)
Q15R31 0 999 80 0 598 3 lepA Elongation factor 4 Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
A6WKQ5 0 996 79 0 596 3 lepA Elongation factor 4 Shewanella baltica (strain OS185)
A3D1V4 0 996 79 0 596 3 lepA Elongation factor 4 Shewanella baltica (strain OS155 / ATCC BAA-1091)
A9L5N4 0 996 79 0 596 3 lepA Elongation factor 4 Shewanella baltica (strain OS195)
B8EBQ4 0 996 79 0 596 3 lepA Elongation factor 4 Shewanella baltica (strain OS223)
B1KI55 0 994 79 0 594 3 lepA Elongation factor 4 Shewanella woodyi (strain ATCC 51908 / MS32)
Q07YZ4 0 993 79 0 592 3 lepA Elongation factor 4 Shewanella frigidimarina (strain NCIMB 400)
B8CQJ7 0 976 79 0 594 3 lepA Elongation factor 4 Shewanella piezotolerans (strain WP3 / JCM 13877)
A1S3X9 0 976 79 0 596 3 lepA Elongation factor 4 Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
A1SSM6 0 975 79 0 597 3 lepA Elongation factor 4 Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
B0TIV5 0 970 79 0 594 3 lepA Elongation factor 4 Shewanella halifaxensis (strain HAW-EB4)
A8H1C5 0 970 79 0 594 3 lepA Elongation factor 4 Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
Q3IDL4 0 949 76 0 596 3 lepA Elongation factor 4 Pseudoalteromonas translucida (strain TAC 125)
Q5R104 0 946 78 0 598 3 lepA Elongation factor 4 Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q21IH3 0 945 75 0 594 3 lepA Elongation factor 4 Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q47WP3 0 942 75 0 592 3 lepA Elongation factor 4 Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q9I5G8 0 937 75 0 594 3 lepA Elongation factor 4 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02HR9 0 937 75 0 594 3 lepA Elongation factor 4 Pseudomonas aeruginosa (strain UCBPP-PA14)
B7UYX5 0 937 75 0 594 3 lepA Elongation factor 4 Pseudomonas aeruginosa (strain LESB58)
A6VAK9 0 937 75 0 594 3 lepA Elongation factor 4 Pseudomonas aeruginosa (strain PA7)
C5BRN3 0 930 73 0 594 3 lepA Elongation factor 4 Teredinibacter turnerae (strain ATCC 39867 / T7901)
Q1LTI1 0 929 74 0 596 3 lepA Elongation factor 4 Baumannia cicadellinicola subsp. Homalodisca coagulata
Q5WVI1 0 925 72 0 596 3 lepA Elongation factor 4 Legionella pneumophila (strain Lens)
Q5ZUD2 0 925 72 0 596 3 lepA Elongation factor 4 Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
A5ID24 0 925 72 0 596 3 lepA Elongation factor 4 Legionella pneumophila (strain Corby)
Q5X443 0 925 72 0 596 3 lepA Elongation factor 4 Legionella pneumophila (strain Paris)
A4VIX2 0 925 73 0 594 3 lepA Elongation factor 4 Stutzerimonas stutzeri (strain A1501)
Q1I5V6 0 924 73 0 594 3 lepA Elongation factor 4 Pseudomonas entomophila (strain L48)
B3PLG4 0 924 73 0 594 3 lepA Elongation factor 4 Cellvibrio japonicus (strain Ueda107)
Q88MY7 0 923 73 0 594 3 lepA Elongation factor 4 Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A5W8F4 0 923 73 0 594 3 lepA Elongation factor 4 Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q4KHT3 0 922 72 0 594 3 lepA Elongation factor 4 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
B0KV29 0 922 73 0 594 3 lepA Elongation factor 4 Pseudomonas putida (strain GB-1)
A4XSC1 0 919 72 0 594 3 lepA Elongation factor 4 Pseudomonas mendocina (strain ymp)
C3K6G8 0 919 72 0 594 3 lepA Elongation factor 4 Pseudomonas fluorescens (strain SBW25)
Q3KHM1 0 918 72 0 594 3 lepA Elongation factor 4 Pseudomonas fluorescens (strain Pf0-1)
A1U2V8 0 918 74 1 596 3 lepA Elongation factor 4 Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q87XF8 0 916 72 0 594 3 lepA Elongation factor 4 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
B1J4D8 0 915 72 0 594 3 lepA Elongation factor 4 Pseudomonas putida (strain W619)
Q2SL35 0 913 74 0 597 3 lepA Elongation factor 4 Hahella chejuensis (strain KCTC 2396)
Q48EV0 0 911 72 0 594 3 lepA Elongation factor 4 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
C1DQS0 0 910 72 0 594 3 lepA Elongation factor 4 Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
Q4ZPD8 0 908 71 0 594 3 lepA Elongation factor 4 Pseudomonas syringae pv. syringae (strain B728a)
Q6F9B9 0 907 73 0 594 3 lepA Elongation factor 4 Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q83BK3 0 907 72 0 591 3 lepA Elongation factor 4 Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
A9N944 0 907 72 0 591 3 lepA Elongation factor 4 Coxiella burnetii (strain RSA 331 / Henzerling II)
A9KF98 0 906 72 0 591 3 lepA Elongation factor 4 Coxiella burnetii (strain Dugway 5J108-111)
Q0VP16 0 905 74 0 594 3 lepA Elongation factor 4 Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q1QX26 0 897 70 1 593 3 lepA Elongation factor 4 Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q3J8D2 0 896 70 0 596 3 lepA Elongation factor 4 Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
B8D7F7 0 895 71 0 590 3 lepA Elongation factor 4 Buchnera aphidicola subsp. Acyrthosiphon pisum (strain Tuc7)
B8D953 0 895 71 0 590 3 lepA Elongation factor 4 Buchnera aphidicola subsp. Acyrthosiphon pisum (strain 5A)
P57348 0 895 71 0 590 3 lepA Elongation factor 4 Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q39I75 0 894 69 0 594 3 lepA Elongation factor 4 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q0A8Z4 0 894 69 0 594 3 lepA Elongation factor 4 Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
