Homologs in group_1669

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_11605 FBDBKF_11605 100.0 Morganella morganii S1 cysK cysteine synthase A
EHELCC_17525 EHELCC_17525 100.0 Morganella morganii S2 cysK cysteine synthase A
NLDBIP_18735 NLDBIP_18735 100.0 Morganella morganii S4 cysK cysteine synthase A
HKOGLL_18685 HKOGLL_18685 100.0 Morganella morganii S5 cysK cysteine synthase A
F4V73_RS08075 F4V73_RS08075 98.1 Morganella psychrotolerans cysK cysteine synthase A
PMI_RS09015 PMI_RS09015 85.2 Proteus mirabilis HI4320 cysK cysteine synthase A

Distribution of the homologs in the orthogroup group_1669

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1669

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0A1E3 0.0 514 82 0 315 1 cysK Cysteine synthase A Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A1E4 0.0 514 82 0 315 3 cysK Cysteine synthase A Salmonella typhi
P0ABK5 0.0 509 81 0 315 1 cysK Cysteine synthase A Escherichia coli (strain K12)
P0ABK6 0.0 509 81 0 315 3 cysK Cysteine synthase A Escherichia coli O157:H7
Q8KA48 3.23e-150 427 71 0 313 3 cysK Cysteine synthase Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
P45040 5.15e-150 426 74 2 313 1 cysK Cysteine synthase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q59966 1.79e-143 410 68 2 315 2 srpG Cysteine synthase Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P57171 2.59e-142 407 68 0 315 3 cysK Cysteine synthase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
P9WP55 4.63e-106 315 57 5 317 1 cysK1 O-acetylserine sulfhydrylase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WP54 4.63e-106 315 57 5 317 3 cysK1 O-acetylserine sulfhydrylase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A535 4.63e-106 315 57 5 317 3 cysK O-acetylserine sulfhydrylase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P32260 3.98e-105 315 57 5 318 1 CYSK Cysteine synthase, chloroplastic/chromoplastic Spinacia oleracea
O32978 9.8e-105 311 56 4 316 3 cysK O-acetylserine sulfhydrylase Mycobacterium leprae (strain TN)
O81155 2.12e-104 313 57 5 318 2 None Cysteine synthase, chloroplastic/chromoplastic Solanum tuberosum
Q43725 9.93e-99 300 55 5 318 1 OASC Cysteine synthase, mitochondrial Arabidopsis thaliana
P63872 4.22e-98 294 53 7 306 3 cysK Cysteine synthase Staphylococcus aureus (strain MW2)
Q6GBX5 4.22e-98 294 53 7 306 3 cysK Cysteine synthase Staphylococcus aureus (strain MSSA476)
Q6GJF8 4.22e-98 294 53 7 306 3 cysK Cysteine synthase Staphylococcus aureus (strain MRSA252)
P63871 4.22e-98 294 53 7 306 1 cysK Cysteine synthase Staphylococcus aureus (strain N315)
P63870 4.22e-98 294 53 7 306 3 cysK Cysteine synthase Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HIG2 4.22e-98 294 53 7 306 3 cysK Cysteine synthase Staphylococcus aureus (strain COL)
Q8CMT6 5.61e-98 294 53 7 306 3 cysK Cysteine synthase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HRP1 5.61e-98 294 53 7 306 3 cysK Cysteine synthase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P47999 5.82e-98 297 54 5 318 1 OASB Cysteine synthase, chloroplastic/chromoplastic Arabidopsis thaliana
P80608 5.98e-98 295 56 5 316 1 None Cysteine synthase Zea mays
P73410 1.31e-97 293 57 6 319 3 cysK Cysteine synthase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q7DDL5 9.2e-97 291 56 5 314 1 cysK Cysteine synthase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9XEA8 2.05e-96 291 55 5 316 2 RCS3 Cysteine synthase Oryza sativa subsp. japonica
O45679 2.23e-96 291 52 5 311 1 cysl-2 Bifunctional L-3-cyanoalanine synthase/cysteine synthase Caenorhabditis elegans
Q00834 4.23e-95 287 53 5 316 1 None Cysteine synthase Spinacia oleracea
