Homologs in group_2501

Help

5 homologs were identified in 5 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_01845 FBDBKF_01845 100.0 Morganella morganii S1 araH Ribose/xylose/arabinose/galactoside ABC-type transport system, permease component
EHELCC_02315 EHELCC_02315 100.0 Morganella morganii S2 araH Ribose/xylose/arabinose/galactoside ABC-type transport system, permease component
LHKJJB_00890 LHKJJB_00890 100.0 Morganella morganii S3 araH Ribose/xylose/arabinose/galactoside ABC-type transport system, permease component
HKOGLL_00930 HKOGLL_00930 100.0 Morganella morganii S5 araH Ribose/xylose/arabinose/galactoside ABC-type transport system, permease component
F4V73_RS04190 F4V73_RS04190 95.2 Morganella psychrotolerans - ABC transporter permease

Distribution of the homologs in the orthogroup group_2501

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2501

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P36948 6.21e-43 153 33 4 308 3 rbsC Ribose import permease protein RbsC Bacillus subtilis (strain 168)
B2K3F9 6.12e-39 143 36 4 272 3 lsrD Autoinducer 2 import system permease protein LsrD Yersinia pseudotuberculosis serotype IB (strain PB1/+)
A1JJ53 6.57e-39 142 35 4 271 3 lsrD Autoinducer 2 import system permease protein LsrD Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A7FMJ9 6.73e-39 143 36 4 272 3 lsrD Autoinducer 2 import system permease protein LsrD Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q5PJE5 7.95e-39 142 34 4 272 3 lsrD Autoinducer 2 import system permease protein LsrD Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B1JLQ2 8.48e-39 142 36 4 272 3 lsrD Autoinducer 2 import system permease protein LsrD Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66EZ1 8.48e-39 142 36 4 272 3 lsrD Autoinducer 2 import system permease protein LsrD Yersinia pseudotuberculosis serotype I (strain IP32953)
Q8ZKQ2 8.84e-39 142 34 4 272 1 lsrD Autoinducer 2 import system permease protein LsrD Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A9MZG3 8.84e-39 142 34 4 272 3 lsrD Autoinducer 2 import system permease protein LsrD Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q57HE1 8.84e-39 142 34 4 272 3 lsrD Autoinducer 2 import system permease protein LsrD Salmonella choleraesuis (strain SC-B67)
A4TQL7 2.09e-38 141 35 4 272 3 lsrD Autoinducer 2 import system permease protein LsrD Yersinia pestis (strain Pestoides F)
Q1CN17 2.09e-38 141 35 4 272 3 lsrD Autoinducer 2 import system permease protein LsrD Yersinia pestis bv. Antiqua (strain Nepal516)
A9R076 2.09e-38 141 35 4 272 3 lsrD Autoinducer 2 import system permease protein LsrD Yersinia pestis bv. Antiqua (strain Angola)
Q7CG48 2.09e-38 141 35 4 272 3 lsrD Autoinducer 2 import system permease protein LsrD Yersinia pestis
Q1C136 2.09e-38 141 35 4 272 3 lsrD Autoinducer 2 import system permease protein LsrD Yersinia pestis bv. Antiqua (strain Antiqua)
Q8Z2X7 4.27e-38 140 34 4 272 3 lsrD Autoinducer 2 import system permease protein LsrD Salmonella typhi
P0AGI1 3.55e-36 135 33 4 314 1 rbsC Ribose import permease protein RbsC Escherichia coli (strain K12)
P0AGI2 3.55e-36 135 33 4 314 3 rbsC Ribose import permease protein RbsC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AGI3 3.55e-36 135 33 4 314 3 rbsC Ribose import permease protein RbsC Escherichia coli O157:H7
Q2PBM1 1.15e-34 131 34 4 269 3 lsrD Autoinducer 2 import system permease protein LsrD Photorhabdus temperata
P44736 2.71e-33 127 34 6 272 3 rbsC Ribose import permease protein RbsC Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q7N2D7 1.61e-32 126 36 4 269 3 lsrD Autoinducer 2 import system permease protein LsrD Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A4WER2 4.33e-31 122 31 3 274 3 lsrD Autoinducer 2 import system permease protein LsrD Enterobacter sp. (strain 638)