B2SZV7 0 893 69 0 594 3 lepA Elongation factor 4 Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
Q608M4 0 893 72 0 596 3 lepA Elongation factor 4 Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q13VM6 0 892 69 0 594 3 lepA Elongation factor 4 Paraburkholderia xenovorans (strain LB400)
B0VCT7 0 892 72 0 594 3 lepA Elongation factor 4 Acinetobacter baumannii (strain AYE)
A3M7P5 0 892 72 0 594 3 lepA Elongation factor 4 Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
B2HWQ2 0 892 72 0 594 3 lepA Elongation factor 4 Acinetobacter baumannii (strain ACICU)
B7I580 0 892 72 0 594 3 lepA Elongation factor 4 Acinetobacter baumannii (strain AB0057)
B7GYS7 0 892 72 0 594 3 lepA Elongation factor 4 Acinetobacter baumannii (strain AB307-0294)
A0Q453 0 892 71 0 592 3 lepA Elongation factor 4 Francisella tularensis subsp. novicida (strain U112)
Q4FUV9 0 889 70 0 594 3 lepA Elongation factor 4 Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q1QDV6 0 889 70 0 594 3 lepA Elongation factor 4 Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q2Y873 0 889 69 0 596 3 lepA Elongation factor 4 Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
B0VTM2 0 889 72 0 594 3 lepA Elongation factor 4 Acinetobacter baumannii (strain SDF)
A6SXR0 0 884 68 0 594 3 lepA Elongation factor 4 Janthinobacterium sp. (strain Marseille)
Q5NEF8 0 881 71 0 592 3 lepA Elongation factor 4 Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q14FW1 0 881 71 0 592 3 lepA Elongation factor 4 Francisella tularensis subsp. tularensis (strain FSC 198)
Q8K9Q9 0 881 70 0 598 3 lepA Elongation factor 4 Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
A4J080 0 880 71 0 592 3 lepA Elongation factor 4 Francisella tularensis subsp. tularensis (strain WY96-3418)
B2SEJ6 0 880 71 0 592 3 lepA Elongation factor 4 Francisella tularensis subsp. mediasiatica (strain FSC147)
Q0BP65 0 879 71 0 592 3 lepA Elongation factor 4 Francisella tularensis subsp. holarctica (strain OSU18)
Q2A5X6 0 879 71 0 592 3 lepA Elongation factor 4 Francisella tularensis subsp. holarctica (strain LVS)
A7N9A4 0 879 71 0 592 3 lepA Elongation factor 4 Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
A5WCD6 0 877 69 0 594 3 lepA Elongation factor 4 Psychrobacter sp. (strain PRwf-1)
A4G6S1 0 874 69 0 594 3 lepA Elongation factor 4 Herminiimonas arsenicoxydans
A1KT27 0 874 68 0 594 3 lepA Elongation factor 4 Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
Q9K055 0 874 68 0 594 3 lepA Elongation factor 4 Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
C1D7L2 0 873 68 0 594 3 lepA Elongation factor 4 Laribacter hongkongensis (strain HLHK9)
Q9JV65 0 872 68 0 594 3 lepA Elongation factor 4 Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
A9M3J8 0 872 68 0 594 3 lepA Elongation factor 4 Neisseria meningitidis serogroup C (strain 053442)
B4RK41 0 872 68 0 594 3 lepA Elongation factor 4 Neisseria gonorrhoeae (strain NCCP11945)
Q5F9P9 0 872 68 0 594 3 lepA Elongation factor 4 Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q63S94 0 872 69 0 594 3 lepA Elongation factor 4 Burkholderia pseudomallei (strain K96243)
A3NBT1 0 872 69 0 594 3 lepA Elongation factor 4 Burkholderia pseudomallei (strain 668)
Q3JQ75 0 872 69 0 594 3 lepA Elongation factor 4 Burkholderia pseudomallei (strain 1710b)
A3NXL8 0 872 69 0 594 3 lepA Elongation factor 4 Burkholderia pseudomallei (strain 1106a)
A1V6B9 0 872 69 0 594 3 lepA Elongation factor 4 Burkholderia mallei (strain SAVP1)
Q62LT1 0 872 69 0 594 3 lepA Elongation factor 4 Burkholderia mallei (strain ATCC 23344)
A2S9Z3 0 872 69 0 594 3 lepA Elongation factor 4 Burkholderia mallei (strain NCTC 10229)
A3MM44 0 872 69 0 594 3 lepA Elongation factor 4 Burkholderia mallei (strain NCTC 10247)
B3R202 0 871 68 0 594 3 lepA Elongation factor 4 Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
A9ADE0 0 871 69 0 594 3 lepA Elongation factor 4 Burkholderia multivorans (strain ATCC 17616 / 249)
A4JCQ9 0 871 69 0 594 3 lepA Elongation factor 4 Burkholderia vietnamiensis (strain G4 / LMG 22486)
Q2SXT6 0 871 69 0 594 3 lepA Elongation factor 4 Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
B0TW33 0 870 71 0 592 3 lepA Elongation factor 4 Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
Q1BXU3 0 870 69 0 594 3 lepA Elongation factor 4 Burkholderia orbicola (strain AU 1054)
B1JYB1 0 870 69 0 594 3 lepA Elongation factor 4 Burkholderia orbicola (strain MC0-3)
A0K5V7 0 870 69 0 594 3 lepA Elongation factor 4 Burkholderia cenocepacia (strain HI2424)
Q3SH47 0 870 69 0 590 3 lepA Elongation factor 4 Thiobacillus denitrificans (strain ATCC 25259)
Q0BH06 0 869 69 0 594 3 lepA Elongation factor 4 Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
B1YVM2 0 869 69 0 594 3 lepA Elongation factor 4 Burkholderia ambifaria (strain MC40-6)
Q0K8N0 0 868 68 0 594 3 lepA Elongation factor 4 Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
B1XTL2 0 868 67 1 596 3 lepA Elongation factor 4 Polynucleobacter necessarius subsp. necessarius (strain STIR1)
Q1H2L5 0 867 69 0 594 3 lepA1 Elongation factor 4 Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
A1AWP9 0 865 67 0 594 3 lepA Elongation factor 4 Ruthia magnifica subsp. Calyptogena magnifica
B2JFK0 0 865 69 0 594 3 lepA Elongation factor 4 Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
