Homologs in group_635

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_01425 FBDBKF_01425 96.1 Morganella morganii S1 lepA translation elongation factor 4
EHELCC_00120 EHELCC_00120 96.1 Morganella morganii S2 lepA translation elongation factor 4
NLDBIP_03340 NLDBIP_03340 96.1 Morganella morganii S4 lepA translation elongation factor 4
LHKJJB_04855 LHKJJB_04855 96.1 Morganella morganii S3 lepA translation elongation factor 4
HKOGLL_02190 HKOGLL_02190 96.1 Morganella morganii S5 lepA translation elongation factor 4
PMI_RS09330 PMI_RS09330 89.3 Proteus mirabilis HI4320 lepA translation elongation factor 4

Distribution of the homologs in the orthogroup group_635

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_635

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
C6DC02 0 1131 91 0 598 3 lepA Elongation factor 4 Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q6D217 0 1129 91 0 598 3 lepA Elongation factor 4 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A8GI27 0 1126 91 0 597 3 lepA Elongation factor 4 Serratia proteamaculans (strain 568)
A4TKY0 0 1123 90 0 598 3 lepA Elongation factor 4 Yersinia pestis (strain Pestoides F)
A4WDE0 0 1123 92 0 597 3 lepA Elongation factor 4 Enterobacter sp. (strain 638)
B1JRC5 0 1121 90 0 598 3 lepA Elongation factor 4 Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q667U9 0 1121 90 0 598 3 lepA Elongation factor 4 Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CKE6 0 1121 90 0 598 3 lepA Elongation factor 4 Yersinia pestis bv. Antiqua (strain Nepal516)
A9R400 0 1121 90 0 598 3 lepA Elongation factor 4 Yersinia pestis bv. Antiqua (strain Angola)
Q8ZD74 0 1121 90 0 598 3 lepA Elongation factor 4 Yersinia pestis
B2KA49 0 1121 90 0 598 3 lepA Elongation factor 4 Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C557 0 1121 90 0 598 3 lepA Elongation factor 4 Yersinia pestis bv. Antiqua (strain Antiqua)
A7FFT7 0 1121 90 0 598 3 lepA Elongation factor 4 Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A6TCI3 0 1120 91 0 597 3 lepA Elongation factor 4 Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
A7MH13 0 1118 91 0 597 3 lepA Elongation factor 4 Cronobacter sakazakii (strain ATCC BAA-894)
Q3YYU7 0 1117 91 0 598 3 lepA Elongation factor 4 Shigella sonnei (strain Ss046)
B5XNG8 0 1117 91 0 597 3 lepA Elongation factor 4 Klebsiella pneumoniae (strain 342)
Q7N1X3 0 1111 91 0 598 3 lepA Elongation factor 4 Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A1JKK1 0 1110 91 0 598 3 lepA Elongation factor 4 Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
C0PYG5 0 1105 92 0 598 3 lepA Elongation factor 4 Salmonella paratyphi C (strain RKS4594)
P0A1W4 0 1104 92 0 598 3 lepA Elongation factor 4 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A1W5 0 1104 92 0 598 3 lepA Elongation factor 4 Salmonella typhi
B4TS16 0 1104 92 0 598 3 lepA Elongation factor 4 Salmonella schwarzengrund (strain CVM19633)
B4T1G0 0 1104 92 0 598 3 lepA Elongation factor 4 Salmonella newport (strain SL254)
B4TE17 0 1104 92 0 598 3 lepA Elongation factor 4 Salmonella heidelberg (strain SL476)
B5QTV0 0 1104 92 0 598 3 lepA Elongation factor 4 Salmonella enteritidis PT4 (strain P125109)
B5FRC7 0 1104 92 0 598 3 lepA Elongation factor 4 Salmonella dublin (strain CT_02021853)
Q57LC8 0 1104 92 0 598 3 lepA Elongation factor 4 Salmonella choleraesuis (strain SC-B67)
B5F1G3 0 1104 92 0 598 3 lepA Elongation factor 4 Salmonella agona (strain SL483)
B5RD51 0 1102 92 0 598 3 lepA Elongation factor 4 Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5BAS8 0 1101 92 0 598 3 lepA Elongation factor 4 Salmonella paratyphi A (strain AKU_12601)
Q5PNC0 0 1101 92 0 598 3 lepA Elongation factor 4 Salmonella paratyphi A (strain ATCC 9150 / SARB42)
C5BAI0 0 1101 89 0 597 3 lepA Elongation factor 4 Edwardsiella ictaluri (strain 93-146)
A9MGX5 0 1097 91 0 598 3 lepA Elongation factor 4 Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B2VI44 0 1097 91 0 598 3 lepA Elongation factor 4 Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
P60788 0 1097 91 0 598 3 lepA Elongation factor 4 Shigella flexneri
Q0T1T6 0 1097 91 0 598 3 lepA Elongation factor 4 Shigella flexneri serotype 5b (strain 8401)
Q31XR8 0 1097 91 0 598 3 lepA Elongation factor 4 Shigella boydii serotype 4 (strain Sb227)
B2TYI0 0 1097 91 0 598 3 lepA Elongation factor 4 Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B7LUZ5 0 1097 91 0 598 3 lepA Elongation factor 4 Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B1LP82 0 1097 91 0 598 3 lepA Elongation factor 4 Escherichia coli (strain SMS-3-5 / SECEC)
B7N6F7 0 1097 91 0 598 3 lepA Elongation factor 4 Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P60785 0 1097 91 0 598 1 lepA Elongation factor 4 Escherichia coli (strain K12)
B1IVQ8 0 1097 91 0 598 3 lepA Elongation factor 4 Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P60786 0 1097 91 0 598 3 lepA Elongation factor 4 Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TER9 0 1097 91 0 598 3 lepA Elongation factor 4 Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A8A379 0 1097 91 0 598 3 lepA Elongation factor 4 Escherichia coli O9:H4 (strain HS)
B1XB43 0 1097 91 0 598 3 lepA Elongation factor 4 Escherichia coli (strain K12 / DH10B)
C4ZYJ2 0 1097 91 0 598 3 lepA Elongation factor 4 Escherichia coli (strain K12 / MC4100 / BW2952)
B7NRM2 0 1097 91 0 598 3 lepA Elongation factor 4 Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5Z143 0 1097 91 0 598 3 lepA Elongation factor 4 Escherichia coli O157:H7 (strain EC4115 / EHEC)
P60787 0 1097 91 0 598 3 lepA Elongation factor 4 Escherichia coli O157:H7
B7LDG2 0 1097 91 0 598 3 lepA Elongation factor 4 Escherichia coli (strain 55989 / EAEC)
A7ZQ13 0 1097 91 0 598 3 lepA Elongation factor 4 Escherichia coli O139:H28 (strain E24377A / ETEC)
Q2NS11 0 1096 89 0 598 3 lepA Elongation factor 4 Sodalis glossinidius (strain morsitans)
Q32CV2 0 1095 91 0 598 3 lepA Elongation factor 4 Shigella dysenteriae serotype 1 (strain Sd197)
B7M8I2 0 1095 91 0 598 3 lepA Elongation factor 4 Escherichia coli O8 (strain IAI1)
Q1R8G3 0 1095 91 0 598 3 lepA Elongation factor 4 Escherichia coli (strain UTI89 / UPEC)
A1AE99 0 1095 91 0 598 3 lepA Elongation factor 4 Escherichia coli O1:K1 / APEC
B7MYK1 0 1095 91 0 598 3 lepA Elongation factor 4 Escherichia coli O81 (strain ED1a)
B7MIQ4 0 1095 91 0 598 3 lepA Elongation factor 4 Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UH09 0 1095 91 0 598 3 lepA Elongation factor 4 Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B6I5E3 0 1095 91 0 598 3 lepA Elongation factor 4 Escherichia coli (strain SE11)
