Homologs in group_1431

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_08840 FBDBKF_08840 100.0 Morganella morganii S1 pepA leucyl aminopeptidase
EHELCC_12680 EHELCC_12680 100.0 Morganella morganii S2 pepA leucyl aminopeptidase
NLDBIP_13020 NLDBIP_13020 100.0 Morganella morganii S4 pepA leucyl aminopeptidase
HKOGLL_11495 HKOGLL_11495 100.0 Morganella morganii S5 pepA leucyl aminopeptidase
F4V73_RS10060 F4V73_RS10060 96.2 Morganella psychrotolerans pepA leucyl aminopeptidase
PMI_RS17265 PMI_RS17265 90.6 Proteus mirabilis HI4320 pepA leucyl aminopeptidase

Distribution of the homologs in the orthogroup group_1431

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1431

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B4F2N1 0.0 956 90 1 503 3 pepA Probable cytosol aminopeptidase Proteus mirabilis (strain HI4320)
A1JJ31 0.0 930 87 0 503 3 pepA Probable cytosol aminopeptidase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
B1JLS9 0.0 928 87 0 503 3 pepA Probable cytosol aminopeptidase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66F09 0.0 928 87 0 503 3 pepA Probable cytosol aminopeptidase Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TQP6 0.0 928 87 0 503 3 pepA Probable cytosol aminopeptidase Yersinia pestis (strain Pestoides F)
Q1CM01 0.0 928 87 0 503 3 pepA Probable cytosol aminopeptidase Yersinia pestis bv. Antiqua (strain Nepal516)
A9R5F5 0.0 928 87 0 503 3 pepA Probable cytosol aminopeptidase Yersinia pestis bv. Antiqua (strain Angola)
Q8ZBH3 0.0 928 87 0 503 3 pepA Probable cytosol aminopeptidase Yersinia pestis
B2K3E9 0.0 928 87 0 503 3 pepA Probable cytosol aminopeptidase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C3R8 0.0 928 87 0 503 3 pepA Probable cytosol aminopeptidase Yersinia pestis bv. Antiqua (strain Antiqua)
A7FML9 0.0 928 87 0 503 3 pepA Probable cytosol aminopeptidase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A8G978 0.0 920 85 0 503 3 pepA Probable cytosol aminopeptidase Serratia proteamaculans (strain 568)
Q7MZ27 0.0 904 87 1 506 3 pepA Probable cytosol aminopeptidase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
C6DJN2 0.0 898 87 0 498 3 pepA Probable cytosol aminopeptidase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q6DA52 0.0 897 87 0 498 3 pepA Probable cytosol aminopeptidase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
B2VL42 0.0 896 85 0 503 3 pepA Probable cytosol aminopeptidase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
A8AMA5 0.0 892 85 0 503 3 pepA Probable cytosol aminopeptidase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
A9MET9 0.0 890 85 0 503 3 pepA Probable cytosol aminopeptidase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q8ZK29 0.0 889 85 0 503 3 pepA Probable cytosol aminopeptidase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TTA0 0.0 889 85 0 503 3 pepA Probable cytosol aminopeptidase Salmonella schwarzengrund (strain CVM19633)
B5BKS6 0.0 889 85 0 503 3 pepA Probable cytosol aminopeptidase Salmonella paratyphi A (strain AKU_12601)
C0Q7D6 0.0 889 85 0 503 3 pepA Probable cytosol aminopeptidase Salmonella paratyphi C (strain RKS4594)
A9N680 0.0 889 85 0 503 3 pepA Probable cytosol aminopeptidase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PJD4 0.0 889 85 0 503 3 pepA Probable cytosol aminopeptidase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4T3M4 0.0 889 85 0 503 3 pepA Probable cytosol aminopeptidase Salmonella newport (strain SL254)
B4TG58 0.0 889 85 0 503 3 pepA Probable cytosol aminopeptidase Salmonella heidelberg (strain SL476)
B5R9L5 0.0 889 85 0 503 3 pepA Probable cytosol aminopeptidase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5R1K2 0.0 889 85 0 503 3 pepA Probable cytosol aminopeptidase Salmonella enteritidis PT4 (strain P125109)
B5FSH0 0.0 889 85 0 503 3 pepA Probable cytosol aminopeptidase Salmonella dublin (strain CT_02021853)
Q57GC3 0.0 889 85 0 503 3 pepA Probable cytosol aminopeptidase Salmonella choleraesuis (strain SC-B67)
B5F465 0.0 889 85 0 503 3 pepA Probable cytosol aminopeptidase Salmonella agona (strain SL483)
C5BBY4 0.0 888 84 0 503 3 pepA Probable cytosol aminopeptidase Edwardsiella ictaluri (strain 93-146)