Q46Z15 0 860 68 0 594 3 lepA Elongation factor 4 Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q0AF67 0 858 68 0 594 3 lepA Elongation factor 4 Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q1LKM8 0 857 68 0 594 3 lepA Elongation factor 4 Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
P56865 0 857 66 0 594 3 lepA Elongation factor 4 Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7W5J4 0 857 66 0 594 3 lepA Elongation factor 4 Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WD30 0 857 66 0 594 3 lepA Elongation factor 4 Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q7NWC7 0 853 68 0 595 3 lepA Elongation factor 4 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
A9III9 0 852 66 0 594 3 lepA Elongation factor 4 Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
Q820H8 0 851 68 0 594 3 lepA Elongation factor 4 Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q492C9 0 849 65 0 597 3 lepA Elongation factor 4 Blochmanniella pennsylvanica (strain BPEN)
B4SRL3 0 847 69 0 594 3 lepA Elongation factor 4 Stenotrophomonas maltophilia (strain R551-3)
Q47EG0 0 846 67 0 594 3 lepA Elongation factor 4 Dechloromonas aromatica (strain RCB)
Q2KWY3 0 846 65 0 594 3 lepA Elongation factor 4 Bordetella avium (strain 197N)
B2FQC4 0 845 69 0 594 3 lepA Elongation factor 4 Stenotrophomonas maltophilia (strain K279a)
A2SDH0 0 845 65 2 602 3 lepA Elongation factor 4 Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
A4SVW0 0 844 66 1 596 3 lepA Elongation factor 4 Polynucleobacter asymbioticus (strain DSM 18221 / CIP 109841 / QLW-P1DMWA-1)
Q126K0 0 841 65 1 601 3 lepA Elongation factor 4 Polaromonas sp. (strain JS666 / ATCC BAA-500)
Q8Y0I4 0 840 68 1 595 3 lepA Elongation factor 4 Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
B1XZN0 0 839 65 1 600 3 lepA Elongation factor 4 Leptothrix cholodnii (strain ATCC 51168 / LMG 8142 / SP-6)
B2U978 0 838 68 2 596 3 lepA Elongation factor 4 Ralstonia pickettii (strain 12J)
Q5P089 0 837 67 0 594 3 lepA Elongation factor 4 Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
A9BNJ8 0 835 64 1 600 3 lepA Elongation factor 4 Delftia acidovorans (strain DSM 14801 / SPH-1)
A1VRT5 0 833 65 1 601 3 lepA Elongation factor 4 Polaromonas naphthalenivorans (strain CJ2)
B9MDP9 0 833 64 1 600 3 lepA Elongation factor 4 Acidovorax ebreus (strain TPSY)
B5EQB5 0 833 65 0 595 3 lepA Elongation factor 4 Acidithiobacillus ferrooxidans (strain ATCC 53993 / BNL-5-31)
B7J9J8 0 833 65 0 595 3 lepA Elongation factor 4 Acidithiobacillus ferrooxidans (strain ATCC 23270 / DSM 14882 / CIP 104768 / NCIMB 8455)
A1TLE7 0 831 64 1 600 3 lepA Elongation factor 4 Paracidovorax citrulli (strain AAC00-1)
Q8PB55 0 830 68 0 596 3 lepA Elongation factor 4 Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
A1WAW8 0 829 64 1 600 3 lepA Elongation factor 4 Acidovorax sp. (strain JS42)
B0RX30 0 829 68 0 596 3 lepA Elongation factor 4 Xanthomonas campestris pv. campestris (strain B100)
Q4USF4 0 829 68 0 596 3 lepA Elongation factor 4 Xanthomonas campestris pv. campestris (strain 8004)
Q31HP5 0 828 69 1 598 3 lepA Elongation factor 4 Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q8PMV3 0 828 68 0 596 3 lepA Elongation factor 4 Xanthomonas axonopodis pv. citri (strain 306)
Q5H1R5 0 828 68 0 596 3 lepA Elongation factor 4 Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q2P4M4 0 828 68 0 596 3 lepA Elongation factor 4 Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q3BVV9 0 828 68 0 596 3 lepA Elongation factor 4 Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
B2SRY0 0 827 68 0 596 3 lepA Elongation factor 4 Xanthomonas oryzae pv. oryzae (strain PXO99A)
C5CSF2 0 827 64 1 601 3 lepA Elongation factor 4 Variovorax paradoxus (strain S110)
A5CWJ4 0 826 66 0 594 3 lepA Elongation factor 4 Vesicomyosocius okutanii subsp. Calyptogena okutanii (strain HA)
B0U3D5 0 825 67 0 594 3 lepA Elongation factor 4 Xylella fastidiosa (strain M12)
Q9PBA1 0 825 68 0 594 3 lepA Elongation factor 4 Xylella fastidiosa (strain 9a5c)
A1WMW4 0 825 64 1 600 3 lepA Elongation factor 4 Verminephrobacter eiseniae (strain EF01-2)
A1K601 0 825 66 0 594 3 lepA Elongation factor 4 Azoarcus sp. (strain BH72)
Q21XN4 0 824 63 1 601 3 lepA Elongation factor 4 Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q87C09 0 824 67 0 594 3 lepA Elongation factor 4 Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I601 0 824 67 0 594 3 lepA Elongation factor 4 Xylella fastidiosa (strain M23)
Q7VRQ8 0 816 65 2 596 3 lepA Elongation factor 4 Blochmanniella floridana
Q89AM5 0 813 63 0 590 3 lepA Elongation factor 4 Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
P60789 0 789 62 1 597 3 lepA Elongation factor 4 Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
B0TAD2 0 784 60 1 595 3 lepA Elongation factor 4 Heliobacterium modesticaldum (strain ATCC 51547 / Ice1)
Q2W0F9 0 783 61 0 596 3 lepA Elongation factor 4 Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
A0L631 0 782 61 1 597 3 lepA Elongation factor 4 Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
Q39US7 0 781 62 1 597 3 lepA Elongation factor 4 Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
Q1D6M1 0 781 61 1 593 3 lepA Elongation factor 4 Myxococcus xanthus (strain DK1622)