B4F049 0 1092 89 0 597 3 lepA Elongation factor 4 Proteus mirabilis (strain HI4320)
Q65VN2 0 1092 88 0 598 3 lepA Elongation factor 4 Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
A8AD16 0 1092 91 0 598 3 lepA Elongation factor 4 Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
P57806 0 1087 88 0 597 3 lepA Elongation factor 4 Pasteurella multocida (strain Pm70)
B0USR9 0 1078 87 0 597 3 lepA Elongation factor 4 Histophilus somni (strain 2336)
Q0I4Z1 0 1078 87 0 597 3 lepA Elongation factor 4 Histophilus somni (strain 129Pt)
A5UFI9 0 1078 87 0 597 3 lepA Elongation factor 4 Haemophilus influenzae (strain PittGG)
A5UBC2 0 1078 87 0 597 3 lepA Elongation factor 4 Haemophilus influenzae (strain PittEE)
Q4QPM8 0 1078 87 0 597 3 lepA Elongation factor 4 Haemophilus influenzae (strain 86-028NP)
P43729 0 1078 87 0 597 3 lepA Elongation factor 4 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q7VL73 0 1076 87 0 597 3 lepA Elongation factor 4 Haemophilus ducreyi (strain 35000HP / ATCC 700724)
A6VLV6 0 1073 87 0 597 3 lepA Elongation factor 4 Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
C4LBZ6 0 1063 84 0 598 3 lepA Elongation factor 4 Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
C4K3Z1 0 1061 85 0 598 3 lepA Elongation factor 4 Hamiltonella defensa subsp. Acyrthosiphon pisum (strain 5AT)
A4SRD4 0 1058 84 0 597 3 lepA Elongation factor 4 Aeromonas salmonicida (strain A449)
A0KGF0 0 1058 84 0 597 3 lepA Elongation factor 4 Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
C3LR06 0 1047 85 0 597 3 lepA Elongation factor 4 Vibrio cholerae serotype O1 (strain M66-2)
Q9KPB0 0 1047 85 0 597 3 lepA Elongation factor 4 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F5G3 0 1047 85 0 597 3 lepA Elongation factor 4 Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
A7MZB0 0 1043 84 0 597 3 lepA Elongation factor 4 Vibrio campbellii (strain ATCC BAA-1116)
Q7MHN6 0 1041 85 0 597 3 lepA Elongation factor 4 Vibrio vulnificus (strain YJ016)
Q8DC78 0 1041 85 0 597 3 lepA Elongation factor 4 Vibrio vulnificus (strain CMCP6)
Q87LN7 0 1036 84 0 597 3 lepA Elongation factor 4 Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
B5FAH2 0 1036 83 0 597 3 lepA Elongation factor 4 Aliivibrio fischeri (strain MJ11)
Q5E312 0 1034 83 0 597 3 lepA Elongation factor 4 Aliivibrio fischeri (strain ATCC 700601 / ES114)
B6EKN1 0 1021 82 0 597 3 lepA Elongation factor 4 Aliivibrio salmonicida (strain LFI1238)
Q0HSI9 0 1019 81 0 596 3 lepA Elongation factor 4 Shewanella sp. (strain MR-7)
Q0HG96 0 1019 81 0 596 3 lepA Elongation factor 4 Shewanella sp. (strain MR-4)
A0KZN4 0 1019 81 0 596 3 lepA Elongation factor 4 Shewanella sp. (strain ANA-3)
B7VK81 0 1016 82 0 597 3 lepA Elongation factor 4 Vibrio atlanticus (strain LGP32)
Q8EH83 0 1012 80 0 596 3 lepA Elongation factor 4 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
A1RMC9 0 1011 80 0 596 3 lepA Elongation factor 4 Shewanella sp. (strain W3-18-1)
A4Y4K2 0 1009 80 0 596 3 lepA Elongation factor 4 Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
A9L5N4 0 1006 80 0 596 3 lepA Elongation factor 4 Shewanella baltica (strain OS195)
A6WKQ5 0 1006 80 0 596 3 lepA Elongation factor 4 Shewanella baltica (strain OS185)
A3D1V4 0 1006 80 0 596 3 lepA Elongation factor 4 Shewanella baltica (strain OS155 / ATCC BAA-1091)
B8EBQ4 0 1006 80 0 596 3 lepA Elongation factor 4 Shewanella baltica (strain OS223)
A8FSD4 0 1005 79 0 594 3 lepA Elongation factor 4 Shewanella sediminis (strain HAW-EB3)
Q07YZ4 0 1003 80 0 592 3 lepA Elongation factor 4 Shewanella frigidimarina (strain NCIMB 400)
Q6LMS0 0 1002 82 0 596 3 lepA Elongation factor 4 Photobacterium profundum (strain SS9)
Q12KH9 0 1001 80 0 592 3 lepA Elongation factor 4 Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
A3QBS5 0 1000 81 0 596 3 lepA Elongation factor 4 Shewanella loihica (strain ATCC BAA-1088 / PV-4)
B4RVA8 0 998 80 0 595 3 lepA Elongation factor 4 Alteromonas mediterranea (strain DSM 17117 / CIP 110805 / LMG 28347 / Deep ecotype)
B1KI55 0 998 79 0 594 3 lepA Elongation factor 4 Shewanella woodyi (strain ATCC 51908 / MS32)
Q15R31 0 996 80 0 594 3 lepA Elongation factor 4 Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
A1S3X9 0 984 80 0 596 3 lepA Elongation factor 4 Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
B0TIV5 0 981 80 0 594 3 lepA Elongation factor 4 Shewanella halifaxensis (strain HAW-EB4)
A1SSM6 0 981 79 0 597 3 lepA Elongation factor 4 Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
B8CQJ7 0 979 80 0 592 3 lepA Elongation factor 4 Shewanella piezotolerans (strain WP3 / JCM 13877)
A8H1C5 0 976 79 0 594 3 lepA Elongation factor 4 Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
Q3IDL4 0 966 77 0 596 3 lepA Elongation factor 4 Pseudoalteromonas translucida (strain TAC 125)
Q47WP3 0 953 76 0 592 3 lepA Elongation factor 4 Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q21IH3 0 945 75 0 594 3 lepA Elongation factor 4 Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q9I5G8 0 945 75 0 594 3 lepA Elongation factor 4 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02HR9 0 945 75 0 594 3 lepA Elongation factor 4 Pseudomonas aeruginosa (strain UCBPP-PA14)
B7UYX5 0 945 75 0 594 3 lepA Elongation factor 4 Pseudomonas aeruginosa (strain LESB58)
A6VAK9 0 945 75 0 594 3 lepA Elongation factor 4 Pseudomonas aeruginosa (strain PA7)
Q1LTI1 0 940 75 0 596 3 lepA Elongation factor 4 Baumannia cicadellinicola subsp. Homalodisca coagulata
Q5R104 0 937 77 0 595 3 lepA Elongation factor 4 Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
C5BRN3 0 936 74 0 594 3 lepA Elongation factor 4 Teredinibacter turnerae (strain ATCC 39867 / T7901)
A4VIX2 0 935 74 0 594 3 lepA Elongation factor 4 Stutzerimonas stutzeri (strain A1501)
Q5ZUD2 0 932 73 0 596 3 lepA Elongation factor 4 Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
A5ID24 0 932 73 0 596 3 lepA Elongation factor 4 Legionella pneumophila (strain Corby)
Q5X443 0 932 73 0 596 3 lepA Elongation factor 4 Legionella pneumophila (strain Paris)
Q5WVI1 0 932 73 0 596 3 lepA Elongation factor 4 Legionella pneumophila (strain Lens)
Q3KHM1 0 931 73 0 594 3 lepA Elongation factor 4 Pseudomonas fluorescens (strain Pf0-1)
Q4KHT3 0 930 73 0 594 3 lepA Elongation factor 4 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q87XF8 0 929 73 0 594 3 lepA Elongation factor 4 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