P32720 1.33e-30 120 28 2 297 1 alsC D-allose transport system permease protein AlsC Escherichia coli (strain K12)
Q2PBL8 1.4e-30 120 35 4 269 3 lsrD Autoinducer 2 import system permease protein LsrD Photorhabdus luminescens
B1LFA0 3.24e-30 119 33 3 271 3 lsrD Autoinducer 2 import system permease protein LsrD Escherichia coli (strain SMS-3-5 / SECEC)
P0AFS2 4.11e-30 119 33 3 271 3 lsrD Autoinducer 2 import system permease protein LsrD Shigella flexneri
Q0T4L7 4.11e-30 119 33 3 271 3 lsrD Autoinducer 2 import system permease protein LsrD Shigella flexneri serotype 5b (strain 8401)
P0AFS1 4.11e-30 119 33 3 271 1 lsrD Autoinducer 2 import system permease protein LsrD Escherichia coli (strain K12)
B1IRU5 4.11e-30 119 33 3 271 3 lsrD Autoinducer 2 import system permease protein LsrD Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A068 4.11e-30 119 33 3 271 3 lsrD Autoinducer 2 import system permease protein LsrD Escherichia coli O9:H4 (strain HS)
B1XEA3 4.11e-30 119 33 3 271 3 lsrD Autoinducer 2 import system permease protein LsrD Escherichia coli (strain K12 / DH10B)
Q8X504 5.37e-30 119 33 3 271 3 lsrD Autoinducer 2 import system permease protein LsrD Escherichia coli O157:H7
P44885 1.91e-26 109 28 5 296 3 mglC Galactose/methyl galactoside import permease protein MglC Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A6TEB6 3.22e-25 106 33 4 271 3 lsrD Autoinducer 2 import system permease protein LsrD Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
P0AE27 9.5e-25 105 28 1 302 3 araH L-arabinose transport system permease protein AraH Shigella flexneri
P0AE26 9.5e-25 105 28 1 302 2 araH L-arabinose transport system permease protein AraH Escherichia coli (strain K12)
A4TQL6 4.91e-22 98 31 7 292 3 lsrC Autoinducer 2 import system permease protein LsrC Yersinia pestis (strain Pestoides F)
Q1CN16 4.91e-22 98 31 7 292 3 lsrC Autoinducer 2 import system permease protein LsrC Yersinia pestis bv. Antiqua (strain Nepal516)
A9R075 4.91e-22 98 31 7 292 3 lsrC Autoinducer 2 import system permease protein LsrC Yersinia pestis bv. Antiqua (strain Angola)
Q7CG49 4.91e-22 98 31 7 292 3 lsrC Autoinducer 2 import system permease protein LsrC Yersinia pestis
Q1C137 4.91e-22 98 31 7 292 3 lsrC Autoinducer 2 import system permease protein LsrC Yersinia pestis bv. Antiqua (strain Antiqua)
Q66EZ0 5.59e-22 97 30 6 290 3 lsrC Autoinducer 2 import system permease protein LsrC Yersinia pseudotuberculosis serotype I (strain IP32953)
B2K3G0 5.59e-22 97 30 6 290 3 lsrC Autoinducer 2 import system permease protein LsrC Yersinia pseudotuberculosis serotype IB (strain PB1/+)
B1JLQ1 5.99e-22 97 30 6 290 3 lsrC Autoinducer 2 import system permease protein LsrC Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
A7FMJ8 7.31e-22 97 31 7 292 3 lsrC Autoinducer 2 import system permease protein LsrC Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q7N2D8 6.4e-21 94 29 5 292 3 lsrC Autoinducer 2 import system permease protein LsrC Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q2PBM2 7.58e-21 94 30 5 290 3 lsrC Autoinducer 2 import system permease protein LsrC Photorhabdus temperata
P55569 1.54e-20 93 28 2 257 3 NGR_a02490 Probable ABC transporter permease protein y4mJ Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P39328 4.79e-20 92 35 3 240 1 ytfT Galactofuranose transporter permease protein YtfT Escherichia coli (strain K12)
Q2PBL9 8.13e-19 88 29 5 292 3 lsrC Autoinducer 2 import system permease protein LsrC Photorhabdus luminescens
A1JJ54 1.05e-18 89 32 6 265 3 lsrC Autoinducer 2 import system permease protein LsrC Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