O23733 5.23e-94 284 54 5 315 2 None Cysteine synthase Brassica juncea
Q43317 1.19e-93 283 53 5 318 1 None Cysteine synthase Citrullus lanatus
O81154 1.23e-93 283 54 5 316 2 None Cysteine synthase Solanum tuberosum
Q9XEA6 1.59e-93 283 54 5 316 2 RCS1 Cysteine synthase Oryza sativa subsp. japonica
P47998 3.47e-93 282 54 5 315 1 OASA1 Cysteine synthase 1 Arabidopsis thaliana
O23735 1.85e-91 278 54 5 313 2 None Cysteine synthase Brassica juncea
P31300 4.94e-91 278 53 5 318 2 None Cysteine synthase, chloroplastic/chromoplastic Capsicum annuum
O01592 3.3e-90 275 48 5 316 1 cysl-3 Cysteine synthase 3 Caenorhabditis elegans
P38076 4.02e-90 275 52 5 316 2 CYS1 Cysteine synthase Triticum aestivum
Q5XAQ3 3.52e-89 272 49 8 320 1 cysK Cysteine synthase Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q9S6Z7 1.8e-88 270 51 5 316 1 CYSD1 Bifunctional L-3-cyanoalanine synthase/cysteine synthase D1 Arabidopsis thaliana
Q93244 3.42e-87 268 50 5 321 1 cysl-1 Cysteine synthase 1 Caenorhabditis elegans
Q9SXS7 2.56e-86 265 51 5 316 1 CYSD2 Bifunctional L-3-cyanoalanine synthase/cysteine synthase D2 Arabidopsis thaliana
Q1KLZ2 2.77e-86 266 47 5 320 1 CAS1 L-3-cyanoalanine synthase 1, mitochondrial Malus domestica
Q43153 2.95e-86 266 49 5 320 1 CYSC Bifunctional L-3-cyanoalanine synthase/cysteine synthase, mitochondrial Spinacia oleracea
Q76MX2 5.34e-85 262 49 5 311 1 PCAS-1 Bifunctional L-3-cyanoalanine synthase/cysteine synthase 1, mitochondrial Solanum tuberosum
Q1KLZ1 5.09e-84 261 46 5 320 1 CAS2 L-3-cyanoalanine synthase 2, mitochondrial Malus domestica
Q9S757 5.49e-83 258 49 5 313 1 CYSC1 Bifunctional L-3-cyanoalanine synthase/cysteine synthase C1, mitochondrial Arabidopsis thaliana
P37887 2.98e-82 254 53 7 311 1 cysK Cysteine synthase Bacillus subtilis (strain 168)
Q9FS29 7.27e-82 254 47 5 318 1 PCAS-2 Bifunctional L-3-cyanoalanine synthase/cysteine synthase 2, mitochondrial Solanum tuberosum
F4K5T2 1.38e-81 253 50 5 316 1 DES1 Bifunctional cystathionine gamma-lyase/cysteine synthase Arabidopsis thaliana
P71128 4.5e-81 251 47 6 311 3 cysM Cysteine synthase B Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
O22682 4.25e-79 249 50 5 317 1 CS26 S-sulfo-L-cysteine synthase (O-acetyl-L-serine-dependent), chloroplastic Arabidopsis thaliana
Q59447 5.57e-73 230 47 4 263 3 cysK Cysteine synthase Flavobacterium sp. (strain K3-15 / DSM ID92-509)
P29848 1.06e-72 229 45 7 308 1 cysM Cysteine synthase B Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P16703 1.94e-71 226 43 6 307 1 cysM Cysteine synthase B Escherichia coli (strain K12)
O34476 2.01e-71 226 47 6 321 3 ytkP Probable cysteine synthase Bacillus subtilis (strain 168)
D2Z027 1.73e-65 211 45 7 310 1 dcsD O-ureido-L-serine synthase Streptomyces lavendulae
O05393 2.01e-64 208 42 6 304 1 mccA O-acetylserine dependent cystathionine beta-synthase Bacillus subtilis (strain 168)
Q9LJA0 3.76e-63 201 57 3 183 5 OASA2 Putative inactive cysteine synthase 2 Arabidopsis thaliana
P56067 8.59e-63 204 39 6 306 1 cysM Cysteine synthase Helicobacter pylori (strain ATCC 700392 / 26695)
Q9I526 4.43e-62 202 40 8 316 3 cysM Cysteine synthase B Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P32232 1.09e-61 208 41 7 318 1 Cbs Cystathionine beta-synthase Rattus norvegicus
P35520 2.42e-60 204 41 7 317 1 CBS Cystathionine beta-synthase Homo sapiens
Q91WT9 3.58e-60 204 41 7 318 1 Cbs Cystathionine beta-synthase Mus musculus
Q58H57 2.18e-59 202 41 7 317 2 CBS Cystathionine beta-synthase Macaca fascicularis
O67507 1.32e-57 191 42 6 314 3 cysM Cysteine synthase Aquifex aeolicus (strain VF5)