C3K6G8 0 928 73 0 594 3 lepA Elongation factor 4 Pseudomonas fluorescens (strain SBW25)
A5W8F4 0 927 73 0 594 3 lepA Elongation factor 4 Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q88MY7 0 927 73 0 594 3 lepA Elongation factor 4 Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
B0KV29 0 926 73 0 594 3 lepA Elongation factor 4 Pseudomonas putida (strain GB-1)
Q1I5V6 0 925 73 0 594 3 lepA Elongation factor 4 Pseudomonas entomophila (strain L48)
A1U2V8 0 924 75 1 595 3 lepA Elongation factor 4 Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
B3PLG4 0 924 73 0 594 3 lepA Elongation factor 4 Cellvibrio japonicus (strain Ueda107)
Q48EV0 0 924 73 0 594 3 lepA Elongation factor 4 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
A4XSC1 0 923 73 0 594 3 lepA Elongation factor 4 Pseudomonas mendocina (strain ymp)
C1DQS0 0 922 73 0 594 3 lepA Elongation factor 4 Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
B1J4D8 0 920 73 0 594 3 lepA Elongation factor 4 Pseudomonas putida (strain W619)
Q4ZPD8 0 919 72 0 594 3 lepA Elongation factor 4 Pseudomonas syringae pv. syringae (strain B728a)
Q2SL35 0 918 74 0 596 3 lepA Elongation factor 4 Hahella chejuensis (strain KCTC 2396)
Q6F9B9 0 912 74 0 594 3 lepA Elongation factor 4 Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q3J8D2 0 905 70 0 596 3 lepA Elongation factor 4 Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
A9KF98 0 904 72 0 591 3 lepA Elongation factor 4 Coxiella burnetii (strain Dugway 5J108-111)
Q83BK3 0 904 72 0 591 3 lepA Elongation factor 4 Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
A9N944 0 904 72 0 591 3 lepA Elongation factor 4 Coxiella burnetii (strain RSA 331 / Henzerling II)
B2SZV7 0 901 70 0 594 3 lepA Elongation factor 4 Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
Q1QX26 0 900 71 1 595 3 lepA Elongation factor 4 Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q13VM6 0 900 70 0 594 3 lepA Elongation factor 4 Paraburkholderia xenovorans (strain LB400)
Q0VP16 0 900 73 0 594 3 lepA Elongation factor 4 Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q0A8Z4 0 900 70 0 594 3 lepA Elongation factor 4 Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q4FUV9 0 896 71 0 594 3 lepA Elongation factor 4 Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q39I75 0 896 70 0 594 3 lepA Elongation factor 4 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
B8D7F7 0 896 70 0 593 3 lepA Elongation factor 4 Buchnera aphidicola subsp. Acyrthosiphon pisum (strain Tuc7)
B8D953 0 896 70 0 593 3 lepA Elongation factor 4 Buchnera aphidicola subsp. Acyrthosiphon pisum (strain 5A)
B0VCT7 0 895 72 0 594 3 lepA Elongation factor 4 Acinetobacter baumannii (strain AYE)
A3M7P5 0 895 72 0 594 3 lepA Elongation factor 4 Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
B2HWQ2 0 895 72 0 594 3 lepA Elongation factor 4 Acinetobacter baumannii (strain ACICU)
B7I580 0 895 72 0 594 3 lepA Elongation factor 4 Acinetobacter baumannii (strain AB0057)
B7GYS7 0 895 72 0 594 3 lepA Elongation factor 4 Acinetobacter baumannii (strain AB307-0294)
Q1QDV6 0 895 71 0 594 3 lepA Elongation factor 4 Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
P57348 0 895 70 0 593 3 lepA Elongation factor 4 Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q2Y873 0 893 69 0 596 3 lepA Elongation factor 4 Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
A6SXR0 0 892 69 0 594 3 lepA Elongation factor 4 Janthinobacterium sp. (strain Marseille)
B0VTM2 0 891 72 0 594 3 lepA Elongation factor 4 Acinetobacter baumannii (strain SDF)
A0Q453 0 890 71 0 592 3 lepA Elongation factor 4 Francisella tularensis subsp. novicida (strain U112)
A4G6S1 0 885 70 0 594 3 lepA Elongation factor 4 Herminiimonas arsenicoxydans
Q8K9Q9 0 885 70 0 597 3 lepA Elongation factor 4 Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
C1D7L2 0 884 69 0 594 3 lepA Elongation factor 4 Laribacter hongkongensis (strain HLHK9)
Q1BXU3 0 884 70 0 594 3 lepA Elongation factor 4 Burkholderia orbicola (strain AU 1054)
B1JYB1 0 884 70 0 594 3 lepA Elongation factor 4 Burkholderia orbicola (strain MC0-3)
A0K5V7 0 884 70 0 594 3 lepA Elongation factor 4 Burkholderia cenocepacia (strain HI2424)
Q63S94 0 882 70 0 594 3 lepA Elongation factor 4 Burkholderia pseudomallei (strain K96243)
A3NBT1 0 882 70 0 594 3 lepA Elongation factor 4 Burkholderia pseudomallei (strain 668)
Q3JQ75 0 882 70 0 594 3 lepA Elongation factor 4 Burkholderia pseudomallei (strain 1710b)
A3NXL8 0 882 70 0 594 3 lepA Elongation factor 4 Burkholderia pseudomallei (strain 1106a)
A1V6B9 0 882 70 0 594 3 lepA Elongation factor 4 Burkholderia mallei (strain SAVP1)
Q62LT1 0 882 70 0 594 3 lepA Elongation factor 4 Burkholderia mallei (strain ATCC 23344)
A2S9Z3 0 882 70 0 594 3 lepA Elongation factor 4 Burkholderia mallei (strain NCTC 10229)
A3MM44 0 882 70 0 594 3 lepA Elongation factor 4 Burkholderia mallei (strain NCTC 10247)
Q608M4 0 881 71 0 597 3 lepA Elongation factor 4 Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q2SXT6 0 881 70 0 594 3 lepA Elongation factor 4 Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
A5WCD6 0 880 69 0 594 3 lepA Elongation factor 4 Psychrobacter sp. (strain PRwf-1)
A4JCQ9 0 880 70 0 594 3 lepA Elongation factor 4 Burkholderia vietnamiensis (strain G4 / LMG 22486)
Q5NEF8 0 879 71 0 592 3 lepA Elongation factor 4 Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q14FW1 0 879 71 0 592 3 lepA Elongation factor 4 Francisella tularensis subsp. tularensis (strain FSC 198)
A4J080 0 879 71 0 592 3 lepA Elongation factor 4 Francisella tularensis subsp. tularensis (strain WY96-3418)
B2SEJ6 0 879 71 0 592 3 lepA Elongation factor 4 Francisella tularensis subsp. mediasiatica (strain FSC147)
A9ADE0 0 879 70 0 594 3 lepA Elongation factor 4 Burkholderia multivorans (strain ATCC 17616 / 249)
Q0BP65 0 878 71 0 592 3 lepA Elongation factor 4 Francisella tularensis subsp. holarctica (strain OSU18)
Q2A5X6 0 878 71 0 592 3 lepA Elongation factor 4 Francisella tularensis subsp. holarctica (strain LVS)
A7N9A4 0 878 71 0 592 3 lepA Elongation factor 4 Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
Q0BH06 0 878 69 0 594 3 lepA Elongation factor 4 Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
B1YVM2 0 878 69 0 594 3 lepA Elongation factor 4 Burkholderia ambifaria (strain MC40-6)
B3R202 0 877 69 0 594 3 lepA Elongation factor 4 Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
Q3SH47 0 876 70 0 590 3 lepA Elongation factor 4 Thiobacillus denitrificans (strain ATCC 25259)