A5G4G3 0 779 61 1 597 3 lepA Elongation factor 4 Geotalea uraniireducens (strain Rf4)
B9M4U5 0 774 61 1 597 3 lepA Elongation factor 4 Geotalea daltonii (strain DSM 22248 / JCM 15807 / FRC-32)
B3E9R0 0 773 61 1 597 3 lepA Elongation factor 4 Trichlorobacter lovleyi (strain ATCC BAA-1151 / DSM 17278 / SZ)
Q2RKX8 0 773 61 1 596 3 lepA Elongation factor 4 Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
C1F2I3 0 770 61 1 600 3 lepA Elongation factor 4 Acidobacterium capsulatum (strain ATCC 51196 / DSM 11244 / BCRC 80197 / JCM 7670 / NBRC 15755 / NCIMB 13165 / 161)
Q3A445 0 769 61 1 597 3 lepA Elongation factor 4 Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
A1ARG8 0 768 61 1 597 3 lepA Elongation factor 4 Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
A4J7F8 0 768 60 1 594 3 lepA Elongation factor 4 Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
Q2IIA6 0 763 59 1 596 3 lepA Elongation factor 4 Anaeromyxobacter dehalogenans (strain 2CP-C)
B8JAF3 0 763 59 1 596 3 lepA Elongation factor 4 Anaeromyxobacter dehalogenans (strain 2CP-1 / ATCC BAA-258)
B5EB36 0 763 60 1 597 3 lepA Elongation factor 4 Citrifermentans bemidjiense (strain ATCC BAA-1014 / DSM 16622 / JCM 12645 / Bem)
A5D3X6 0 762 61 1 595 3 lepA Elongation factor 4 Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
C6DZ67 0 761 60 1 597 3 lepA Elongation factor 4 Geobacter sp. (strain M21)
B4UDQ7 0 761 59 1 596 3 lepA Elongation factor 4 Anaeromyxobacter sp. (strain K)
Q24SR6 0 761 58 1 592 3 lepA Elongation factor 4 Desulfitobacterium hafniense (strain Y51)
B8FUP2 0 761 58 1 592 3 lepA Elongation factor 4 Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
A7HCF3 0 759 59 1 593 3 lepA Elongation factor 4 Anaeromyxobacter sp. (strain Fw109-5)
Q0BRZ7 0 756 59 0 594 3 lepA Elongation factor 4 Granulibacter bethesdensis (strain ATCC BAA-1260 / CGDNIH1)
Q9KD76 0 756 58 1 594 3 lepA Elongation factor 4 Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q5FUC2 0 755 60 0 594 3 lepA Elongation factor 4 Gluconobacter oxydans (strain 621H)
A5FY07 0 755 60 0 591 3 lepA Elongation factor 4 Acidiphilium cryptum (strain JF-5)
B8DIZ5 0 754 61 1 596 3 lepA Elongation factor 4 Nitratidesulfovibrio vulgaris (strain DSM 19637 / Miyazaki F)
B0JQT7 0 753 59 1 595 3 lepA Elongation factor 4 Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
Q01SV7 0 752 59 1 599 3 lepA Elongation factor 4 Solibacter usitatus (strain Ellin6076)
B9DSE0 0 752 58 1 595 3 lepA Elongation factor 4 Streptococcus uberis (strain ATCC BAA-854 / 0140J)
Q3AF13 0 751 61 1 592 3 lepA Elongation factor 4 Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
A7GT14 0 751 57 1 597 3 lepA Elongation factor 4 Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
B7GKC4 0 750 59 1 594 3 lepA Elongation factor 4 Anoxybacillus flavithermus (strain DSM 21510 / WK1)
Q1IV51 0 749 60 1 600 3 lepA Elongation factor 4 Koribacter versatilis (strain Ellin345)
Q5KWZ3 0 749 58 1 593 3 lepA Elongation factor 4 Geobacillus kaustophilus (strain HTA426)
A7IEG8 0 749 59 0 593 3 lepA Elongation factor 4 Xanthobacter autotrophicus (strain ATCC BAA-1158 / Py2)
C4L433 0 749 57 1 595 3 lepA Elongation factor 4 Exiguobacterium sp. (strain ATCC BAA-1283 / AT1b)
Q89BJ8 0 749 58 1 596 3 lepA Elongation factor 4 Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q8D307 0 749 58 0 595 3 lepA Elongation factor 4 Wigglesworthia glossinidia brevipalpis
Q5WHG5 0 749 57 1 594 3 lepA Elongation factor 4 Shouchella clausii (strain KSM-K16)
B6IUG3 0 747 59 0 597 3 lepA Elongation factor 4 Rhodospirillum centenum (strain ATCC 51521 / SW)
Q730L6 0 747 57 1 594 3 lepA Elongation factor 4 Bacillus cereus (strain ATCC 10987 / NRS 248)
B7KJX0 0 746 58 1 598 3 lepA Elongation factor 4 Gloeothece citriformis (strain PCC 7424)
A8FFD6 0 746 58 1 594 3 lepA Elongation factor 4 Bacillus pumilus (strain SAFR-032)
B8IMT0 0 745 59 0 594 3 lepA Elongation factor 4 Methylobacterium nodulans (strain LMG 21967 / CNCM I-2342 / ORS 2060)
Q65H50 0 745 57 1 594 3 lepA Elongation factor 4 Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
P60930 0 744 59 1 597 3 lepA Elongation factor 4 Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
B7HCU5 0 744 57 1 594 3 lepA Elongation factor 4 Bacillus cereus (strain B4264)
B7IYH2 0 744 57 1 594 3 lepA Elongation factor 4 Bacillus cereus (strain G9842)
Q5M4M2 0 744 57 1 595 3 lepA Elongation factor 4 Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
A9HG78 0 744 59 0 591 3 lepA Elongation factor 4 Gluconacetobacter diazotrophicus (strain ATCC 49037 / DSM 5601 / CCUG 37298 / CIP 103539 / LMG 7603 / PAl5)
Q03KW7 0 744 57 1 595 3 lepA Elongation factor 4 Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q5M008 0 744 57 1 595 3 lepA Elongation factor 4 Streptococcus thermophilus (strain CNRZ 1066)
B9IY86 0 744 57 1 594 3 lepA Elongation factor 4 Bacillus cereus (strain Q1)
B7HPL8 0 744 57 1 594 3 lepA Elongation factor 4 Bacillus cereus (strain AH187)
B7JNV1 0 744 57 1 594 3 lepA Elongation factor 4 Bacillus cereus (strain AH820)
A4IR35 0 743 58 1 593 3 lepA Elongation factor 4 Geobacillus thermodenitrificans (strain NG80-2)
A7Z6W5 0 743 57 1 594 3 lepA Elongation factor 4 Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