Q3YU89 0.0 887 85 0 503 3 pepA Probable cytosol aminopeptidase Shigella sonnei (strain Ss046)
Q0SXK0 0.0 887 85 0 503 3 pepA Probable cytosol aminopeptidase Shigella flexneri serotype 5b (strain 8401)
Q328S1 0.0 887 85 0 503 3 pepA Probable cytosol aminopeptidase Shigella dysenteriae serotype 1 (strain Sd197)
Q8Z116 0.0 887 85 0 503 3 pepA Probable cytosol aminopeptidase Salmonella typhi
Q1R2Z4 0.0 887 85 0 503 3 pepA Probable cytosol aminopeptidase Escherichia coli (strain UTI89 / UPEC)
B1LRE5 0.0 887 85 0 503 3 pepA Probable cytosol aminopeptidase Escherichia coli (strain SMS-3-5 / SECEC)
B6I2H3 0.0 887 85 0 503 3 pepA Probable cytosol aminopeptidase Escherichia coli (strain SE11)
B7NGJ2 0.0 887 85 0 503 3 pepA Probable cytosol aminopeptidase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P68767 0.0 887 85 0 503 1 pepA Cytosol aminopeptidase Escherichia coli (strain K12)
B1ISB1 0.0 887 85 0 503 3 pepA Probable cytosol aminopeptidase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P68766 0.0 887 85 0 503 3 pepA Cytosol aminopeptidase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0T9D1 0.0 887 85 0 503 3 pepA Probable cytosol aminopeptidase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AJG3 0.0 887 85 0 503 3 pepA Probable cytosol aminopeptidase Escherichia coli O1:K1 / APEC
A8A816 0.0 887 85 0 503 3 pepA Probable cytosol aminopeptidase Escherichia coli O9:H4 (strain HS)
B1XEN9 0.0 887 85 0 503 3 pepA Probable cytosol aminopeptidase Escherichia coli (strain K12 / DH10B)
C4ZRD1 0.0 887 85 0 503 3 pepA Probable cytosol aminopeptidase Escherichia coli (strain K12 / MC4100 / BW2952)
B7M9L9 0.0 887 85 0 503 3 pepA Probable cytosol aminopeptidase Escherichia coli O8 (strain IAI1)
B7MSZ3 0.0 887 85 0 503 3 pepA Probable cytosol aminopeptidase Escherichia coli O81 (strain ED1a)
B7NUH4 0.0 887 85 0 503 3 pepA Probable cytosol aminopeptidase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5Z3L7 0.0 887 85 0 503 3 pepA Probable cytosol aminopeptidase Escherichia coli O157:H7 (strain EC4115 / EHEC)
P68768 0.0 887 85 0 503 3 pepA Cytosol aminopeptidase Escherichia coli O157:H7
B7LCX0 0.0 887 85 0 503 3 pepA Probable cytosol aminopeptidase Escherichia coli (strain 55989 / EAEC)
B7MLR5 0.0 887 85 0 503 3 pepA Probable cytosol aminopeptidase Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UQR7 0.0 887 85 0 503 3 pepA Probable cytosol aminopeptidase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A7ZVE0 0.0 887 85 0 503 3 pepA Probable cytosol aminopeptidase Escherichia coli O139:H28 (strain E24377A / ETEC)
Q31TK2 0.0 885 85 0 503 3 pepA Probable cytosol aminopeptidase Shigella boydii serotype 4 (strain Sb227)
B2TYY4 0.0 885 85 0 503 3 pepA Probable cytosol aminopeptidase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
A6THI2 0.0 885 85 0 503 3 pepA Probable cytosol aminopeptidase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B5Y2T8 0.0 885 85 0 503 3 pepA Probable cytosol aminopeptidase Klebsiella pneumoniae (strain 342)
A4WF25 0.0 884 85 0 503 3 pepA Probable cytosol aminopeptidase Enterobacter sp. (strain 638)
Q83P64 0.0 883 85 0 503 3 pepA Probable cytosol aminopeptidase Shigella flexneri
B7LMT2 0.0 883 85 0 503 3 pepA Probable cytosol aminopeptidase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q2NR41 0.0 881 84 0 503 3 pepA Probable cytosol aminopeptidase Sodalis glossinidius (strain morsitans)
C3LR42 0.0 851 79 1 498 3 pepA Probable cytosol aminopeptidase Vibrio cholerae serotype O1 (strain M66-2)
P0C6E1 0.0 851 79 1 498 3 pepA Cytosol aminopeptidase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F5D8 0.0 851 79 1 498 3 pepA Cytosol aminopeptidase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q6LUW0 0.0 847 78 1 499 3 pepA Probable cytosol aminopeptidase Photobacterium profundum (strain SS9)
B6EMT2 0.0 842 77 1 498 3 pepA Probable cytosol aminopeptidase Aliivibrio salmonicida (strain LFI1238)
A7MSE5 0.0 840 77 1 503 3 pepA Probable cytosol aminopeptidase Vibrio campbellii (strain ATCC BAA-1116)
Q87LG8 0.0 838 76 1 503 3 pepA Probable cytosol aminopeptidase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
B5F9Q6 0.0 837 77 1 498 3 pepA Probable cytosol aminopeptidase Aliivibrio fischeri (strain MJ11)