B0TW33 0 874 72 0 592 3 lepA Elongation factor 4 Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
B2JFK0 0 874 69 0 594 3 lepA Elongation factor 4 Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
Q1H2L5 0 872 69 0 594 3 lepA1 Elongation factor 4 Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
A1KT27 0 870 68 0 594 3 lepA Elongation factor 4 Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
A9M3J8 0 869 68 0 594 3 lepA Elongation factor 4 Neisseria meningitidis serogroup C (strain 053442)
Q0K8N0 0 869 69 0 594 3 lepA Elongation factor 4 Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q9K055 0 869 68 0 594 3 lepA Elongation factor 4 Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9JV65 0 869 68 0 594 3 lepA Elongation factor 4 Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
B4RK41 0 868 68 0 594 3 lepA Elongation factor 4 Neisseria gonorrhoeae (strain NCCP11945)
Q5F9P9 0 868 68 0 594 3 lepA Elongation factor 4 Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q46Z15 0 866 69 0 594 3 lepA Elongation factor 4 Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q1LKM8 0 863 69 0 594 3 lepA Elongation factor 4 Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
A1AWP9 0 863 67 0 594 3 lepA Elongation factor 4 Ruthia magnifica subsp. Calyptogena magnifica
B1XTL2 0 860 66 1 599 3 lepA Elongation factor 4 Polynucleobacter necessarius subsp. necessarius (strain STIR1)
Q0AF67 0 857 67 0 594 3 lepA Elongation factor 4 Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q7NWC7 0 857 69 0 595 3 lepA Elongation factor 4 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q47EG0 0 856 68 0 594 3 lepA Elongation factor 4 Dechloromonas aromatica (strain RCB)
P56865 0 855 66 0 594 3 lepA Elongation factor 4 Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7W5J4 0 854 66 0 594 3 lepA Elongation factor 4 Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WD30 0 854 66 0 594 3 lepA Elongation factor 4 Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q492C9 0 854 65 0 597 3 lepA Elongation factor 4 Blochmanniella pennsylvanica (strain BPEN)
Q820H8 0 848 68 0 594 3 lepA Elongation factor 4 Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
B4SRL3 0 847 69 0 594 3 lepA Elongation factor 4 Stenotrophomonas maltophilia (strain R551-3)
A9III9 0 846 65 0 594 3 lepA Elongation factor 4 Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
Q2KWY3 0 845 65 0 594 3 lepA Elongation factor 4 Bordetella avium (strain 197N)
B1XZN0 0 844 66 1 600 3 lepA Elongation factor 4 Leptothrix cholodnii (strain ATCC 51168 / LMG 8142 / SP-6)
Q8Y0I4 0 844 68 1 595 3 lepA Elongation factor 4 Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
B2FQC4 0 842 69 0 594 3 lepA Elongation factor 4 Stenotrophomonas maltophilia (strain K279a)
B2U978 0 842 69 2 596 3 lepA Elongation factor 4 Ralstonia pickettii (strain 12J)
A2SDH0 0 842 65 2 602 3 lepA Elongation factor 4 Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
Q8PB55 0 840 69 0 596 3 lepA Elongation factor 4 Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
A9BNJ8 0 840 65 1 600 3 lepA Elongation factor 4 Delftia acidovorans (strain DSM 14801 / SPH-1)
Q3BVV9 0 839 68 0 596 3 lepA Elongation factor 4 Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
A4SVW0 0 838 66 1 599 3 lepA Elongation factor 4 Polynucleobacter asymbioticus (strain DSM 18221 / CIP 109841 / QLW-P1DMWA-1)
Q8PMV3 0 838 68 0 596 3 lepA Elongation factor 4 Xanthomonas axonopodis pv. citri (strain 306)
B0RX30 0 838 69 0 596 3 lepA Elongation factor 4 Xanthomonas campestris pv. campestris (strain B100)
Q4USF4 0 838 69 0 596 3 lepA Elongation factor 4 Xanthomonas campestris pv. campestris (strain 8004)
Q126K0 0 838 65 1 601 3 lepA Elongation factor 4 Polaromonas sp. (strain JS666 / ATCC BAA-500)
B9MDP9 0 837 65 1 600 3 lepA Elongation factor 4 Acidovorax ebreus (strain TPSY)
A1TLE7 0 836 64 1 600 3 lepA Elongation factor 4 Paracidovorax citrulli (strain AAC00-1)
Q5P089 0 836 67 0 594 3 lepA Elongation factor 4 Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
Q5H1R5 0 835 68 0 596 3 lepA Elongation factor 4 Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q2P4M4 0 835 68 0 596 3 lepA Elongation factor 4 Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
B2SRY0 0 834 68 0 596 3 lepA Elongation factor 4 Xanthomonas oryzae pv. oryzae (strain PXO99A)
A1VRT5 0 834 65 1 601 3 lepA Elongation factor 4 Polaromonas naphthalenivorans (strain CJ2)
A1WAW8 0 833 64 1 600 3 lepA Elongation factor 4 Acidovorax sp. (strain JS42)
B5EQB5 0 832 65 0 595 3 lepA Elongation factor 4 Acidithiobacillus ferrooxidans (strain ATCC 53993 / BNL-5-31)
B7J9J8 0 832 65 0 595 3 lepA Elongation factor 4 Acidithiobacillus ferrooxidans (strain ATCC 23270 / DSM 14882 / CIP 104768 / NCIMB 8455)
C5CSF2 0 832 64 1 601 3 lepA Elongation factor 4 Variovorax paradoxus (strain S110)
A5CWJ4 0 831 66 0 594 3 lepA Elongation factor 4 Vesicomyosocius okutanii subsp. Calyptogena okutanii (strain HA)
Q31HP5 0 828 69 2 599 3 lepA Elongation factor 4 Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
A1K601 0 828 67 0 594 3 lepA Elongation factor 4 Azoarcus sp. (strain BH72)
A1WMW4 0 827 63 1 600 3 lepA Elongation factor 4 Verminephrobacter eiseniae (strain EF01-2)
Q9PBA1 0 826 68 0 594 3 lepA Elongation factor 4 Xylella fastidiosa (strain 9a5c)
B0U3D5 0 826 67 0 594 3 lepA Elongation factor 4 Xylella fastidiosa (strain M12)
Q87C09 0 824 67 0 594 3 lepA Elongation factor 4 Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I601 0 824 67 0 594 3 lepA Elongation factor 4 Xylella fastidiosa (strain M23)
Q89AM5 0 820 63 0 593 3 lepA Elongation factor 4 Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q21XN4 0 817 63 1 601 3 lepA Elongation factor 4 Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q7VRQ8 0 815 64 2 596 3 lepA Elongation factor 4 Blochmanniella floridana
A0L631 0 787 62 1 595 3 lepA Elongation factor 4 Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
P60789 0 781 62 1 595 3 lepA Elongation factor 4 Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q2W0F9 0 778 61 0 595 3 lepA Elongation factor 4 Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q2RKX8 0 778 61 1 596 3 lepA Elongation factor 4 Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
B0TAD2 0 777 60 3 597 3 lepA Elongation factor 4 Heliobacterium modesticaldum (strain ATCC 51547 / Ice1)
Q3A445 0 775 62 1 594 3 lepA Elongation factor 4 Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
Q1D6M1 0 774 60 1 593 3 lepA Elongation factor 4 Myxococcus xanthus (strain DK1622)