Q3SVT1 0 743 59 1 596 3 lepA Elongation factor 4 Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
B1YKS5 0 743 57 1 595 3 lepA Elongation factor 4 Exiguobacterium sibiricum (strain DSM 17290 / CCUG 55495 / CIP 109462 / JCM 13490 / 255-15)
Q8FV17 0 743 58 1 598 3 lepA Elongation factor 4 Brucella suis biovar 1 (strain 1330)
A9WW49 0 743 58 1 598 3 lepA Elongation factor 4 Brucella suis (strain ATCC 23445 / NCTC 10510)
A5VVU4 0 743 58 1 598 3 lepA Elongation factor 4 Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
A9MCW5 0 743 58 1 598 3 lepA Elongation factor 4 Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q818E4 0 743 57 1 594 3 lepA Elongation factor 4 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
C3L5S2 0 743 57 1 594 3 lepA Elongation factor 4 Bacillus anthracis (strain CDC 684 / NRRL 3495)
Q8DTF3 0 742 57 1 595 3 lepA Elongation factor 4 Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
P65274 0 742 57 1 595 3 lepA Elongation factor 4 Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
P65273 0 742 57 1 595 3 lepA Elongation factor 4 Streptococcus agalactiae serotype III (strain NEM316)
Q3K1F9 0 742 57 1 595 3 lepA Elongation factor 4 Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
P37949 0 742 57 1 594 3 lepA Elongation factor 4 Bacillus subtilis (strain 168)
Q6HDK2 0 742 57 1 594 3 lepA Elongation factor 4 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q634M2 0 742 57 1 594 3 lepA Elongation factor 4 Bacillus cereus (strain ZK / E33L)
C1ESL3 0 742 57 1 594 3 lepA Elongation factor 4 Bacillus cereus (strain 03BB102)
Q81LR7 0 742 57 1 594 3 lepA Elongation factor 4 Bacillus anthracis
A0RIT7 0 742 57 1 594 3 lepA Elongation factor 4 Bacillus thuringiensis (strain Al Hakam)
C3P8M5 0 742 57 1 594 3 lepA Elongation factor 4 Bacillus anthracis (strain A0248)
Q8UIQ2 0 742 58 1 596 3 lepA Elongation factor 4 Agrobacterium fabrum (strain C58 / ATCC 33970)
B8H2Z7 0 741 59 0 597 3 lepA Elongation factor 4 Caulobacter vibrioides (strain NA1000 / CB15N)
Q9A9F4 0 741 59 0 597 3 lepA Elongation factor 4 Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q8RB72 0 741 59 1 596 3 lepA Elongation factor 4 Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
A6WYK4 0 741 58 1 598 3 lepA Elongation factor 4 Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
Q8YDB8 0 741 58 1 598 3 lepA Elongation factor 4 Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
C0RMH8 0 741 58 1 598 3 lepA Elongation factor 4 Brucella melitensis biotype 2 (strain ATCC 23457)
Q576S5 0 741 58 1 598 3 lepA Elongation factor 4 Brucella abortus biovar 1 (strain 9-941)
Q2YJP8 0 741 58 1 598 3 lepA Elongation factor 4 Brucella abortus (strain 2308)
B2SC25 0 741 58 1 598 3 lepA Elongation factor 4 Brucella abortus (strain S19)
A9GWZ4 0 740 58 1 592 3 lepA Elongation factor 4 Sorangium cellulosum (strain So ce56)
Q1QR19 0 740 58 1 596 3 lepA Elongation factor 4 Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
Q8Y742 0 740 58 1 592 3 lepA Elongation factor 4 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
B8DE32 0 740 58 1 592 3 lepA Elongation factor 4 Listeria monocytogenes serotype 4a (strain HCC23)
Q71ZJ1 0 740 58 1 592 3 lepA Elongation factor 4 Listeria monocytogenes serotype 4b (strain F2365)
C1KVC6 0 740 58 1 592 3 lepA Elongation factor 4 Listeria monocytogenes serotype 4b (strain CLIP80459)
A5VB59 0 740 57 1 602 3 lepA Elongation factor 4 Rhizorhabdus wittichii (strain DSM 6014 / CCUG 31198 / JCM 15750 / NBRC 105917 / EY 4224 / RW1)
A4VUL8 0 739 57 1 595 3 lepA Elongation factor 4 Streptococcus suis (strain 05ZYH33)
A4W0W0 0 739 57 1 595 3 lepA Elongation factor 4 Streptococcus suis (strain 98HAH33)
Q5XCD2 0 739 57 1 595 3 lepA Elongation factor 4 Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
A9VHU6 0 739 57 1 594 3 lepA Elongation factor 4 Bacillus mycoides (strain KBAB4)
Q1JH37 0 739 57 1 595 3 lepA Elongation factor 4 Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q72E76 0 739 59 1 596 3 lepA Elongation factor 4 Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
C0MDV7 0 738 57 1 593 3 lepA Elongation factor 4 Streptococcus equi subsp. zooepidemicus (strain H70)
B0UFE0 0 738 58 0 594 3 lepA Elongation factor 4 Methylobacterium sp. (strain 4-46)
Q1MQF3 0 738 58 1 596 3 lepA Elongation factor 4 Lawsonia intracellularis (strain PHE/MN1-00)
Q8DM20 0 738 58 1 595 3 lepA Elongation factor 4 Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q831Z0 0 738 57 1 592 3 lepA Elongation factor 4 Enterococcus faecalis (strain ATCC 700802 / V583)
Q2JQ51 0 738 57 1 598 3 lepA Elongation factor 4 Synechococcus sp. (strain JA-2-3B'a(2-13))
Q48TU0 0 738 57 1 595 3 lepA Elongation factor 4 Streptococcus pyogenes serotype M28 (strain MGAS6180)
Q1JLY8 0 738 57 1 595 3 lepA Elongation factor 4 Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q99ZV8 0 738 57 1 595 3 lepA Elongation factor 4 Streptococcus pyogenes serotype M1
Q92SU3 0 738 58 1 596 3 lepA Elongation factor 4 Rhizobium meliloti (strain 1021)
P0DC23 0 737 57 1 595 3 lepA Elongation factor 4 Streptococcus pyogenes serotype M3 (strain SSI-1)
P0DC22 0 737 57 1 595 3 lepA Elongation factor 4 Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