Q9ZMW6 1.14e-56 188 37 9 311 3 cysM Cysteine synthase Helicobacter pylori (strain J99 / ATCC 700824)
Q9N0V7 3.2e-56 194 41 7 317 2 CBS Cystathionine beta-synthase Oryctolagus cuniculus
P9WP51 2.86e-54 186 41 9 331 1 cbs Probable cystathionine beta-synthase Rv1077 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WP50 2.86e-54 186 41 9 331 3 cbs Putative cystathionine beta-synthase MT1108 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q2V0C9 2.01e-53 185 41 7 315 1 CBS Cystathionine beta-synthase Apis mellifera
P50867 4.57e-50 173 39 8 310 3 cysB Cysteine synthase 1 Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
P46794 6.97e-50 176 40 8 319 2 cysB Cystathionine beta-synthase Dictyostelium discoideum
P32582 2.05e-47 169 37 9 313 1 CYS4 Cystathionine beta-synthase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
O59701 2.79e-47 165 39 9 312 1 cys11 Cysteine synthase 1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P9WP53 2.79e-45 159 35 7 321 1 cysM O-phosphoserine sulfhydrylase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WP52 2.79e-45 159 35 7 321 3 cysM O-phosphoserine sulfhydrylase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63874 2.79e-45 159 35 7 321 3 cysM O-phosphoserine sulfhydrylase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q9N4K2 2.11e-44 163 39 11 323 2 cbs-2 Putative cystathionine beta-synthase cbs-2 Caenorhabditis elegans
G5EFH8 1.26e-42 159 39 11 322 1 cbs-1 Cystathionine beta-synthase cbs-1 Caenorhabditis elegans
G5EFH8 3.95e-08 58 29 9 309 1 cbs-1 Cystathionine beta-synthase cbs-1 Caenorhabditis elegans
Q7RYW6 1.22e-41 151 37 7 308 3 cys-17 Cysteine synthase 1 Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q59918 6.1e-41 143 50 5 161 3 cysK Cysteine synthase (Fragment) Staphylococcus haemolyticus
P87131 9.24e-41 149 34 10 325 3 cys12 Cysteine synthase 2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q54CN7 1.19e-40 149 33 7 313 3 cysK Cysteine synthase Dictyostelium discoideum
Q5BD67 1.29e-40 149 36 10 334 3 cysF Cysteine synthase 2 Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q2YUU0 5.1e-40 145 34 6 302 3 sbnA N-(2-amino-2-carboxyethyl)-L-glutamate synthase Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q99X99 1.07e-39 145 35 6 302 3 sbnA N-(2-amino-2-carboxyethyl)-L-glutamate synthase Staphylococcus aureus (strain N315)
Q8XSQ0 1.74e-39 144 36 7 306 3 sbnA N-(2-amino-2-carboxyethyl)-L-glutamate synthase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q7A1Z6 3.51e-39 143 34 6 302 3 sbnA N-(2-amino-2-carboxyethyl)-L-glutamate synthase Staphylococcus aureus (strain MW2)
A8YZ41 3.51e-39 143 34 6 302 3 sbnA N-(2-amino-2-carboxyethyl)-L-glutamate synthase Staphylococcus aureus (strain USA300 / TCH1516)
Q6GD09 3.51e-39 143 34 6 302 3 sbnA N-(2-amino-2-carboxyethyl)-L-glutamate synthase Staphylococcus aureus (strain MSSA476)
Q6GKI9 3.51e-39 143 34 6 302 3 sbnA N-(2-amino-2-carboxyethyl)-L-glutamate synthase Staphylococcus aureus (strain MRSA252)
Q932K9 3.51e-39 143 34 6 302 3 sbnA N-(2-amino-2-carboxyethyl)-L-glutamate synthase Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QDA0 3.51e-39 143 34 6 302 1 sbnA N-(2-amino-2-carboxyethyl)-L-glutamate synthase Staphylococcus aureus (strain Newman)
D0K799 3.51e-39 143 34 6 302 3 sbnA N-(2-amino-2-carboxyethyl)-L-glutamate synthase Staphylococcus aureus (strain ED98)
Q5HJQ3 3.51e-39 143 34 6 302 3 sbnA N-(2-amino-2-carboxyethyl)-L-glutamate synthase Staphylococcus aureus (strain COL)
A5INY7 3.51e-39 143 34 6 302 3 sbnA N-(2-amino-2-carboxyethyl)-L-glutamate synthase Staphylococcus aureus (strain JH9)