Q39US7 0 773 62 1 595 3 lepA Elongation factor 4 Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
A4J7F8 0 772 61 1 594 3 lepA Elongation factor 4 Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
B9M4U5 0 772 61 1 595 3 lepA Elongation factor 4 Geotalea daltonii (strain DSM 22248 / JCM 15807 / FRC-32)
A5G4G3 0 771 61 1 595 3 lepA Elongation factor 4 Geotalea uraniireducens (strain Rf4)
B3E9R0 0 771 62 1 595 3 lepA Elongation factor 4 Trichlorobacter lovleyi (strain ATCC BAA-1151 / DSM 17278 / SZ)
C1F2I3 0 769 61 1 598 3 lepA Elongation factor 4 Acidobacterium capsulatum (strain ATCC 51196 / DSM 11244 / BCRC 80197 / JCM 7670 / NBRC 15755 / NCIMB 13165 / 161)
Q24SR6 0 764 59 1 592 3 lepA Elongation factor 4 Desulfitobacterium hafniense (strain Y51)
B8FUP2 0 764 59 1 592 3 lepA Elongation factor 4 Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
A1ARG8 0 764 62 1 595 3 lepA Elongation factor 4 Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
Q5FUC2 0 760 60 0 594 3 lepA Elongation factor 4 Gluconobacter oxydans (strain 621H)
B5EB36 0 759 60 1 595 3 lepA Elongation factor 4 Citrifermentans bemidjiense (strain ATCC BAA-1014 / DSM 16622 / JCM 12645 / Bem)
A5D3X6 0 759 61 1 595 3 lepA Elongation factor 4 Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
Q8D307 0 757 58 0 597 3 lepA Elongation factor 4 Wigglesworthia glossinidia brevipalpis
Q0BRZ7 0 757 59 0 594 3 lepA Elongation factor 4 Granulibacter bethesdensis (strain ATCC BAA-1260 / CGDNIH1)
Q5WHG5 0 756 58 1 594 3 lepA Elongation factor 4 Shouchella clausii (strain KSM-K16)
A9HG78 0 756 60 0 594 3 lepA Elongation factor 4 Gluconacetobacter diazotrophicus (strain ATCC 49037 / DSM 5601 / CCUG 37298 / CIP 103539 / LMG 7603 / PAl5)
Q65H50 0 756 58 1 594 3 lepA Elongation factor 4 Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
A8FFD6 0 755 58 1 594 3 lepA Elongation factor 4 Bacillus pumilus (strain SAFR-032)
C6DZ67 0 755 60 1 595 3 lepA Elongation factor 4 Geobacter sp. (strain M21)
Q89BJ8 0 755 59 1 596 3 lepA Elongation factor 4 Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q2IIA6 0 754 59 1 594 3 lepA Elongation factor 4 Anaeromyxobacter dehalogenans (strain 2CP-C)
A5FY07 0 754 60 0 591 3 lepA Elongation factor 4 Acidiphilium cryptum (strain JF-5)
Q8UIQ2 0 753 59 1 596 3 lepA Elongation factor 4 Agrobacterium fabrum (strain C58 / ATCC 33970)
B9DSE0 0 753 58 1 596 3 lepA Elongation factor 4 Streptococcus uberis (strain ATCC BAA-854 / 0140J)
P37949 0 753 57 1 594 3 lepA Elongation factor 4 Bacillus subtilis (strain 168)
A7GT14 0 753 57 1 597 3 lepA Elongation factor 4 Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
B8JAF3 0 753 59 1 594 3 lepA Elongation factor 4 Anaeromyxobacter dehalogenans (strain 2CP-1 / ATCC BAA-258)
A7Z6W5 0 752 58 1 594 3 lepA Elongation factor 4 Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
Q8FV17 0 752 59 1 598 3 lepA Elongation factor 4 Brucella suis biovar 1 (strain 1330)
A9WW49 0 752 59 1 598 3 lepA Elongation factor 4 Brucella suis (strain ATCC 23445 / NCTC 10510)
A5VVU4 0 752 59 1 598 3 lepA Elongation factor 4 Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
A9MCW5 0 752 59 1 598 3 lepA Elongation factor 4 Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
A7IEG8 0 751 59 0 593 3 lepA Elongation factor 4 Xanthobacter autotrophicus (strain ATCC BAA-1158 / Py2)
Q9KD76 0 751 58 1 594 3 lepA Elongation factor 4 Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q5KWZ3 0 751 58 1 593 3 lepA Elongation factor 4 Geobacillus kaustophilus (strain HTA426)
B4UDQ7 0 751 59 1 594 3 lepA Elongation factor 4 Anaeromyxobacter sp. (strain K)
Q3AF13 0 751 61 1 592 3 lepA Elongation factor 4 Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
B7IYH2 0 751 57 1 594 3 lepA Elongation factor 4 Bacillus cereus (strain G9842)
Q3SVT1 0 750 59 1 594 3 lepA Elongation factor 4 Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
Q8YDB8 0 750 59 1 598 3 lepA Elongation factor 4 Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
C0RMH8 0 750 59 1 598 3 lepA Elongation factor 4 Brucella melitensis biotype 2 (strain ATCC 23457)
A7HCF3 0 750 59 1 593 3 lepA Elongation factor 4 Anaeromyxobacter sp. (strain Fw109-5)
Q576S5 0 749 59 1 598 3 lepA Elongation factor 4 Brucella abortus biovar 1 (strain 9-941)
Q2YJP8 0 749 59 1 598 3 lepA Elongation factor 4 Brucella abortus (strain 2308)
B2SC25 0 749 59 1 598 3 lepA Elongation factor 4 Brucella abortus (strain S19)
Q730L6 0 749 57 1 594 3 lepA Elongation factor 4 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q5XCD2 0 749 58 1 595 3 lepA Elongation factor 4 Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q1IV51 0 749 60 1 598 3 lepA Elongation factor 4 Koribacter versatilis (strain Ellin345)
B7GKC4 0 749 58 1 594 3 lepA Elongation factor 4 Anoxybacillus flavithermus (strain DSM 21510 / WK1)
A6WYK4 0 748 59 1 598 3 lepA Elongation factor 4 Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
B8H2Z7 0 748 60 0 597 3 lepA Elongation factor 4 Caulobacter vibrioides (strain NA1000 / CB15N)
Q9A9F4 0 748 60 0 597 3 lepA Elongation factor 4 Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q1JH37 0 747 58 1 595 3 lepA Elongation factor 4 Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q8DTF3 0 747 58 1 596 3 lepA Elongation factor 4 Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
B6IUG3 0 747 60 0 597 3 lepA Elongation factor 4 Rhodospirillum centenum (strain ATCC 51521 / SW)
B8DIZ5 0 747 60 1 596 3 lepA Elongation factor 4 Nitratidesulfovibrio vulgaris (strain DSM 19637 / Miyazaki F)
B0JQT7 0 747 58 1 595 3 lepA Elongation factor 4 Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
B9IY86 0 746 57 1 594 3 lepA Elongation factor 4 Bacillus cereus (strain Q1)
B7HPL8 0 746 57 1 594 3 lepA Elongation factor 4 Bacillus cereus (strain AH187)
B7JNV1 0 746 57 1 594 3 lepA Elongation factor 4 Bacillus cereus (strain AH820)
Q48TU0 0 746 58 1 595 3 lepA Elongation factor 4 Streptococcus pyogenes serotype M28 (strain MGAS6180)
Q1JLY8 0 746 58 1 595 3 lepA Elongation factor 4 Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q99ZV8 0 746 58 1 596 3 lepA Elongation factor 4 Streptococcus pyogenes serotype M1
Q1QR19 0 746 59 1 594 3 lepA Elongation factor 4 Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
P60930 0 746 59 1 594 3 lepA Elongation factor 4 Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
Q03KW7 0 746 58 1 595 3 lepA Elongation factor 4 Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q5M4M2 0 746 58 1 595 3 lepA Elongation factor 4 Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q5M008 0 746 58 1 595 3 lepA Elongation factor 4 Streptococcus thermophilus (strain CNRZ 1066)