C6BST2 0 737 57 1 599 3 lepA Elongation factor 4 Maridesulfovibrio salexigens (strain ATCC 14822 / DSM 2638 / NCIMB 8403 / VKM B-1763)
A0AIS8 0 737 58 1 592 3 lepA Elongation factor 4 Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q92BN4 0 737 58 1 592 3 lepA Elongation factor 4 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
B1I6E0 0 737 60 1 596 3 lepA Elongation factor 4 Desulforudis audaxviator (strain MP104C)
B8J444 0 737 60 1 600 3 lepA Elongation factor 4 Desulfovibrio desulfuricans (strain ATCC 27774 / DSM 6949 / MB)
Q1JC06 0 736 57 1 592 3 lepA Elongation factor 4 Streptococcus pyogenes serotype M12 (strain MGAS2096)
Q6G550 0 736 57 1 596 3 lepA Elongation factor 4 Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
Q2JWR1 0 735 57 1 598 3 lepA Elongation factor 4 Synechococcus sp. (strain JA-3-3Ab)
B5XLC6 0 735 57 1 595 3 lepA Elongation factor 4 Streptococcus pyogenes serotype M49 (strain NZ131)
Q2KDL5 0 735 57 1 599 3 lepA Elongation factor 4 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q0ATE3 0 735 58 1 592 3 lepA Elongation factor 4 Maricaulis maris (strain MCS10)
B4U3G9 0 735 56 1 593 3 lepA Elongation factor 4 Streptococcus equi subsp. zooepidemicus (strain MGCS10565)
B8ENL1 0 734 58 0 594 3 lepA Elongation factor 4 Methylocella silvestris (strain DSM 15510 / CIP 108128 / LMG 27833 / NCIMB 13906 / BL2)
Q6G1F5 0 734 57 1 596 3 lepA Elongation factor 4 Bartonella quintana (strain Toulouse)
A4XKA0 0 734 58 2 595 3 lepA Elongation factor 4 Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
C0M8H9 0 733 56 1 593 3 lepA Elongation factor 4 Streptococcus equi subsp. equi (strain 4047)
A8AWG3 0 733 56 1 595 3 lepA Elongation factor 4 Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
A8GW16 0 733 57 0 595 3 lepA Elongation factor 4 Rickettsia bellii (strain OSU 85-389)
Q0C5X0 0 733 57 1 597 3 lepA Elongation factor 4 Hyphomonas neptunium (strain ATCC 15444)
B1IC02 0 733 56 1 595 3 lepA Elongation factor 4 Streptococcus pneumoniae (strain Hungary19A-6)
Q11AY3 0 733 58 1 596 3 lepA Elongation factor 4 Chelativorans sp. (strain BNC1)
B9MJZ5 0 732 58 2 595 3 lepA Elongation factor 4 Caldicellulosiruptor bescii (strain ATCC BAA-1888 / DSM 6725 / KCTC 15123 / Z-1320)
Q1GRH5 0 732 59 1 602 3 lepA Elongation factor 4 Sphingopyxis alaskensis (strain DSM 13593 / LMG 18877 / RB2256)
A2RL76 0 732 56 1 595 3 lepA Elongation factor 4 Lactococcus lactis subsp. cremoris (strain MG1363)
Q4UKS2 0 731 57 0 595 3 lepA Elongation factor 4 Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q5NLP5 0 731 59 1 598 3 lepA Elongation factor 4 Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
Q2RNY6 0 731 57 1 598 3 lepA Elongation factor 4 Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
B9E6X5 0 731 57 1 596 3 lepA Elongation factor 4 Macrococcus caseolyticus (strain JCSC5402)
Q02Z80 0 731 56 1 595 3 lepA Elongation factor 4 Lactococcus lactis subsp. cremoris (strain SK11)
Q9CGI8 0 731 56 1 595 3 lepA Elongation factor 4 Lactococcus lactis subsp. lactis (strain IL1403)
Q49Y26 0 730 56 1 596 3 lepA Elongation factor 4 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q30XI4 0 730 58 1 596 3 lepA Elongation factor 4 Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
Q67S76 0 730 57 1 596 3 lepA Elongation factor 4 Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
C1C7G9 0 730 56 1 595 3 lepA Elongation factor 4 Streptococcus pneumoniae (strain 70585)
B5E4T8 0 730 56 1 595 3 lepA Elongation factor 4 Streptococcus pneumoniae serotype 19F (strain G54)
A8GMT1 0 730 57 0 596 3 lepA Elongation factor 4 Rickettsia akari (strain Hartford)
C1CR98 0 729 56 1 595 3 lepA Elongation factor 4 Streptococcus pneumoniae (strain Taiwan19F-14)
Q8DPN5 0 729 56 1 595 3 lepA Elongation factor 4 Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
B8ZQ69 0 729 56 1 595 3 lepA Elongation factor 4 Streptococcus pneumoniae (strain ATCC 700669 / Spain 23F-1)
Q04KB7 0 729 56 1 595 3 lepA Elongation factor 4 Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
B3PYC6 0 729 57 1 599 3 lepA Elongation factor 4 Rhizobium etli (strain CIAT 652)
C1CKU6 0 728 56 1 595 3 lepA Elongation factor 4 Streptococcus pneumoniae (strain P1031)
Q97QK5 0 728 56 1 595 3 lepA Elongation factor 4 Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
A9KKU4 0 728 57 2 597 3 lepA Elongation factor 4 Lachnoclostridium phytofermentans (strain ATCC 700394 / DSM 18823 / ISDg)
B3CPV1 0 728 56 1 597 3 lepA Elongation factor 4 Wolbachia pipientis subsp. Culex pipiens (strain wPip)
C1CEG3 0 727 56 1 595 3 lepA Elongation factor 4 Streptococcus pneumoniae (strain JJA)
B8HLK8 0 727 57 1 595 3 lepA Elongation factor 4 Cyanothece sp. (strain PCC 7425 / ATCC 29141)
C3PMX3 0 727 57 0 595 3 lepA Elongation factor 4 Rickettsia africae (strain ESF-5)
B0KA85 0 726 57 1 596 3 lepA Elongation factor 4 Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
B5ZXQ5 0 726 57 1 599 3 lepA Elongation factor 4 Rhizobium leguminosarum bv. trifolii (strain WSM2304)
Q3J4P0 0 726 55 0 595 3 lepA Elongation factor 4 Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
B0C9R9 0 726 57 1 595 3 lepA Elongation factor 4 Acaryochloris marina (strain MBIC 11017)
Q8CP13 0 725 57 1 593 3 lepA Elongation factor 4 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HNW2 0 725 57 1 593 3 lepA Elongation factor 4 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