Q5E7T8 0.0 837 76 1 503 3 pepA Probable cytosol aminopeptidase Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q7MHG4 0.0 837 76 1 503 3 pepA Probable cytosol aminopeptidase Vibrio vulnificus (strain YJ016)
Q8DCE5 0.0 837 76 1 503 3 pepA Probable cytosol aminopeptidase Vibrio vulnificus (strain CMCP6)
A4SSA7 0.0 830 77 2 503 3 pepA Probable cytosol aminopeptidase Aeromonas salmonicida (strain A449)
A0KPF3 0.0 830 77 2 503 3 pepA Probable cytosol aminopeptidase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
C4LA51 0.0 821 77 2 503 3 pepA Probable cytosol aminopeptidase Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
A3QBG2 0.0 798 75 1 499 3 pepA Probable cytosol aminopeptidase Shewanella loihica (strain ATCC BAA-1088 / PV-4)
B8CU18 0.0 796 74 1 499 3 pepA Probable cytosol aminopeptidase Shewanella piezotolerans (strain WP3 / JCM 13877)
A8FS02 0.0 796 74 1 503 3 pepA Probable cytosol aminopeptidase Shewanella sediminis (strain HAW-EB3)
Q12QW7 0.0 796 73 1 503 3 pepA Probable cytosol aminopeptidase Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q8EH62 0.0 796 74 1 499 3 pepA2 Probable cytosol aminopeptidase 2 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q086N8 0.0 790 73 1 503 3 pepA Probable cytosol aminopeptidase Shewanella frigidimarina (strain NCIMB 400)
Q488M4 0.0 785 74 2 498 3 pepA Probable cytosol aminopeptidase Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q15PX4 0.0 771 72 2 503 3 pepA Probable cytosol aminopeptidase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q5QY05 0.0 753 70 2 496 3 pepA Probable cytosol aminopeptidase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
A3N1A7 0.0 737 70 1 497 3 pepA Probable cytosol aminopeptidase Actinobacillus pleuropneumoniae serotype 5b (strain L20)
B8F6N9 0.0 730 67 1 499 3 pepA Probable cytosol aminopeptidase Glaesserella parasuis serovar 5 (strain SH0165)
B3GXY6 0.0 730 69 1 497 3 pepA Probable cytosol aminopeptidase Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
B0BQ37 0.0 728 69 1 497 3 pepA Probable cytosol aminopeptidase Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
A1SRZ1 0.0 718 67 2 497 3 pepA Probable cytosol aminopeptidase Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q1LTH8 0.0 711 69 2 497 3 pepA Probable cytosol aminopeptidase Baumannia cicadellinicola subsp. Homalodisca coagulata
C4K346 0.0 683 66 4 498 3 pepA Probable cytosol aminopeptidase Hamiltonella defensa subsp. Acyrthosiphon pisum (strain 5AT)
Q7VNH9 0.0 659 62 1 497 3 pepA Probable cytosol aminopeptidase Haemophilus ducreyi (strain 35000HP / ATCC 700724)
B0UVX4 0.0 631 60 3 497 3 pepA Probable cytosol aminopeptidase Histophilus somni (strain 2336)
B8GTX6 0.0 625 58 2 497 3 pepA Probable cytosol aminopeptidase Thioalkalivibrio sulfidiphilus (strain HL-EbGR7)
P57823 0.0 618 59 3 497 3 pepA Probable cytosol aminopeptidase Pasteurella multocida (strain Pm70)
Q0I236 0.0 618 59 3 497 3 pepA Probable cytosol aminopeptidase Histophilus somni (strain 129Pt)
P45334 0.0 617 58 4 496 3 pepA Cytosol aminopeptidase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A5UBH1 0.0 615 58 4 496 3 pepA Probable cytosol aminopeptidase Haemophilus influenzae (strain PittEE)
Q4QJN7 0.0 615 58 4 496 3 pepA Probable cytosol aminopeptidase Haemophilus influenzae (strain 86-028NP)
A5UFE2 0.0 614 58 4 496 3 pepA Probable cytosol aminopeptidase Haemophilus influenzae (strain PittGG)
Q47BG9 0.0 609 57 2 498 3 pepA Probable cytosol aminopeptidase Dechloromonas aromatica (strain RCB)
Q65SA3 0.0 603 59 4 496 3 pepA Probable cytosol aminopeptidase Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q7NTY9 0.0 592 54 1 500 3 pepA Probable cytosol aminopeptidase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q1H4U4 0.0 589 55 2 498 3 pepA Probable cytosol aminopeptidase Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q2YB18 0.0 583 55 3 499 3 pepA Probable cytosol aminopeptidase Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
A6VMX3 0.0 569 55 5 483 3 pepA Probable cytosol aminopeptidase Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