P77315 8.49e-18 85 28 8 302 3 yphD Probable ABC transporter permease protein YphD Escherichia coli (strain K12)
Q9F9B1 3.13e-16 81 27 4 287 1 frcC Fructose import permease protein FrcC Rhizobium meliloti
Q4J711 3.27e-16 81 27 7 320 1 xylH Xylose/arabinose import permease protein XylH Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770)
Q8G846 3.51e-15 78 26 5 271 1 fruF Fructose import permease protein FruF Bifidobacterium longum (strain NCC 2705)
Q1JUP6 6.69e-15 77 25 3 286 3 araH L-arabinose ABC transporter permease protein AraH Azospirillum brasilense
Q8XAY8 2.34e-14 76 30 3 262 3 lsrC Autoinducer 2 import system permease protein LsrC Escherichia coli O157:H7
Q0T4L8 2.46e-14 75 30 3 262 3 lsrC Autoinducer 2 import system permease protein LsrC Shigella flexneri serotype 5b (strain 8401)
P77672 2.68e-14 75 30 3 262 1 lsrC Autoinducer 2 import system permease protein LsrC Escherichia coli (strain K12)
B1XEA2 2.68e-14 75 30 3 262 3 lsrC Autoinducer 2 import system permease protein LsrC Escherichia coli (strain K12 / DH10B)
B1LFA1 3.33e-14 75 29 3 262 3 lsrC Autoinducer 2 import system permease protein LsrC Escherichia coli (strain SMS-3-5 / SECEC)
Q83RD8 4.34e-14 75 31 3 262 3 lsrC Autoinducer 2 import system permease protein LsrC Shigella flexneri
B1IRU6 2.58e-13 73 29 3 262 3 lsrC Autoinducer 2 import system permease protein LsrC Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A067 2.58e-13 73 29 3 262 3 lsrC Autoinducer 2 import system permease protein LsrC Escherichia coli O9:H4 (strain HS)
Q57321 3.09e-13 73 29 4 217 3 mglC Galactose/methyl galactoside import permease protein MglC Treponema pallidum (strain Nichols)
A4WER3 4.61e-13 72 31 4 226 3 lsrC Autoinducer 2 import system permease protein LsrC Enterobacter sp. (strain 638)
Q56036 5.84e-13 72 28 8 338 1 mglC Galactose/methyl galactoside import permease protein MglC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0AGI7 6.27e-13 72 30 0 127 3 xylH Xylose transport system permease protein XylH Shigella flexneri
P0AGI4 6.27e-13 72 30 0 127 1 xylH Xylose transport system permease protein XylH Escherichia coli (strain K12)
P0AGI5 6.27e-13 72 30 0 127 3 xylH Xylose transport system permease protein XylH Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AGI6 6.27e-13 72 30 0 127 3 xylH Xylose transport system permease protein XylH Escherichia coli O157:H7
Q8G845 1.64e-12 70 28 7 322 1 fruG Fructose import permease protein FruG Bifidobacterium longum (strain NCC 2705)
Q8Z2X6 2.56e-12 70 28 2 289 3 lsrC Autoinducer 2 import system permease protein LsrC Salmonella typhi
Q57HE2 2.79e-12 70 28 3 289 3 lsrC Autoinducer 2 import system permease protein LsrC Salmonella choleraesuis (strain SC-B67)
Q8ZKQ3 3.27e-12 69 28 3 289 1 lsrC Autoinducer 2 import system permease protein LsrC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q5PJE6 3.27e-12 69 28 3 289 3 lsrC Autoinducer 2 import system permease protein LsrC Salmonella paratyphi A (strain ATCC 9150 / SARB42)
A9MZG2 3.5e-12 69 28 3 289 3 lsrC Autoinducer 2 import system permease protein LsrC Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
P23200 6.24e-12 68 28 9 338 1 mglC Galactose/methyl galactoside import permease protein MglC Escherichia coli (strain K12)
P45045 1.24e-11 68 24 9 382 3 xylH Xylose transport system permease protein XylH Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P37772 4.04e-11 66 27 8 306 1 yjfF Inner membrane ABC transporter permease protein YjfF Escherichia coli (strain K12)
A6TEB7 9.61e-11 65 29 2 229 3 lsrC Autoinducer 2 import system permease protein LsrC Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)

