Homologs in group_3006

Help

5 homologs were identified in 5 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_17655 FBDBKF_17655 100.0 Morganella morganii S1 potC ABC-type spermidine/putrescine transport system, permease component II
EHELCC_18140 EHELCC_18140 100.0 Morganella morganii S2 potC ABC-type spermidine/putrescine transport system, permease component II
NLDBIP_18010 NLDBIP_18010 100.0 Morganella morganii S4 potC ABC-type spermidine/putrescine transport system, permease component II
HKOGLL_17995 HKOGLL_17995 100.0 Morganella morganii S5 potC ABC-type spermidine/putrescine transport system, permease component II
F4V73_RS15035 F4V73_RS15035 90.2 Morganella psychrotolerans - ABC transporter permease

Distribution of the homologs in the orthogroup group_3006

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_3006

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q8Z8X0 6.01e-09 58 24 4 265 3 phnV Putative 2-aminoethylphosphonate transport system permease protein PhnV Salmonella typhi
Q5PFQ5 1.26e-08 57 23 4 266 3 phnV Putative 2-aminoethylphosphonate transport system permease protein PhnV Salmonella paratyphi A (strain ATCC 9150 / SARB42)
P18795 1.97e-08 57 26 10 256 3 nifC Probable transport system permease protein NifC Clostridium pasteurianum
P96065 3.83e-08 56 23 4 266 2 phnV Putative 2-aminoethylphosphonate transport system permease protein PhnV Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q6QJE2 6.74e-08 56 28 7 199 1 SULP2 Sulfate permease 2, chloroplastic Chlamydomonas reinhardtii
Q57SD8 7.85e-08 55 25 3 185 3 phnV Putative 2-aminoethylphosphonate transport system permease protein PhnV Salmonella choleraesuis (strain SC-B67)
P27370 2.91e-07 53 26 10 232 2 cysW Sulfate transport system permease protein CysW Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P0AFK6 2.96e-07 53 25 3 195 3 potC Spermidine/putrescine transport system permease protein PotC Escherichia coli (strain K12)
P0AFK7 2.96e-07 53 25 3 195 3 potC Spermidine/putrescine transport system permease protein PotC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AFK8 2.96e-07 53 25 3 195 3 potC Spermidine/putrescine transport system permease protein PotC Escherichia coli O157:H7
Q83RR7 3.34e-07 53 25 3 195 3 potC Spermidine/putrescine transport system permease protein PotC Shigella flexneri
P31135 2.17e-06 51 27 5 203 1 potH Putrescine transport system permease protein PotH Escherichia coli (strain K12)
P0AEB0 3.7e-06 50 32 10 201 1 cysW Sulfate transport system permease protein CysW Escherichia coli (strain K12)
P0AEB1 3.7e-06 50 32 10 201 3 cysW Sulfate transport system permease protein CysW Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P55452 4.57e-06 51 25 9 259 3 NGR_a03680 Probable ABC transporter permease protein y4fN Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P37731 1e-05 48 27 6 161 3 modB Molybdenum transport system permease protein ModB Azotobacter vinelandii
Q9TJR4 1.07e-05 49 24 2 161 3 cysT Probable sulfate transport system permease protein cysT Prototheca wickerhamii
O51924 1.21e-05 49 27 10 211 1 malF Trehalose/maltose transport system permease protein MalF Thermococcus litoralis (strain ATCC 51850 / DSM 5473 / JCM 8560 / NS-C)
P26246 1.27e-05 49 27 4 162 3 cysT Probable sulfate transport system permease protein cysT Marchantia polymorpha
P45169 3.5e-05 47 25 4 212 3 potC Spermidine/putrescine transport system permease protein PotC Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P0A4N2 3.64e-05 48 27 9 222 3 malC Maltodextrin transport system permease protein MalC Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A4N1 3.64e-05 48 27 9 222 3 malC Maltodextrin transport system permease protein MalC Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
P0AF01 4.94e-05 47 32 4 116 1 modB Molybdenum transport system permease protein ModB Escherichia coli (strain K12)
P0AF02 4.94e-05 47 32 4 116 3 modB Molybdenum transport system permease protein ModB Escherichia coli O157:H7
P74547 0.000102 46 31 7 148 3 cysW Sulfate transport system permease protein CysW Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q9TKU8 0.000352 44 27 5 147 3 cysT Probable sulfate transport system permease protein cysT Nephroselmis olivacea
P16701 0.000417 44 26 8 191 3 cysU Sulfate transport system permease protein CysT Escherichia coli (strain K12)
P0AFK5 0.000437 44 25 7 237 3 potB Spermidine/putrescine transport system permease protein PotB Shigella flexneri
P0AFK4 0.000437 44 25 7 237 1 potB Spermidine/putrescine transport system permease protein PotB Escherichia coli (strain K12)
P45322 0.000543 43 28 8 182 3 modB Molybdenum transport system permease protein ModB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q53683 0.000678 43 32 2 113 3 None Putative ABC transporter permease protein ORF1 (Fragment) Streptomyces antibioticus
P0CL49 0.00068 43 25 7 237 3 potB Spermidine/putrescine transport system permease protein PotB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
E1WF94 0.00068 43 25 7 237 3 potB Spermidine/putrescine transport system permease protein PotB Salmonella typhimurium (strain SL1344)
P0A2J8 0.00068 43 25 7 237 3 potB Spermidine/putrescine transport system permease protein PotB Salmonella typhi