Q89AG2 0.0 566 50 1 498 3 pepA Probable cytosol aminopeptidase Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q82X54 0.0 558 54 4 498 3 pepA Probable cytosol aminopeptidase Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q8K9I0 0.0 553 52 4 503 3 pepA Probable cytosol aminopeptidase Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
C1DPG2 0.0 547 55 5 498 3 pepA Probable cytosol aminopeptidase Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
Q0AIF5 0.0 544 52 2 497 3 pepA Probable cytosol aminopeptidase Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q4ZXH7 0.0 543 54 5 500 3 pepA Probable cytosol aminopeptidase Pseudomonas syringae pv. syringae (strain B728a)
C3K6G5 0.0 542 55 5 498 3 pepA Probable cytosol aminopeptidase Pseudomonas fluorescens (strain SBW25)
B8D7Q4 0.0 538 51 2 497 3 pepA Probable cytosol aminopeptidase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain Tuc7)
Q3KHM4 0.0 536 54 5 498 3 pepA Probable cytosol aminopeptidase Pseudomonas fluorescens (strain Pf0-1)
P57448 0.0 536 51 2 497 3 pepA Cytosol aminopeptidase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
B8D9F2 0.0 536 51 2 497 3 pepA Probable cytosol aminopeptidase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain 5A)
Q887M0 0.0 536 54 5 500 3 pepA Probable cytosol aminopeptidase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q3JEC8 0.0 533 51 2 497 3 pepA Probable cytosol aminopeptidase Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
Q0AB75 0.0 530 50 2 498 3 pepA Probable cytosol aminopeptidase Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q1I5F9 0.0 530 54 6 500 3 pepA Probable cytosol aminopeptidase Pseudomonas entomophila (strain L48)
A6V0T2 0.0 529 54 4 498 3 pepA Probable cytosol aminopeptidase Pseudomonas aeruginosa (strain PA7)
A5VZ69 0.0 526 52 6 500 3 pepA Probable cytosol aminopeptidase Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q88P73 0.0 525 53 6 500 3 pepA Probable cytosol aminopeptidase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
B1JBA9 0.0 525 53 6 499 3 pepA Probable cytosol aminopeptidase Pseudomonas putida (strain W619)
O68822 0.0 523 54 4 498 3 pepA Cytosol aminopeptidase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
B7UVT6 0.0 523 54 4 498 3 pepA Probable cytosol aminopeptidase Pseudomonas aeruginosa (strain LESB58)
B0KQK8 0.0 522 52 6 500 3 pepA Probable cytosol aminopeptidase Pseudomonas putida (strain GB-1)
Q02RY8 0.0 522 54 4 498 1 pepA Probable cytosol aminopeptidase Pseudomonas aeruginosa (strain UCBPP-PA14)
Q606B9 0.0 520 50 3 498 3 pepA Probable cytosol aminopeptidase Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
O86436 0.0 519 52 6 500 1 pepA Cytosol aminopeptidase Pseudomonas putida
Q7VQT0 2.38e-180 518 50 5 504 3 pepA Probable cytosol aminopeptidase Blochmanniella floridana
A4VNZ7 3.69e-178 512 51 5 497 3 pepA Probable cytosol aminopeptidase Stutzerimonas stutzeri (strain A1501)
A1WUV1 6.61e-178 512 51 2 498 3 pepA Probable cytosol aminopeptidase Halorhodospira halophila (strain DSM 244 / SL1)
B2JET5 8.24e-177 509 49 4 505 3 pepA Probable cytosol aminopeptidase Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
B2T146 1.68e-170 493 48 4 505 3 pepA Probable cytosol aminopeptidase Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
A9AHG9 1.93e-170 493 48 4 506 3 pepA Probable cytosol aminopeptidase Burkholderia multivorans (strain ATCC 17616 / 249)
Q39DS5 2.84e-169 490 47 4 506 3 pepA Probable cytosol aminopeptidase Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q143Y9 3.32e-169 490 48 4 505 3 pepA Probable cytosol aminopeptidase Paraburkholderia xenovorans (strain LB400)
Q1BUE7 3.57e-169 490 48 4 506 3 pepA Probable cytosol aminopeptidase Burkholderia orbicola (strain AU 1054)
A0K9N9 3.57e-169 490 48 4 506 3 pepA Probable cytosol aminopeptidase Burkholderia cenocepacia (strain HI2424)
Q0BCQ2 6.21e-169 489 47 5 510 3 pepA Probable cytosol aminopeptidase Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
B1YUW5 7.32e-169 489 47 4 506 3 pepA Probable cytosol aminopeptidase Burkholderia ambifaria (strain MC40-6)
A1K9L5 1.53e-168 488 48 5 506 3 pepA Probable cytosol aminopeptidase Azoarcus sp. (strain BH72)
B4E8G9 2.89e-168 488 47 4 506 3 pepA Probable cytosol aminopeptidase Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