Q01SV7 0 746 58 1 596 3 lepA Elongation factor 4 Solibacter usitatus (strain Ellin6076)
Q92SU3 0 746 59 1 596 3 lepA Elongation factor 4 Rhizobium meliloti (strain 1021)
Q2KDL5 0 746 58 1 599 3 lepA Elongation factor 4 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
B7HCU5 0 746 57 1 594 3 lepA Elongation factor 4 Bacillus cereus (strain B4264)
P0DC23 0 745 58 1 595 3 lepA Elongation factor 4 Streptococcus pyogenes serotype M3 (strain SSI-1)
P0DC22 0 745 58 1 595 3 lepA Elongation factor 4 Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
B1YKS5 0 745 57 1 595 3 lepA Elongation factor 4 Exiguobacterium sibiricum (strain DSM 17290 / CCUG 55495 / CIP 109462 / JCM 13490 / 255-15)
B8J444 0 745 60 1 596 3 lepA Elongation factor 4 Desulfovibrio desulfuricans (strain ATCC 27774 / DSM 6949 / MB)
Q81LR7 0 745 57 1 594 3 lepA Elongation factor 4 Bacillus anthracis
C3L5S2 0 745 57 1 594 3 lepA Elongation factor 4 Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3P8M5 0 745 57 1 594 3 lepA Elongation factor 4 Bacillus anthracis (strain A0248)
P65274 0 744 58 1 596 3 lepA Elongation factor 4 Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
P65273 0 744 58 1 596 3 lepA Elongation factor 4 Streptococcus agalactiae serotype III (strain NEM316)
Q3K1F9 0 744 58 1 596 3 lepA Elongation factor 4 Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q6HDK2 0 744 57 1 594 3 lepA Elongation factor 4 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q634M2 0 744 57 1 594 3 lepA Elongation factor 4 Bacillus cereus (strain ZK / E33L)
C1ESL3 0 744 57 1 594 3 lepA Elongation factor 4 Bacillus cereus (strain 03BB102)
A0RIT7 0 744 57 1 594 3 lepA Elongation factor 4 Bacillus thuringiensis (strain Al Hakam)
C4L433 0 744 57 1 595 3 lepA Elongation factor 4 Exiguobacterium sp. (strain ATCC BAA-1283 / AT1b)
Q0ATE3 0 744 59 1 592 3 lepA Elongation factor 4 Maricaulis maris (strain MCS10)
B5XLC6 0 743 58 1 596 3 lepA Elongation factor 4 Streptococcus pyogenes serotype M49 (strain NZ131)
Q8Y742 0 743 58 1 592 3 lepA Elongation factor 4 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
B8DE32 0 743 58 1 592 3 lepA Elongation factor 4 Listeria monocytogenes serotype 4a (strain HCC23)
Q71ZJ1 0 743 58 1 592 3 lepA Elongation factor 4 Listeria monocytogenes serotype 4b (strain F2365)
C1KVC6 0 743 58 1 592 3 lepA Elongation factor 4 Listeria monocytogenes serotype 4b (strain CLIP80459)
Q818E4 0 743 57 1 594 3 lepA Elongation factor 4 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q1JC06 0 743 58 1 590 3 lepA Elongation factor 4 Streptococcus pyogenes serotype M12 (strain MGAS2096)
B8ENL1 0 743 59 0 594 3 lepA Elongation factor 4 Methylocella silvestris (strain DSM 15510 / CIP 108128 / LMG 27833 / NCIMB 13906 / BL2)
A5VB59 0 742 58 1 603 3 lepA Elongation factor 4 Rhizorhabdus wittichii (strain DSM 6014 / CCUG 31198 / JCM 15750 / NBRC 105917 / EY 4224 / RW1)
Q4UKS2 0 742 58 0 595 3 lepA Elongation factor 4 Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
B8IMT0 0 742 59 0 594 3 lepA Elongation factor 4 Methylobacterium nodulans (strain LMG 21967 / CNCM I-2342 / ORS 2060)
A4IR35 0 742 58 1 593 3 lepA Elongation factor 4 Geobacillus thermodenitrificans (strain NG80-2)
Q831Z0 0 742 57 1 592 3 lepA Elongation factor 4 Enterococcus faecalis (strain ATCC 700802 / V583)
A4VUL8 0 741 57 1 596 3 lepA Elongation factor 4 Streptococcus suis (strain 05ZYH33)
A4W0W0 0 741 57 1 596 3 lepA Elongation factor 4 Streptococcus suis (strain 98HAH33)
A8GMT1 0 741 58 0 596 3 lepA Elongation factor 4 Rickettsia akari (strain Hartford)
B0UFE0 0 741 59 0 594 3 lepA Elongation factor 4 Methylobacterium sp. (strain 4-46)
B3PYC6 0 741 58 1 599 3 lepA Elongation factor 4 Rhizobium etli (strain CIAT 652)
A0AIS8 0 741 58 1 592 3 lepA Elongation factor 4 Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q11AY3 0 741 58 1 596 3 lepA Elongation factor 4 Chelativorans sp. (strain BNC1)
Q92BN4 0 740 58 1 592 3 lepA Elongation factor 4 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
A8GW16 0 740 58 0 595 3 lepA Elongation factor 4 Rickettsia bellii (strain OSU 85-389)
C3PMX3 0 739 58 1 600 3 lepA Elongation factor 4 Rickettsia africae (strain ESF-5)
B7KJX0 0 739 58 1 599 3 lepA Elongation factor 4 Gloeothece citriformis (strain PCC 7424)
Q6G1F5 0 739 58 1 596 3 lepA Elongation factor 4 Bartonella quintana (strain Toulouse)
Q6G550 0 739 58 1 596 3 lepA Elongation factor 4 Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
B5ZXQ5 0 739 58 1 599 3 lepA Elongation factor 4 Rhizobium leguminosarum bv. trifolii (strain WSM2304)
Q1MMQ8 0 738 58 1 599 3 lepA Elongation factor 4 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q2RNY6 0 737 58 1 598 3 lepA Elongation factor 4 Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
A8GRF6 0 737 58 1 600 3 lepA Elongation factor 4 Rickettsia rickettsii (strain Sheila Smith)
B0BWV5 0 737 58 1 600 3 lepA Elongation factor 4 Rickettsia rickettsii (strain Iowa)
C4K153 0 736 58 1 600 3 lepA Elongation factor 4 Rickettsia peacockii (strain Rustic)
A2RL76 0 736 56 1 595 3 lepA Elongation factor 4 Lactococcus lactis subsp. cremoris (strain MG1363)
Q9CGI8 0 736 56 1 595 3 lepA Elongation factor 4 Lactococcus lactis subsp. lactis (strain IL1403)
A9VHU6 0 736 56 1 594 3 lepA Elongation factor 4 Bacillus mycoides (strain KBAB4)
Q92IQ1 0 736 58 1 600 3 lepA Elongation factor 4 Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q0C5X0 0 736 58 1 597 3 lepA Elongation factor 4 Hyphomonas neptunium (strain ATCC 15444)
Q02Z80 0 736 56 1 595 3 lepA Elongation factor 4 Lactococcus lactis subsp. cremoris (strain SK11)
Q8RB72 0 736 58 1 595 3 lepA Elongation factor 4 Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q5NLP5 0 735 59 1 599 3 lepA Elongation factor 4 Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
B4U3G9 0 735 57 1 593 3 lepA Elongation factor 4 Streptococcus equi subsp. zooepidemicus (strain MGCS10565)
Q98DV1 0 735 58 1 596 3 lepA Elongation factor 4 Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
C0MDV7 0 734 57 1 593 3 lepA Elongation factor 4 Streptococcus equi subsp. zooepidemicus (strain H70)
Q1MQF3 0 734 58 1 596 3 lepA Elongation factor 4 Lawsonia intracellularis (strain PHE/MN1-00)
B1IC02 0 733 57 1 595 3 lepA Elongation factor 4 Streptococcus pneumoniae (strain Hungary19A-6)
A8AWG3 0 733 56 1 595 3 lepA Elongation factor 4 Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