B7K3Z7 0 724 57 1 595 3 lepA Elongation factor 4 Rippkaea orientalis (strain PCC 8801 / RF-1)
A8GRF6 0 724 56 0 596 3 lepA Elongation factor 4 Rickettsia rickettsii (strain Sheila Smith)
B0BWV5 0 724 56 0 596 3 lepA Elongation factor 4 Rickettsia rickettsii (strain Iowa)
C4K153 0 724 56 0 595 3 lepA Elongation factor 4 Rickettsia peacockii (strain Rustic)
Q1MMQ8 0 724 56 1 599 3 lepA Elongation factor 4 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
B9KNH9 0 724 55 0 595 3 lepA Elongation factor 4 Cereibacter sphaeroides (strain KD131 / KCTC 12085)
B6JJT7 0 724 58 0 594 3 lepA Elongation factor 4 Afipia carboxidovorans (strain ATCC 49405 / DSM 1227 / KCTC 32145 / OM5)
Q92IQ1 0 724 56 0 595 3 lepA Elongation factor 4 Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q98DV1 0 724 57 1 596 3 lepA Elongation factor 4 Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
A3PHQ9 0 724 55 0 595 3 lepA Elongation factor 4 Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
B0K3Y4 0 724 57 1 596 3 lepA Elongation factor 4 Thermoanaerobacter sp. (strain X514)
C0R5S3 0 723 56 1 597 3 lepA Elongation factor 4 Wolbachia sp. subsp. Drosophila simulans (strain wRi)
Q4L6T4 0 723 56 1 593 3 lepA Elongation factor 4 Staphylococcus haemolyticus (strain JCSC1435)
Q7VJZ1 0 723 56 4 596 3 lepA Elongation factor 4 Helicobacter hepaticus (strain ATCC 51449 / 3B1)
Q73HR8 0 722 56 1 597 3 lepA Elongation factor 4 Wolbachia pipientis wMel
B1WWD8 0 722 57 1 595 3 lepA Elongation factor 4 Crocosphaera subtropica (strain ATCC 51142 / BH68)
B9DNK4 0 721 56 1 596 3 lepA Elongation factor 4 Staphylococcus carnosus (strain TM300)
Q31R08 0 721 57 1 600 3 lepA Elongation factor 4 Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
B3Q991 0 720 58 1 596 3 lepA Elongation factor 4 Rhodopseudomonas palustris (strain TIE-1)
P60793 0 720 58 1 596 3 lepA Elongation factor 4 Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q38W39 0 719 56 1 593 3 lepA Elongation factor 4 Latilactobacillus sakei subsp. sakei (strain 23K)
Q038N6 0 719 57 1 593 3 lepA Elongation factor 4 Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
B3WEQ5 0 719 57 1 593 3 lepA Elongation factor 4 Lacticaseibacillus casei (strain BL23)
A4WX88 0 719 54 0 595 3 lepA Elongation factor 4 Cereibacter sphaeroides (strain ATCC 17025 / ATH 2.4.3)
A7ZCJ3 0 718 56 3 596 3 lepA Elongation factor 4 Campylobacter concisus (strain 13826)
Q4FNH3 0 718 56 1 599 3 lepA Elongation factor 4 Pelagibacter ubique (strain HTCC1062)
Q28LR4 0 718 56 0 592 3 lepA Elongation factor 4 Jannaschia sp. (strain CCS1)
Q1GIV5 0 717 55 0 595 3 lepA Elongation factor 4 Ruegeria sp. (strain TM1040)
Q16BA3 0 717 55 0 592 3 lepA Elongation factor 4 Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
A7GHI0 0 717 55 1 591 3 lepA Elongation factor 4 Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
B1ILM7 0 717 55 1 591 3 lepA Elongation factor 4 Clostridium botulinum (strain Okra / Type B1)
Q5N390 0 717 57 1 600 3 lepA Elongation factor 4 Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
A8EY28 0 717 56 0 595 3 lepA Elongation factor 4 Rickettsia canadensis (strain McKiel)
Q2N9U6 0 716 58 2 606 3 lepA Elongation factor 4 Erythrobacter litoralis (strain HTCC2594)
B1ZC10 0 716 56 0 594 3 lepA Elongation factor 4 Methylorubrum populi (strain ATCC BAA-705 / NCIMB 13946 / BJ001)
Q88VN0 0 716 56 1 596 3 lepA1 Elongation factor 4 1 Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
B1KZP1 0 715 55 1 591 3 lepA Elongation factor 4 Clostridium botulinum (strain Loch Maree / Type A3)
A8Z4C4 0 714 56 1 593 3 lepA Elongation factor 4 Staphylococcus aureus (strain USA300 / TCH1516)
A6QHC7 0 714 56 1 593 3 lepA Elongation factor 4 Staphylococcus aureus (strain Newman)
Q5HFH6 0 714 56 1 593 3 lepA Elongation factor 4 Staphylococcus aureus (strain COL)
Q2FXY7 0 714 56 1 593 1 lepA Elongation factor 4 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FGD9 0 714 56 1 593 3 lepA Elongation factor 4 Staphylococcus aureus (strain USA300)
Q6G8Y3 0 714 56 1 593 3 lepA Elongation factor 4 Staphylococcus aureus (strain MSSA476)
Q6GGB6 0 714 56 1 593 3 lepA Elongation factor 4 Staphylococcus aureus (strain MRSA252)
P65272 0 714 56 1 593 1 lepA Elongation factor 4 Staphylococcus aureus (strain N315)
P65271 0 714 56 1 593 3 lepA Elongation factor 4 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q2YT42 0 714 56 1 593 3 lepA Elongation factor 4 Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5ITB2 0 714 56 1 593 3 lepA Elongation factor 4 Staphylococcus aureus (strain JH9)
A6U257 0 714 56 1 593 3 lepA Elongation factor 4 Staphylococcus aureus (strain JH1)
A7X2Y7 0 714 56 1 593 3 lepA Elongation factor 4 Staphylococcus aureus (strain Mu3 / ATCC 700698)
A6Q241 0 714 55 4 598 3 lepA Elongation factor 4 Nitratiruptor sp. (strain SB155-2)
A5I644 0 714 55 1 591 3 lepA Elongation factor 4 Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
A7FXL9 0 714 55 1 591 3 lepA Elongation factor 4 Clostridium botulinum (strain ATCC 19397 / Type A)
Q8NWA7 0 713 56 1 593 3 lepA Elongation factor 4 Staphylococcus aureus (strain MW2)
B8I3E6 0 713 55 2 595 3 lepA Elongation factor 4 Ruminiclostridium cellulolyticum (strain ATCC 35319 / DSM 5812 / JCM 6584 / H10)