B2UAK8 3.54e-168 487 49 5 505 3 pepA Probable cytosol aminopeptidase Ralstonia pickettii (strain 12J)
Q2T0C0 7.69e-168 486 48 4 506 3 pepA Probable cytosol aminopeptidase Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q2SKR0 8.86e-168 486 49 5 497 3 pepA Probable cytosol aminopeptidase Hahella chejuensis (strain KCTC 2396)
Q3JV16 1.07e-166 483 48 4 506 3 pepA Probable cytosol aminopeptidase Burkholderia pseudomallei (strain 1710b)
A6T0V4 1.57e-166 483 48 6 505 3 pepA Probable cytosol aminopeptidase Janthinobacterium sp. (strain Marseille)
A4G7P5 1.62e-166 483 48 6 505 3 pepA Probable cytosol aminopeptidase Herminiimonas arsenicoxydans
A1V5Z5 1.73e-166 483 48 4 506 3 pepA Probable cytosol aminopeptidase Burkholderia mallei (strain SAVP1)
Q62LH2 1.73e-166 483 48 4 506 3 pepA Probable cytosol aminopeptidase Burkholderia mallei (strain ATCC 23344)
A2SAC2 1.73e-166 483 48 4 506 3 pepA Probable cytosol aminopeptidase Burkholderia mallei (strain NCTC 10229)
A3MLR1 1.73e-166 483 48 4 506 3 pepA Probable cytosol aminopeptidase Burkholderia mallei (strain NCTC 10247)
Q63WC3 1.79e-166 483 48 4 506 3 pepA Probable cytosol aminopeptidase Burkholderia pseudomallei (strain K96243)
A3N6U4 1.79e-166 483 48 4 506 3 pepA Probable cytosol aminopeptidase Burkholderia pseudomallei (strain 668)
A3NSI1 1.79e-166 483 48 4 506 3 pepA Probable cytosol aminopeptidase Burkholderia pseudomallei (strain 1106a)
B1JWV2 2.56e-166 483 47 4 506 3 pepA Probable cytosol aminopeptidase Burkholderia orbicola (strain MC0-3)
Q5NXM1 2.72e-164 477 48 4 500 3 pepA Probable cytosol aminopeptidase Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
A4JGZ2 1.4e-163 476 47 4 506 3 pepA Probable cytosol aminopeptidase Burkholderia vietnamiensis (strain G4 / LMG 22486)
Q46XT9 2.05e-162 473 46 6 516 3 pepA Probable cytosol aminopeptidase Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q0K7F5 4.49e-162 472 46 6 518 3 pepA Probable cytosol aminopeptidase Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q8D295 2.83e-161 469 45 0 495 3 pepA Probable cytosol aminopeptidase Wigglesworthia glossinidia brevipalpis
Q1LJJ6 4.65e-161 469 46 6 516 3 pepA Probable cytosol aminopeptidase Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
B3R663 6.01e-160 467 45 6 522 3 pepA Probable cytosol aminopeptidase Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
Q8XWQ8 9.22e-157 458 47 5 510 3 pepA Probable cytosol aminopeptidase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q1QTE5 4.52e-155 454 47 1 496 3 pepA Probable cytosol aminopeptidase Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q3BPA1 5.38e-151 443 45 3 497 3 pepA Probable cytosol aminopeptidase Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
B0U1L5 7.62e-151 442 45 4 496 3 pepA Probable cytosol aminopeptidase Xylella fastidiosa (strain M12)
Q9PH08 1.14e-150 442 45 4 496 3 pepA Probable cytosol aminopeptidase Xylella fastidiosa (strain 9a5c)
Q87F32 1.15e-150 442 45 4 496 3 pepA Probable cytosol aminopeptidase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I6L3 1.15e-150 442 45 4 496 3 pepA Probable cytosol aminopeptidase Xylella fastidiosa (strain M23)
Q2KWX0 3.4e-149 439 45 3 504 3 pepA Probable cytosol aminopeptidase Bordetella avium (strain 197N)
Q8PCR4 2.61e-148 436 45 3 497 3 pepA Probable cytosol aminopeptidase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
B0RVI0 2.61e-148 436 45 3 497 3 pepA Probable cytosol aminopeptidase Xanthomonas campestris pv. campestris (strain B100)
Q4UQP6 2.61e-148 436 45 3 497 3 pepA Probable cytosol aminopeptidase Xanthomonas campestris pv. campestris (strain 8004)
Q5H4N2 2.94e-148 436 46 3 497 1 pepA Probable cytosol aminopeptidase Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
B2SPE7 2.94e-148 436 46 3 497 3 pepA Probable cytosol aminopeptidase Xanthomonas oryzae pv. oryzae (strain PXO99A)
Q2P7G2 2.94e-148 436 46 3 497 3 pepA Probable cytosol aminopeptidase Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q7VW48 1.15e-147 435 46 4 501 3 pepA Probable cytosol aminopeptidase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7WD42 1.15e-147 435 46 4 501 3 pepA Probable cytosol aminopeptidase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q7W5K6 5.31e-147 433 46 4 501 3 pepA Probable cytosol aminopeptidase Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