Q2G1N3 3.51e-39 143 34 6 302 1 sbnA N-(2-amino-2-carboxyethyl)-L-glutamate synthase Staphylococcus aureus (strain NCTC 8325 / PS 47)
D2N3G7 3.51e-39 143 34 6 302 3 sbnA N-(2-amino-2-carboxyethyl)-L-glutamate synthase Staphylococcus aureus (strain MRSA ST398 / isolate S0385)
D3ERF5 3.51e-39 143 34 6 302 3 sbnA N-(2-amino-2-carboxyethyl)-L-glutamate synthase Staphylococcus aureus (strain 04-02981)
Q2FKE3 3.51e-39 143 34 6 302 3 sbnA N-(2-amino-2-carboxyethyl)-L-glutamate synthase Staphylococcus aureus (strain USA300)
A6TXQ1 3.51e-39 143 34 6 302 3 sbnA N-(2-amino-2-carboxyethyl)-L-glutamate synthase Staphylococcus aureus (strain JH1)
A7WX68 3.51e-39 143 34 6 302 3 sbnA N-(2-amino-2-carboxyethyl)-L-glutamate synthase Staphylococcus aureus (strain Mu3 / ATCC 700698)
D1GUM7 3.51e-39 143 34 6 302 3 sbnA N-(2-amino-2-carboxyethyl)-L-glutamate synthase Staphylococcus aureus (strain TW20 / 0582)
Q7SHQ1 7.4e-38 142 37 10 329 3 cys-12 Cysteine synthase 2 Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
P48028 4.97e-37 133 45 3 171 3 cysM Cysteine synthase B (Fragment) Pseudomonas syringae pv. syringae
P53206 5.12e-35 134 35 10 323 1 MCY1 Putative mitochondrial cysteine synthase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q44004 3.04e-33 128 32 8 308 3 sbnA N-(2-amino-2-carboxyethyl)-L-glutamate synthase Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
P55708 1.54e-30 120 31 9 315 3 NGR_a00730 Putative cysteine synthase Sinorhizobium fredii (strain NBRC 101917 / NGR234)
O69652 1.36e-13 73 26 10 300 1 cds1 L-cysteine desulfhydrase Cds1 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
A5U908 1.36e-13 73 26 10 300 1 cds1 L-cysteine desulfhydrase Cds1 Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
Q9YBL2 3.49e-12 70 27 11 303 1 cysO Protein CysO Aeropyrum pernix (strain ATCC 700893 / DSM 11879 / JCM 9820 / NBRC 100138 / K1)
Q79FV4 3.48e-11 67 25 9 307 1 cysK2 S-sulfocysteine synthase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q9AXU4 7.88e-09 60 29 12 298 1 TD Threonine dehydratase Nicotiana attenuata
Q8U093 7.95e-07 53 27 12 286 1 trpB1 Tryptophan synthase beta chain 1 Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
E3PY97 2.61e-06 52 28 11 319 1 ortB 2-amino-4-ketopentanoate thiolase beta subunit Acetoanaerobium sticklandii (strain ATCC 12662 / DSM 519 / JCM 1433 / CCUG 9281 / NCIMB 10654 / HF)
Q19374 2.83e-06 52 23 8 252 1 F13B12.4 Putative pyridoxal-phosphate dependent protein F13B12.4 Caenorhabditis elegans
A0JNI4 2.99e-06 51 25 11 289 2 SRR Serine racemase Bos taurus
Q10725 2e-05 49 25 9 205 1 psdht Phenylserine dehydratase Ralstonia pickettii
Q8R9M9 5.35e-05 48 28 14 289 3 trpB Tryptophan synthase beta chain Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q54HH2 6.77e-05 47 27 13 278 1 srr Serine racemase Dictyostelium discoideum
P25306 0.000123 47 26 12 280 1 TD2 Threonine dehydratase 2 biosynthetic, chloroplastic Solanum lycopersicum
O94634 0.000215 46 28 11 269 3 SPBC1677.03c Threonine dehydratase, mitochondrial Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9GZT4 0.00024 45 24 12 304 1 SRR Serine racemase Homo sapiens
P19868 0.000376 45 26 13 287 3 trpB Tryptophan synthase beta chain Geobacillus stearothermophilus
Q3AFZ5 0.000406 45 26 4 158 3 dsdA Probable D-serine dehydratase Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
O67409 0.00051 45 26 5 171 3 trpB2 Tryptophan synthase beta chain 2 Aquifex aeolicus (strain VF5)
A6UW25 0.000544 45 24 12 289 3 trpB Tryptophan synthase beta chain Methanococcus aeolicus (strain ATCC BAA-1280 / DSM 17508 / OCM 812 / Nankai-3)
Q86B06 0.000699 44 23 11 319 3 sds L-serine dehydratase Dictyostelium discoideum