Q49Y26 0 733 56 1 596 3 lepA Elongation factor 4 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q2JQ51 0 733 58 1 598 3 lepA Elongation factor 4 Synechococcus sp. (strain JA-2-3B'a(2-13))
B9DNK4 0 733 57 1 596 3 lepA Elongation factor 4 Staphylococcus carnosus (strain TM300)
Q16BA3 0 733 56 0 592 3 lepA Elongation factor 4 Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
B6JJT7 0 733 59 0 594 3 lepA Elongation factor 4 Afipia carboxidovorans (strain ATCC 49405 / DSM 1227 / KCTC 32145 / OM5)
A9GWZ4 0 732 57 1 592 3 lepA Elongation factor 4 Sorangium cellulosum (strain So ce56)
C0M8H9 0 732 56 1 593 3 lepA Elongation factor 4 Streptococcus equi subsp. equi (strain 4047)
B1I6E0 0 732 59 1 596 3 lepA Elongation factor 4 Desulforudis audaxviator (strain MP104C)
Q72E76 0 731 58 1 596 3 lepA Elongation factor 4 Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q8DM20 0 731 57 1 595 3 lepA Elongation factor 4 Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
C1CR98 0 731 56 1 595 3 lepA Elongation factor 4 Streptococcus pneumoniae (strain Taiwan19F-14)
Q8DPN5 0 731 56 1 595 3 lepA Elongation factor 4 Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
B8ZQ69 0 731 56 1 595 3 lepA Elongation factor 4 Streptococcus pneumoniae (strain ATCC 700669 / Spain 23F-1)
C1C7G9 0 731 56 1 595 3 lepA Elongation factor 4 Streptococcus pneumoniae (strain 70585)
B5E4T8 0 731 56 1 595 3 lepA Elongation factor 4 Streptococcus pneumoniae serotype 19F (strain G54)
Q04KB7 0 731 56 1 595 3 lepA Elongation factor 4 Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
A4XKA0 0 731 58 2 595 3 lepA Elongation factor 4 Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
Q1GRH5 0 730 59 1 603 3 lepA Elongation factor 4 Sphingopyxis alaskensis (strain DSM 13593 / LMG 18877 / RB2256)
Q2JWR1 0 729 57 1 598 3 lepA Elongation factor 4 Synechococcus sp. (strain JA-3-3Ab)
C1CKU6 0 729 56 1 595 3 lepA Elongation factor 4 Streptococcus pneumoniae (strain P1031)
Q97QK5 0 729 56 1 595 3 lepA Elongation factor 4 Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
C1CEG3 0 728 56 1 595 3 lepA Elongation factor 4 Streptococcus pneumoniae (strain JJA)
A8EY28 0 728 57 0 595 3 lepA Elongation factor 4 Rickettsia canadensis (strain McKiel)
Q30XI4 0 728 58 1 594 3 lepA Elongation factor 4 Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
Q038N6 0 728 57 1 593 3 lepA Elongation factor 4 Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
B3WEQ5 0 728 57 1 593 3 lepA Elongation factor 4 Lacticaseibacillus casei (strain BL23)
B9MJZ5 0 728 58 2 595 3 lepA Elongation factor 4 Caldicellulosiruptor bescii (strain ATCC BAA-1888 / DSM 6725 / KCTC 15123 / Z-1320)
Q67S76 0 727 57 1 596 3 lepA Elongation factor 4 Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
C6BST2 0 726 57 1 598 3 lepA Elongation factor 4 Maridesulfovibrio salexigens (strain ATCC 14822 / DSM 2638 / NCIMB 8403 / VKM B-1763)
Q68X95 0 726 57 0 593 3 lepA Elongation factor 4 Rickettsia typhi (strain ATCC VR-144 / Wilmington)
B0C9R9 0 726 57 1 595 3 lepA Elongation factor 4 Acaryochloris marina (strain MBIC 11017)
Q3J4P0 0 725 55 0 594 3 lepA Elongation factor 4 Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
A7GHI0 0 725 56 1 591 3 lepA Elongation factor 4 Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
B1ILM7 0 725 56 1 591 3 lepA Elongation factor 4 Clostridium botulinum (strain Okra / Type B1)
B3CPV1 0 724 56 1 596 3 lepA Elongation factor 4 Wolbachia pipientis subsp. Culex pipiens (strain wPip)
Q8CP13 0 724 56 1 593 3 lepA Elongation factor 4 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HNW2 0 724 56 1 593 3 lepA Elongation factor 4 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
B9E6X5 0 724 57 1 596 3 lepA Elongation factor 4 Macrococcus caseolyticus (strain JCSC5402)
B1KZP1 0 724 56 1 591 3 lepA Elongation factor 4 Clostridium botulinum (strain Loch Maree / Type A3)
Q5LUS0 0 724 56 0 592 3 lepA Elongation factor 4 Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
B9KNH9 0 724 55 0 594 3 lepA Elongation factor 4 Cereibacter sphaeroides (strain KD131 / KCTC 12085)
B3Q991 0 723 59 1 596 3 lepA Elongation factor 4 Rhodopseudomonas palustris (strain TIE-1)
P60793 0 723 59 1 596 3 lepA Elongation factor 4 Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
A3PHQ9 0 723 55 0 594 3 lepA Elongation factor 4 Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
B0KA85 0 723 57 1 595 3 lepA Elongation factor 4 Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
A9KKU4 0 723 57 2 597 3 lepA Elongation factor 4 Lachnoclostridium phytofermentans (strain ATCC 700394 / DSM 18823 / ISDg)
B8HLK8 0 722 57 1 595 3 lepA Elongation factor 4 Cyanothece sp. (strain PCC 7425 / ATCC 29141)
Q4L6T4 0 721 56 1 593 3 lepA Elongation factor 4 Staphylococcus haemolyticus (strain JCSC1435)
C1FVU4 0 721 56 1 591 3 lepA Elongation factor 4 Clostridium botulinum (strain Kyoto / Type A2)
A5I644 0 721 56 1 591 3 lepA Elongation factor 4 Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
A7FXL9 0 721 56 1 591 3 lepA Elongation factor 4 Clostridium botulinum (strain ATCC 19397 / Type A)
A0RQX4 0 721 57 3 596 3 lepA Elongation factor 4 Campylobacter fetus subsp. fetus (strain 82-40)
C0R5S3 0 721 56 1 596 3 lepA Elongation factor 4 Wolbachia sp. subsp. Drosophila simulans (strain wRi)
B1ZC10 0 721 57 0 594 3 lepA Elongation factor 4 Methylorubrum populi (strain ATCC BAA-705 / NCIMB 13946 / BJ001)
Q73HR8 0 721 56 1 596 3 lepA Elongation factor 4 Wolbachia pipientis wMel
B0K3Y4 0 721 57 1 595 3 lepA Elongation factor 4 Thermoanaerobacter sp. (strain X514)
Q38W39 0 720 56 1 597 3 lepA Elongation factor 4 Latilactobacillus sakei subsp. sakei (strain 23K)
Q1GIV5 0 720 55 0 594 3 lepA Elongation factor 4 Ruegeria sp. (strain TM1040)
B7K3Z7 0 720 57 1 595 3 lepA Elongation factor 4 Rippkaea orientalis (strain PCC 8801 / RF-1)
Q21BS0 0 720 58 0 594 3 lepA Elongation factor 4 Rhodopseudomonas palustris (strain BisB18)
C3L3H1 0 720 56 1 591 3 lepA Elongation factor 4 Clostridium botulinum (strain 657 / Type Ba4)
Q13E78 0 719 58 1 596 3 lepA Elongation factor 4 Rhodopseudomonas palustris (strain BisB5)
Q9ZDQ1 0 719 56 0 593 3 lepA Elongation factor 4 Rickettsia prowazekii (strain Madrid E)
A4WX88 0 719 55 0 594 3 lepA Elongation factor 4 Cereibacter sphaeroides (strain ATCC 17025 / ATH 2.4.3)
A7ZCJ3 0 719 56 3 596 3 lepA Elongation factor 4 Campylobacter concisus (strain 13826)
Q6G8Y3 0 718 56 1 593 3 lepA Elongation factor 4 Staphylococcus aureus (strain MSSA476)