  • Number of RefSeq hits:

General

Source Morganella morganii S4
Locus tag NLDBIP_01145
Feature type CDS
Gene araH
Product Ribose/xylose/arabinose/galactoside ABC-type transport system, permease component
Location 235148 - 236098 (strand: 1)
Length 951 (nucleotides) / 316 (amino acids)

Contig

Accession ZDB_519
Length 680340 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2501
Orthogroup size 6
N. genomes 6

Actions

Genomic region

Domains

PF02653 Branched-chain amino acid transport system / permease component

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1172 Carbohydrate transport and metabolism (G) G Ribose/xylose/arabinose/galactoside ABC-type transport system, permease component

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K02057 simple sugar transport system permease protein - -

Protein Sequence

MMSMLNLRSDRNIIYLLVIMAAILLLQGMFNAGAFFSVSNFQSMTSQMPLLGMLALAMSVCMLTGGINLSIIATTNACGLVMASVMAMSPGDGAMLLPALLAGLVTAVIIGLINGFLIAFVGVSPILATLGMMTLINGLNVLISGGTVISGFPPSLLWLGNGTLLGIPMPLILFLLFAFLLWGLLEYTPLGRTVYLMGSNEKATRFSGLNTQKTIMAVYVISSVLCWVAAIIMMAKFNSAKAGYGESYLLIAILASVLGGVNPDGGFGRIIGIVLALFVLQMLESGLNLLGVSSYLIMALWGGILILFIALQKARS

Flanking regions ( +/- flanking 50bp)

TTCACCGCGTATAACGAAAAACGCCGTGCCGCTGCCGGAGGTCATCTGTCATGATGTCAATGCTGAATCTGCGGAGTGACCGCAACATTATTTACCTGCTGGTGATCATGGCCGCTATCCTGCTGTTGCAGGGAATGTTTAATGCAGGCGCGTTTTTCTCTGTTTCCAACTTCCAGTCAATGACGTCCCAGATGCCGCTGCTCGGTATGCTGGCGCTGGCGATGTCTGTCTGTATGCTGACCGGCGGGATCAACCTGTCCATTATCGCGACCACCAATGCCTGCGGGCTGGTGATGGCGAGTGTGATGGCGATGAGCCCGGGTGACGGCGCCATGTTACTGCCTGCCCTGCTGGCCGGGCTGGTCACTGCCGTGATTATCGGTCTGATTAATGGTTTTCTGATTGCGTTTGTCGGAGTGTCTCCGATCCTCGCCACCCTCGGGATGATGACCTTAATCAACGGCCTGAATGTGCTGATTTCCGGCGGTACCGTGATCTCCGGCTTCCCGCCGTCACTGCTGTGGCTCGGTAACGGTACCCTTCTCGGGATCCCGATGCCGCTGATCCTGTTCCTGCTGTTTGCGTTCCTGCTGTGGGGATTGCTGGAATATACGCCGCTCGGCCGTACCGTTTATCTGATGGGTTCTAATGAAAAAGCAACGCGCTTTTCCGGCCTGAATACACAGAAAACCATTATGGCAGTGTATGTGATTTCATCTGTTCTGTGCTGGGTGGCCGCGATTATTATGATGGCTAAGTTTAACTCCGCCAAAGCAGGATACGGAGAATCTTACCTGCTGATCGCTATTCTCGCCTCTGTGCTCGGCGGTGTGAACCCGGACGGCGGTTTCGGACGCATTATCGGCATTGTACTGGCTCTGTTTGTCTTACAGATGCTGGAAAGCGGCCTGAACCTGCTGGGTGTCAGCAGCTACCTCATCATGGCGCTGTGGGGCGGTATTCTTATCTTATTTATTGCATTGCAGAAAGCCCGGTCATAAGGGAGCGGATTATGAGTGTCTATTTTATTGGTGTGGATGTCGGGAGCGGC