B2FMS4 2.82e-146 431 44 5 499 3 pepA Probable cytosol aminopeptidase Stenotrophomonas maltophilia (strain K279a)
A9IIK3 1.41e-145 429 46 4 500 3 pepA Probable cytosol aminopeptidase Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
Q8PGR0 2.27e-145 429 45 3 497 3 pepA Probable cytosol aminopeptidase Xanthomonas axonopodis pv. citri (strain 306)
B4SJ73 1.01e-143 424 44 3 497 3 pepA Probable cytosol aminopeptidase Stenotrophomonas maltophilia (strain R551-3)
B5EKZ2 7.25e-142 420 43 3 499 3 pepA Probable cytosol aminopeptidase Acidithiobacillus ferrooxidans (strain ATCC 53993 / BNL-5-31)
B7J5I9 7.25e-142 420 43 3 499 3 pepA Probable cytosol aminopeptidase Acidithiobacillus ferrooxidans (strain ATCC 23270 / DSM 14882 / CIP 104768 / NCIMB 8455)
Q21KZ5 2.44e-141 419 45 9 506 3 pepA Probable cytosol aminopeptidase Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q6FFD8 2.21e-138 410 45 8 505 3 pepA Probable cytosol aminopeptidase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
C5BMG6 2.07e-137 409 43 8 515 3 pepA Probable cytosol aminopeptidase Teredinibacter turnerae (strain ATCC 39867 / T7901)
Q0VSA5 4.13e-134 400 42 8 499 3 pepA Probable cytosol aminopeptidase Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q31ET3 5.75e-129 387 42 5 453 3 pepA Probable cytosol aminopeptidase Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
A1VP99 1.07e-128 387 46 7 451 3 pepA Probable cytosol aminopeptidase Polaromonas naphthalenivorans (strain CJ2)
Q5X1Q9 6.21e-128 384 44 9 488 3 pepA Probable cytosol aminopeptidase Legionella pneumophila (strain Paris)
A5IAU5 9.89e-128 383 44 9 488 3 pepA Probable cytosol aminopeptidase Legionella pneumophila (strain Corby)
B0VMG3 2.21e-127 382 49 6 425 3 pepA Probable cytosol aminopeptidase Acinetobacter baumannii (strain SDF)
B0VDC8 2.54e-127 382 49 6 425 3 pepA Probable cytosol aminopeptidase Acinetobacter baumannii (strain AYE)
A3M1A8 2.54e-127 382 49 6 425 3 pepA Probable cytosol aminopeptidase Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
B2I1U0 2.54e-127 382 49 6 425 3 pepA Probable cytosol aminopeptidase Acinetobacter baumannii (strain ACICU)
B7I309 2.54e-127 382 49 6 425 3 pepA Probable cytosol aminopeptidase Acinetobacter baumannii (strain AB0057)
B7H1P9 2.54e-127 382 49 6 425 3 pepA Probable cytosol aminopeptidase Acinetobacter baumannii (strain AB307-0294)
Q12AW5 4.08e-127 382 45 7 446 3 pepA Probable cytosol aminopeptidase Polaromonas sp. (strain JS666 / ATCC BAA-500)
Q5WTG8 5.48e-127 381 43 9 488 3 pepA Probable cytosol aminopeptidase Legionella pneumophila (strain Lens)
C5CLU5 8.95e-127 382 44 5 455 3 pepA Probable cytosol aminopeptidase Variovorax paradoxus (strain S110)
A2SH61 2.34e-125 377 44 4 467 3 pepA Probable cytosol aminopeptidase Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
A5CXK2 6.51e-125 376 43 7 460 3 pepA Probable cytosol aminopeptidase Vesicomyosocius okutanii subsp. Calyptogena okutanii (strain HA)
A1W776 8.17e-122 369 44 10 502 3 pepA Probable cytosol aminopeptidase Acidovorax sp. (strain JS42)
B9MJ44 1.5e-121 368 44 9 485 3 pepA Probable cytosol aminopeptidase Acidovorax ebreus (strain TPSY)
A7NG41 4.09e-120 364 44 9 501 3 pepA Probable cytosol aminopeptidase Roseiflexus castenholzii (strain DSM 13941 / HLO8)
Q21WL3 1.22e-118 360 45 7 457 3 pepA Probable cytosol aminopeptidase Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
A1WSK3 1.77e-116 355 45 8 447 3 pepA Probable cytosol aminopeptidase Verminephrobacter eiseniae (strain EF01-2)
C6E543 3.01e-113 346 39 7 497 3 pepA Probable cytosol aminopeptidase Geobacter sp. (strain M21)
Q3A831 5.21e-113 346 40 6 489 3 pepA Probable cytosol aminopeptidase Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
A5G9C7 4.95e-109 336 39 6 498 3 pepA Probable cytosol aminopeptidase Geotalea uraniireducens (strain Rf4)
Q9JTI8 8.87e-109 334 51 3 329 3 pepA Probable cytosol aminopeptidase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
A0RUA5 4.66e-101 315 37 11 512 3 pepA Probable cytosol aminopeptidase Cenarchaeum symbiosum (strain A)