Q6GGB6 0 718 56 1 593 3 lepA Elongation factor 4 Staphylococcus aureus (strain MRSA252)
P65272 0 718 56 1 593 1 lepA Elongation factor 4 Staphylococcus aureus (strain N315)
P65271 0 718 56 1 593 3 lepA Elongation factor 4 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q2YT42 0 718 56 1 593 3 lepA Elongation factor 4 Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5ITB2 0 718 56 1 593 3 lepA Elongation factor 4 Staphylococcus aureus (strain JH9)
A6U257 0 718 56 1 593 3 lepA Elongation factor 4 Staphylococcus aureus (strain JH1)
A7X2Y7 0 718 56 1 593 3 lepA Elongation factor 4 Staphylococcus aureus (strain Mu3 / ATCC 700698)
B7KR78 0 718 56 0 594 3 lepA Elongation factor 4 Methylorubrum extorquens (strain CM4 / NCIMB 13688)
Q7VJZ1 0 718 56 4 596 3 lepA Elongation factor 4 Helicobacter hepaticus (strain ATCC 51449 / 3B1)
Q8NWA7 0 718 56 1 593 3 lepA Elongation factor 4 Staphylococcus aureus (strain MW2)
A8Z4C4 0 718 56 1 593 3 lepA Elongation factor 4 Staphylococcus aureus (strain USA300 / TCH1516)
A6QHC7 0 718 56 1 593 3 lepA Elongation factor 4 Staphylococcus aureus (strain Newman)
Q5HFH6 0 718 56 1 593 3 lepA Elongation factor 4 Staphylococcus aureus (strain COL)
Q2FXY7 0 718 56 1 593 1 lepA Elongation factor 4 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FGD9 0 718 56 1 593 3 lepA Elongation factor 4 Staphylococcus aureus (strain USA300)
Q2J2Y0 0 718 58 1 596 3 lepA Elongation factor 4 Rhodopseudomonas palustris (strain HaA2)
Q07TF1 0 717 58 1 596 3 lepA Elongation factor 4 Rhodopseudomonas palustris (strain BisA53)
B1WWD8 0 716 57 1 595 3 lepA Elongation factor 4 Crocosphaera subtropica (strain ATCC 51142 / BH68)
Q88VN0 0 716 56 1 596 3 lepA1 Elongation factor 4 1 Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
A3DF29 0 715 57 2 593 3 lepA Elongation factor 4 Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q28LR4 0 715 55 0 592 3 lepA Elongation factor 4 Jannaschia sp. (strain CCS1)
Q1J6V6 0 714 57 1 587 3 lepA Elongation factor 4 Streptococcus pyogenes serotype M4 (strain MGAS10750)
A8LR11 0 714 55 0 592 3 lepA Elongation factor 4 Dinoroseobacter shibae (strain DSM 16493 / NCIMB 14021 / DFL 12)
A7H311 0 714 57 4 598 3 lepA Elongation factor 4 Campylobacter jejuni subsp. doylei (strain ATCC BAA-1458 / RM4099 / 269.97)
A0Q1R8 0 714 55 1 593 3 lepA Elongation factor 4 Clostridium novyi (strain NT)
A6Q241 0 714 56 4 598 3 lepA Elongation factor 4 Nitratiruptor sp. (strain SB155-2)
Q2G550 0 712 58 1 599 3 lepA Elongation factor 4 Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
Q5GRW9 0 712 55 1 597 3 lepA Elongation factor 4 Wolbachia sp. subsp. Brugia malayi (strain TRS)
Q4FNH3 0 712 56 1 598 3 lepA Elongation factor 4 Pelagibacter ubique (strain HTCC1062)
Q057R2 0 711 58 1 596 3 lepA Elongation factor 4 Buchnera aphidicola subsp. Cinara cedri (strain Cc)
B8I3E6 0 711 55 2 595 3 lepA Elongation factor 4 Ruminiclostridium cellulolyticum (strain ATCC 35319 / DSM 5812 / JCM 6584 / H10)
Q2N9U6 0 711 59 2 606 3 lepA Elongation factor 4 Erythrobacter litoralis (strain HTCC2594)
Q8CXD0 0 711 54 1 593 3 lepA Elongation factor 4 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
A1W018 0 711 57 4 598 3 lepA Elongation factor 4 Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS01970
Feature type CDS
Gene lepA
Product translation elongation factor 4
Location 428770 - 430566 (strand: 1)
Length 1797 (nucleotides) / 598 (amino acids)
In genomic island -

Contig

Accession NZ_VXKB01000001
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_635
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00009 Elongation factor Tu GTP binding domain
PF00679 Elongation factor G C-terminus
PF03144 Elongation factor Tu domain 2
PF06421 GTP-binding protein LepA C-terminus

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0481 Translation, ribosomal structure and biogenesis (J) J Translation elongation factor EF-4, membrane-bound GTPase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K03596 GTP-binding protein LepA Legionellosis -

Protein Sequence

MNHIRNFSIIAHIDHGKSTLSDRIIQICGGLSDREMEAQVLDSMDLERERGITIKAQSVTLDYTAQNGETYQLNFIDTPGHVDFSYEVSRSLAACEGALLVVDAGQGVEAQTLANCYTAMEMNLEVVPVLNKIDLPAAEPERVAEEIEDIVGIEAADAVRCSAKTGVGVIEVIERLVRDIPPPKGDPDAPLQALIVDSWFDNYLGVVSLVRIKNGTLRKGDKIKVMSTGQVYNADRVGIFTPKQVDKDILRCGEAGWVVCAIKDILGAPVGDTLTSARQPAEKALPGFKKVKPQVYAGLFPVSSDDYEAFRDALGKLSLNDASLFYEPESSTALGFGFRCGFLGLLHMEIIQERLEREYDLDLITTAPTVVYEVLTTGGETIYVDSPSKLPALNNIEELREPIAECNMLLPQQYLGNVITLCIEKRGVQTNMVYHGNQVALTYEIPMAEVVLDFFDRLKSTSRGYASLDYNFKRFQTSDMVRVDILINSERVDALALITHRENSMYRGRELVEKMKELIPRQQFDIAIQAAIGMHIIARSTVKQLRKNVLAKCYGGDVSRKKKLLQKQKDGKKRMKQVGNVELPQEAFLAILHVGKDN

Flanking regions ( +/- flanking 50bp)

GTCCAAAGCTAGTTTTATAGGGCATTTCAGAGAAGAATTTTATCTTGAAAATTAACCACATACGAAATTTTTCCATTATTGCTCATATCGATCACGGTAAATCAACGTTATCGGATCGCATTATTCAGATTTGCGGTGGGTTATCCGACCGTGAAATGGAAGCGCAGGTTCTGGACTCAATGGATCTGGAACGCGAGCGCGGCATTACGATCAAAGCACAGAGTGTGACGCTGGATTACACTGCTCAGAACGGTGAAACCTACCAGCTGAATTTCATCGATACCCCGGGTCACGTTGACTTCTCTTATGAAGTTTCCCGCTCACTGGCAGCATGTGAAGGTGCGCTGCTGGTGGTCGATGCCGGGCAGGGTGTTGAAGCGCAGACGCTGGCGAACTGCTATACCGCCATGGAAATGAATCTGGAAGTTGTTCCGGTTCTGAACAAAATTGACCTGCCGGCAGCTGAACCTGAGCGCGTGGCAGAAGAGATTGAAGATATCGTCGGTATTGAAGCGGCAGACGCAGTGCGTTGCTCGGCGAAAACCGGCGTGGGTGTTATCGAGGTTATCGAGCGCCTGGTGCGTGATATTCCGCCACCAAAGGGTGATCCTGATGCACCTTTACAGGCGCTGATTGTTGACTCTTGGTTTGATAACTACCTCGGCGTGGTGTCACTTGTGCGGATTAAAAACGGCACACTGCGCAAAGGCGATAAAATCAAAGTCATGAGCACCGGTCAGGTCTATAACGCGGATCGTGTGGGTATTTTTACACCAAAACAGGTGGATAAAGATATTCTCAGATGTGGCGAAGCGGGCTGGGTTGTCTGTGCAATTAAAGACATTTTAGGTGCGCCGGTCGGGGATACCTTGACCAGTGCACGTCAGCCTGCCGAAAAAGCACTGCCGGGCTTTAAAAAAGTCAAACCGCAGGTGTACGCGGGTCTGTTCCCGGTCAGTTCTGATGATTATGAAGCCTTCCGTGATGCGCTGGGTAAACTCAGCCTGAATGATGCTTCATTATTCTATGAGCCGGAAAGTTCCACAGCACTGGGCTTTGGTTTCCGCTGCGGCTTCCTGGGTCTTCTGCATATGGAGATTATTCAGGAGCGTCTGGAGCGTGAATATGATCTCGATCTTATCACCACCGCGCCGACCGTTGTGTATGAAGTGCTGACCACCGGCGGGGAAACTATCTATGTTGACAGCCCGTCCAAATTACCGGCACTGAACAATATCGAAGAGCTGCGTGAGCCTATCGCAGAATGTAATATGCTGCTGCCGCAACAGTATCTGGGGAATGTCATCACCCTGTGTATTGAAAAGCGCGGTGTGCAGACTAACATGGTGTATCACGGTAATCAGGTTGCGCTGACCTATGAAATCCCGATGGCAGAAGTGGTTCTGGACTTCTTTGATCGTCTGAAATCCACTTCGCGCGGCTATGCATCACTGGATTATAACTTCAAACGCTTTCAGACATCTGACATGGTTCGTGTTGATATTCTTATCAATAGTGAGCGGGTTGATGCGCTGGCATTGATCACGCACCGCGAAAATTCAATGTACCGTGGTCGTGAACTGGTTGAGAAAATGAAGGAATTAATTCCGCGCCAGCAGTTTGATATCGCGATTCAGGCGGCTATCGGTATGCATATTATTGCGCGTTCAACAGTGAAACAGTTGCGTAAAAACGTCCTGGCTAAATGCTACGGTGGTGACGTCAGCCGTAAGAAGAAACTGTTGCAGAAGCAGAAAGACGGTAAGAAACGTATGAAGCAGGTCGGGAACGTTGAGTTGCCGCAAGAGGCATTTTTAGCCATTCTTCATGTTGGTAAAGATAATTAATTCATCAGGTTGTAAGGAAATCTAATGGCGAACACTTTTGCGCTGATCCT