  • Number of RefSeq hits:

General

Source Morganella morganii S3
Locus tag LHKJJB_17965
Feature type CDS
Gene cysK
Product cysteine synthase A
Location 14728 - 15684 (strand: -1)
Length 957 (nucleotides) / 318 (amino acids)

Contig

Accession ZDB_381
Length 42053 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1669
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00291 Pyridoxal-phosphate dependent enzyme

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0031 Amino acid transport and metabolism (E) E Cysteine synthase

Kegg Ortholog Annotation(s)

Protein Sequence

MSKIYEDNSLTIGHTPLVRLKHFGHGNILAKVESRNPSFSVKCRIGANMIWDAEKRGILKPGVELVEPTSGNTGIALAYVAAARGYKLTLTMPDTMSIERRKLLKALGANLVLTEGAKGMKGAIEKADEISASDPSRYIVLQQFSNPANPAIHEKTTGPEIWEDTDGNVDVVVAGVGTGGTITGIARYLKNIKGKKDVTIVAVEPEGSPVITQALAGEEIKPGPHKIQGIGAGFIPGNLDLSLIDRVELVSNEDAFATARKLMEREGILAGISSGAAVIAAERLAKEDKFKGKNIVVILPSSGERYLSTALFADISEN

Flanking regions ( +/- flanking 50bp)

ATGTGGTTTTATATTTAGTCTGATTATGAATAACCCTATAAGGAAAACCGATGAGTAAGATATATGAAGATAATTCGCTAACCATTGGTCACACACCGCTGGTGCGCCTCAAACATTTCGGTCACGGCAATATCCTGGCGAAAGTGGAATCCCGCAACCCGAGTTTCAGCGTCAAGTGCCGTATCGGCGCCAATATGATCTGGGACGCGGAAAAACGCGGTATCCTGAAACCGGGTGTGGAACTGGTCGAGCCGACCAGCGGTAACACCGGGATTGCACTGGCGTATGTTGCTGCCGCCCGTGGTTACAAACTCACCCTGACCATGCCGGATACCATGAGTATCGAACGCCGCAAACTGCTGAAAGCCCTGGGTGCCAACCTGGTGCTGACCGAAGGCGCGAAAGGTATGAAAGGCGCGATTGAAAAAGCCGATGAAATCAGCGCGTCTGATCCGTCCCGCTATATTGTGTTACAGCAGTTCAGCAACCCGGCCAACCCGGCGATCCATGAAAAAACCACCGGTCCGGAAATCTGGGAAGACACTGACGGCAATGTGGATGTTGTGGTTGCCGGTGTCGGTACCGGCGGCACCATCACCGGTATCGCCCGTTACCTGAAAAACATCAAAGGGAAAAAAGACGTCACTATCGTGGCCGTCGAGCCGGAAGGCTCCCCGGTCATCACCCAGGCACTGGCCGGGGAAGAGATCAAACCGGGCCCGCACAAAATTCAGGGTATCGGTGCCGGTTTTATCCCGGGTAACCTGGATCTGAGCCTGATTGACCGCGTCGAGCTGGTCAGCAACGAAGACGCTTTCGCCACCGCCCGTAAACTGATGGAGCGCGAAGGTATTCTCGCCGGTATTTCATCCGGTGCGGCTGTAATTGCGGCTGAACGTCTCGCGAAAGAAGATAAATTCAAGGGCAAAAATATCGTGGTGATCCTGCCGTCTTCCGGTGAACGTTATTTGAGTACTGCGCTGTTCGCTGATATCAGTGAAAACTGATCAACTGAACGGATTCAGTTCCCGCCCTGCCTGACCTCGAAAGCACCCGT