Q68X95 0 713 56 0 593 3 lepA Elongation factor 4 Rickettsia typhi (strain ATCC VR-144 / Wilmington)
C1FVU4 0 713 55 1 591 3 lepA Elongation factor 4 Clostridium botulinum (strain Kyoto / Type A2)
B7KR78 0 712 56 0 594 3 lepA Elongation factor 4 Methylorubrum extorquens (strain CM4 / NCIMB 13688)
A3DF29 0 712 57 2 593 3 lepA Elongation factor 4 Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q13E78 0 712 58 1 596 3 lepA Elongation factor 4 Rhodopseudomonas palustris (strain BisB5)
Q2J2Y0 0 712 58 1 596 3 lepA Elongation factor 4 Rhodopseudomonas palustris (strain HaA2)
C3L3H1 0 712 55 1 591 3 lepA Elongation factor 4 Clostridium botulinum (strain 657 / Type Ba4)
Q8CXD0 0 712 54 1 596 3 lepA Elongation factor 4 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q5LUS0 0 711 55 0 592 3 lepA Elongation factor 4 Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q21BS0 0 711 57 0 594 3 lepA Elongation factor 4 Rhodopseudomonas palustris (strain BisB18)
A0Q1R8 0 711 55 1 593 3 lepA Elongation factor 4 Clostridium novyi (strain NT)
A1W018 0 711 56 4 600 3 lepA Elongation factor 4 Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
Q9PNR1 0 711 56 4 600 3 lepA Elongation factor 4 Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
A8FM79 0 711 56 4 600 3 lepA Elongation factor 4 Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
Q5GRW9 0 711 55 1 597 3 lepA Elongation factor 4 Wolbachia sp. subsp. Brugia malayi (strain TRS)
A0RQX4 0 711 56 3 596 3 lepA Elongation factor 4 Campylobacter fetus subsp. fetus (strain 82-40)
Q5HU70 0 710 56 4 600 3 lepA Elongation factor 4 Campylobacter jejuni (strain RM1221)
B3CRQ1 0 710 55 0 593 3 lepA Elongation factor 4 Orientia tsutsugamushi (strain Ikeda)
A7H311 0 710 56 4 598 3 lepA Elongation factor 4 Campylobacter jejuni subsp. doylei (strain ATCC BAA-1458 / RM4099 / 269.97)

  • Number of RefSeq hits:

General

Source Morganella morganii S4
Locus tag NLDBIP_03340
Feature type CDS
Gene lepA
Product translation elongation factor 4
Location 649237 - 651036 (strand: -1)
Length 1800 (nucleotides) / 599 (amino acids)

Contig

Accession ZDB_519
Length 680340 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_561
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00009 Elongation factor Tu GTP binding domain
PF00679 Elongation factor G C-terminus
PF03144 Elongation factor Tu domain 2
PF06421 GTP-binding protein LepA C-terminus

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0481 Translation, ribosomal structure and biogenesis (J) J Translation elongation factor EF-4, membrane-bound GTPase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K03596 GTP-binding protein LepA Legionellosis -

Protein Sequence

MKINHIRNFSIIAHIDHGKSTLSDRIIQICGGLSDREMAAQVLDSMDLERERGITIKAQSVTLDYTAQNGETYQLNFIDTPGHVDFSYEVSRSLAACEGALLVVDAGQGVEAQTLANCYTAMEMNLEVVPVLNKIDLPAADPERVAEEIEDIVGIEAADAVRCSAKTGVGVTDVIERLVRDIPPPEGDPDAPLQALIIDSWFDNYLGVVSLIRIKNGTLRKGDKIKVMSTGQVYNADRLGIFTPKQVDKEILRCGEAGWVVCAIKDILGAPVGDTLTGARAPADKPLPGFKKVKPQVYAGLFPVSSDDYEAFRDALGKLSLNDASLFYEPESSTALGFGFRCGFLGLLHMEIIQERLEREYDLDLITTAPTVVYEVETTSGEIVYVDSPSKLPPLNNIEELREPIAECHMLLPQQYLGNVITLCIEKRGVQTNMVYHGNQVALTYEIPMAEVVLDFFDRLKSTSRGYASLDYNFKRFQASDMVRVDILINSERVDALALITHRDNSMYRGRELVEKMKDLIPRQQFDIAIQAAIGMHIIARSTVKQLRKNVLAKCYGGDVSRKKKLLQKQKDGKKRMKQVGNVELPQEAFLAILHVGKD

Flanking regions ( +/- flanking 50bp)

ACAGGTGTCCAAAGCTAGTTTTATAGGGCATTACAAAGAAGAATTTTATCTTGAAAATCAACCATATCCGAAATTTTTCCATTATTGCTCATATCGATCACGGTAAATCTACTTTATCGGATCGCATTATTCAGATTTGCGGCGGTTTATCCGATCGTGAAATGGCGGCGCAGGTTCTGGATTCAATGGATCTGGAACGCGAACGCGGCATTACCATCAAAGCACAGAGCGTGACGCTGGATTACACCGCACAGAATGGTGAAACGTACCAGCTCAACTTTATCGATACCCCGGGACACGTTGACTTTTCTTATGAGGTCTCCCGTTCACTGGCTGCCTGTGAAGGGGCGCTGCTGGTGGTTGATGCGGGGCAGGGGGTTGAGGCGCAGACGCTGGCAAACTGCTATACAGCGATGGAAATGAACCTGGAAGTTGTCCCGGTTCTGAACAAAATTGACCTGCCTGCTGCCGACCCGGAGCGGGTGGCGGAAGAGATTGAAGACATCGTCGGGATTGAGGCGGCAGATGCTGTGCGCTGCTCGGCGAAAACCGGCGTGGGTGTGACCGATGTGATCGAACGCCTGGTGCGTGATATCCCGCCGCCGGAAGGTGACCCGGATGCGCCGTTACAGGCACTGATTATTGACTCCTGGTTTGATAACTATTTAGGGGTTGTGTCTCTGATCCGGATTAAAAACGGCACACTGCGCAAAGGCGACAAAATCAAAGTGATGAGCACCGGCCAGGTGTATAACGCCGATCGCCTCGGGATCTTCACACCAAAACAGGTCGATAAAGAGATCCTCAGATGCGGTGAGGCCGGCTGGGTGGTCTGTGCAATTAAAGACATTCTCGGGGCACCGGTCGGTGATACGTTAACCGGCGCACGCGCACCGGCGGATAAACCACTGCCGGGCTTTAAAAAAGTCAAACCGCAGGTCTATGCGGGTCTGTTCCCGGTCAGCTCTGACGACTATGAAGCCTTCCGTGATGCTCTGGGTAAACTGAGCCTCAACGATGCTTCCCTGTTCTATGAGCCGGAAAGCTCTACCGCACTGGGCTTCGGTTTCCGCTGCGGCTTCCTGGGTCTTCTGCATATGGAGATTATCCAGGAGCGTCTGGAGCGTGAATATGACCTCGATCTGATCACCACCGCGCCGACCGTTGTTTATGAAGTGGAAACCACCAGCGGTGAAATCGTCTATGTTGACAGCCCGTCCAAGCTGCCGCCGCTCAACAATATTGAAGAGCTGCGTGAGCCGATCGCGGAATGTCATATGCTGCTGCCGCAGCAGTACCTCGGTAACGTGATTACCCTGTGTATTGAGAAGCGCGGTGTGCAGACCAACATGGTGTATCACGGCAATCAGGTTGCTCTGACCTATGAAATTCCGATGGCGGAAGTGGTGCTCGATTTCTTCGATCGCCTGAAATCCACCTCACGCGGCTATGCATCACTGGATTATAACTTCAAACGTTTCCAGGCGTCTGACATGGTGCGTGTTGATATCCTTATCAACAGTGAGCGGGTTGACGCACTGGCACTGATCACCCACCGTGATAACTCCATGTACCGCGGCCGTGAGCTGGTGGAGAAGATGAAAGATCTGATCCCGCGTCAGCAGTTTGATATCGCGATCCAGGCTGCCATTGGTATGCATATTATTGCGCGTTCAACAGTGAAACAGCTGCGTAAAAACGTTCTGGCGAAATGCTACGGCGGTGACGTCAGCCGTAAGAAGAAACTGTTGCAGAAACAGAAAGACGGTAAGAAACGCATGAAGCAGGTCGGTAACGTTGAGTTACCACAGGAAGCGTTTTTAGCCATTCTCCATGTCGGCAAAGATTAATCATTCAGCAGGTTGTAAGGAGACATAATGGCGAACACCTTTGCGCTGAT