  • Number of RefSeq hits:

General

Source Morganella morganii S3
Locus tag LHKJJB_18205
Feature type CDS
Gene potC
Product ABC-type spermidine/putrescine transport system, permease component II
Location 10923 - 11723 (strand: 1)
Length 801 (nucleotides) / 266 (amino acids)

Contig

Accession ZDB_382
Length 38736 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_3006
Orthogroup size 6
N. genomes 6

Actions

Genomic region

Domains

PF00528 Binding-protein-dependent transport system inner membrane component

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1177 Amino acid transport and metabolism (E) E ABC-type spermidine/putrescine transport system, permease component II

Protein Sequence

MPSADLTLNPPSMARYHKIMLSLIVILLLLPIIATLLYSFSTRWGATVLPDGLTLQWYLKLWQDPRFLAAFGRSLFICFVTLAISTLVILPLVFAVFYYFPRLKGLMEILIILPFAVPPVVSSVGLLQLFADGPLPIAGTPWILIGTYFTITLPFMYRALANSLNGVPLKDLLDAAHLLGAGTFKAFLLVVVPNIRKGLLVSLLIAFSFLFGEFVFANILVGTRYETLQIYLYNMRQTSGHFTSALVASYFIFTLILTLIATRLSR

Flanking regions ( +/- flanking 50bp)

CCTCGGATTCATCACTGCTGTCTATCACTGGCTGCTGAAACGGAGTTACCATGCCAAGTGCTGATCTCACACTCAATCCGCCGTCCATGGCGCGTTATCACAAAATCATGCTCAGCCTGATTGTGATCCTGCTGCTGTTACCGATTATCGCGACCCTGCTGTATTCCTTCTCCACCCGCTGGGGTGCCACGGTGCTGCCGGACGGCCTGACATTACAGTGGTATCTGAAACTGTGGCAGGATCCGCGTTTTCTTGCCGCGTTCGGCCGTTCGCTGTTTATCTGTTTTGTCACCCTTGCCATCAGCACCCTGGTGATCCTGCCGCTGGTGTTTGCCGTGTTTTATTACTTCCCGCGGCTGAAAGGGCTGATGGAGATCCTGATTATTCTGCCGTTTGCCGTGCCGCCGGTGGTCTCTTCCGTCGGATTACTGCAGCTGTTCGCTGACGGGCCGCTGCCGATTGCCGGTACCCCGTGGATTCTGATCGGTACCTATTTCACCATCACCCTGCCGTTTATGTACCGGGCGCTGGCCAACAGCCTGAACGGCGTGCCGCTGAAAGATTTACTGGATGCCGCTCATCTGCTCGGCGCAGGTACTTTTAAGGCGTTTCTGCTGGTGGTGGTGCCAAATATCCGCAAAGGGTTGCTGGTGTCGCTGCTGATCGCCTTCTCCTTCCTGTTCGGCGAGTTTGTATTTGCCAATATCCTGGTCGGCACCCGTTACGAAACCCTGCAAATCTATCTCTATAACATGCGCCAGACCAGCGGGCACTTCACCTCCGCACTGGTGGCGAGCTACTTTATTTTCACCCTGATCCTGACCCTGATCGCGACACGCTTAAGCCGCTGAGGAATCACTGATGAGCTATGTAATTGCTGAAAACCTGACAAAATCCTTTG