Q74GB4 1.47e-100 314 39 6 498 3 pepA Probable cytosol aminopeptidase Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
A8ML24 1.82e-100 314 37 9 503 3 pepA Probable cytosol aminopeptidase Alkaliphilus oremlandii (strain OhILAs)
Q9A7M9 2.2e-99 311 37 6 490 3 pepA Probable cytosol aminopeptidase Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q029J4 2.49e-98 308 37 8 501 3 pepA Probable cytosol aminopeptidase Solibacter usitatus (strain Ellin6076)
B5ZWY7 2.82e-97 305 41 7 413 3 pepA Probable cytosol aminopeptidase Rhizobium leguminosarum bv. trifolii (strain WSM2304)
Q1MIZ4 3.97e-97 305 42 10 415 3 pepA Probable cytosol aminopeptidase Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
C3M9C8 7.87e-97 304 40 7 436 3 pepA Probable cytosol aminopeptidase Sinorhizobium fredii (strain NBRC 101917 / NGR234)
C0QSL9 1.35e-96 304 37 10 506 3 pepA Probable cytosol aminopeptidase Persephonella marina (strain DSM 14350 / EX-H1)
B3PUV3 1.5e-96 303 40 9 444 3 pepA Probable cytosol aminopeptidase Rhizobium etli (strain CIAT 652)
Q2KA77 1.92e-96 303 41 5 413 3 pepA Probable cytosol aminopeptidase Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
A5VPM3 9.38e-96 301 40 6 434 3 pepA Probable cytosol aminopeptidase Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q8YG99 1.44e-95 301 40 6 434 3 pepA Probable cytosol aminopeptidase Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q8G1M4 4.21e-95 300 40 6 434 3 pepA Probable cytosol aminopeptidase Brucella suis biovar 1 (strain 1330)
A6TWW9 2.49e-94 298 36 11 503 3 pepA Probable cytosol aminopeptidase Alkaliphilus metalliredigens (strain QYMF)
Q11HH5 3.08e-94 298 38 6 439 3 pepA Probable cytosol aminopeptidase Chelativorans sp. (strain BNC1)
B7HUR5 5.01e-94 297 37 7 487 3 pepA Probable cytosol aminopeptidase Bacillus cereus (strain AH187)
A6X259 6.31e-94 297 40 7 432 3 pepA Probable cytosol aminopeptidase Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
Q92QY7 6.9e-94 296 46 5 341 3 pepA Probable cytosol aminopeptidase Rhizobium meliloti (strain 1021)
A5EIB4 8.39e-94 296 41 7 430 3 pepA Probable cytosol aminopeptidase Bradyrhizobium sp. (strain BTAi1 / ATCC BAA-1182)
A8GXC3 1.22e-93 296 38 14 500 3 pepA Probable cytosol aminopeptidase Rickettsia bellii (strain OSU 85-389)
B2V6F5 1.3e-93 296 34 9 505 3 pepA Probable cytosol aminopeptidase Sulfurihydrogenibium sp. (strain YO3AOP1)
Q07LG0 1.39e-93 296 40 7 440 3 pepA Probable cytosol aminopeptidase Rhodopseudomonas palustris (strain BisA53)
Q1RJN2 1.42e-93 296 38 14 500 3 pepA Probable cytosol aminopeptidase Rickettsia bellii (strain RML369-C)
C5D720 2.17e-93 295 36 6 497 3 pepA Probable cytosol aminopeptidase Geobacillus sp. (strain WCH70)
Q632E1 6.84e-93 294 37 7 487 3 pepA Probable cytosol aminopeptidase Bacillus cereus (strain ZK / E33L)
C1EX85 1.08e-92 293 37 7 487 3 pepA Probable cytosol aminopeptidase Bacillus cereus (strain 03BB102)
A0RKB5 1.08e-92 293 37 7 487 3 pepA Probable cytosol aminopeptidase Bacillus thuringiensis (strain Al Hakam)
A6U7J2 1.22e-92 293 45 5 341 3 pepA Probable cytosol aminopeptidase Sinorhizobium medicae (strain WSM419)
B7JDH9 1.4e-92 293 37 7 487 3 pepA Probable cytosol aminopeptidase Bacillus cereus (strain AH820)
Q81XS5 1.4e-92 293 37 7 487 3 pepA Probable cytosol aminopeptidase Bacillus anthracis
C3LC57 1.4e-92 293 37 7 487 3 pepA Probable cytosol aminopeptidase Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3PDF7 1.4e-92 293 37 7 487 3 pepA Probable cytosol aminopeptidase Bacillus anthracis (strain A0248)
Q6HBY2 1.72e-92 293 37 7 487 3 pepA Probable cytosol aminopeptidase Bacillus thuringiensis subsp. konkukian (strain 97-27)
B9J3C5 1.95e-92 293 37 7 487 3 pepA Probable cytosol aminopeptidase Bacillus cereus (strain Q1)
B9JUW1 3.23e-92 292 48 4 324 3 pepA Probable cytosol aminopeptidase Allorhizobium ampelinum (strain ATCC BAA-846 / DSM 112012 / S4)
B9JCD8 7.57e-92 291 40 8 412 3 pepA Probable cytosol aminopeptidase Rhizobium rhizogenes (strain K84 / ATCC BAA-868)
Q984S1 1.38e-91 291 41 8 413 3 pepA Probable cytosol aminopeptidase Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q8UGC8 1.46e-91 291 45 5 337 3 pepA Probable cytosol aminopeptidase Agrobacterium fabrum (strain C58 / ATCC 33970)
Q72YG1 3.59e-91 290 37 7 487 3 pepA Probable cytosol aminopeptidase Bacillus cereus (strain ATCC 10987 / NRS 248)
B6JGL8 5.55e-91 289 39 5 423 3 pepA Probable cytosol aminopeptidase Afipia carboxidovorans (strain ATCC 49405 / DSM 1227 / KCTC 32145 / OM5)
Q92J85 1.09e-90 288 38 16 503 3 pepA Probable cytosol aminopeptidase Rickettsia conorii (strain ATCC VR-613 / Malish 7)
C3PMI0 1.09e-90 288 38 16 503 3 pepA Probable cytosol aminopeptidase Rickettsia africae (strain ESF-5)
A8F0Q0 1.96e-90 288 38 16 505 3 pepA Probable cytosol aminopeptidase Rickettsia massiliae (strain Mtu5)
A9VMY8 2.93e-90 287 36 8 488 3 pepA Probable cytosol aminopeptidase Bacillus mycoides (strain KBAB4)
A7GUC8 3.34e-90 287 37 9 488 3 pepA Probable cytosol aminopeptidase Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
C4K1N6 4.82e-90 287 38 16 503 3 pepA Probable cytosol aminopeptidase Rickettsia peacockii (strain Rustic)
O67868 6.56e-90 286 35 10 503 3 pepA Probable cytosol aminopeptidase Aquifex aeolicus (strain VF5)
Q893F8 6.81e-90 286 37 12 464 3 pepA Probable cytosol aminopeptidase Clostridium tetani (strain Massachusetts / E88)
Q72F03 7.97e-90 286 35 7 503 3 pepA Probable cytosol aminopeptidase Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q8KD74 1.19e-89 286 46 10 377 3 pepA Probable cytosol aminopeptidase Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
B7IMU0 1.19e-89 286 36 7 487 3 pepA Probable cytosol aminopeptidase Bacillus cereus (strain G9842)
Q4UKD7 2.13e-89 285 38 19 518 3 pepA Probable cytosol aminopeptidase Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q816E3 2.19e-89 285 36 8 488 3 pepA Probable cytosol aminopeptidase Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
A0LK12 3.06e-89 285 37 6 487 3 pepA Probable cytosol aminopeptidase Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
Q215R8 1.89e-88 283 38 7 424 3 pepA Probable cytosol aminopeptidase Rhodopseudomonas palustris (strain BisB18)
A7IFB7 2.01e-88 283 37 10 467 3 pepA Probable cytosol aminopeptidase Xanthobacter autotrophicus (strain ATCC BAA-1158 / Py2)
A8FH04 3.07e-88 282 36 9 490 3 pepA Probable cytosol aminopeptidase Bacillus pumilus (strain SAFR-032)
B7HBG1 4.27e-88 281 35 7 487 3 pepA Probable cytosol aminopeptidase Bacillus cereus (strain B4264)
B1ZAK8 5.87e-88 281 39 6 426 3 pepA Probable cytosol aminopeptidase Methylorubrum populi (strain ATCC BAA-705 / NCIMB 13946 / BJ001)
B3ED46 9.83e-88 281 45 8 342 3 pepA Probable cytosol aminopeptidase Chlorobium limicola (strain DSM 245 / NBRC 103803 / 6330)
B3QNM5 1.37e-87 281 43 8 373 3 pepA Probable cytosol aminopeptidase Chlorobaculum parvum (strain DSM 263 / NCIMB 8327)
Q3SS04 1.7e-87 280 37 8 446 3 pepA Probable cytosol aminopeptidase Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
Q6N5B9 3.23e-87 280 37 8 451 3 pepA Probable cytosol aminopeptidase Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
A8GQW7 4.08e-87 279 37 15 496 3 pepA Probable cytosol aminopeptidase Rickettsia rickettsii (strain Sheila Smith)
B0BWB2 4.08e-87 279 37 15 496 3 pepA Probable cytosol aminopeptidase Rickettsia rickettsii (strain Iowa)
B3Q9R8 1.07e-86 278 37 8 451 3 pepA Probable cytosol aminopeptidase Rhodopseudomonas palustris (strain TIE-1)
Q944P7 1.07e-86 281 36 8 472 2 LAP2 Leucine aminopeptidase 2, chloroplastic Arabidopsis thaliana
Q89MT4 1.87e-86 278 40 8 430 3 pepA Probable cytosol aminopeptidase Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
A1BGN2 1.87e-86 278 47 6 313 3 pepA Probable cytosol aminopeptidase Chlorobium phaeobacteroides (strain DSM 266 / SMG 266 / 2430)
A4WRK9 2.02e-86 277 44 7 362 3 pepA Probable cytosol aminopeptidase Cereibacter sphaeroides (strain ATCC 17025 / ATH 2.4.3)
A8EXL1 2.62e-86 277 37 14 495 3 pepA Probable cytosol aminopeptidase Rickettsia canadensis (strain McKiel)
Q5FU70 5.43e-86 276 39 11 466 3 pepA Probable cytosol aminopeptidase Gluconobacter oxydans (strain 621H)
Q315M7 8.58e-86 276 35 10 465 3 pepA Probable cytosol aminopeptidase Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
B1LVC3 1.35e-85 275 37 7 440 3 pepA Probable cytosol aminopeptidase Methylobacterium radiotolerans (strain ATCC 27329 / DSM 1819 / JCM 2831 / NBRC 15690 / NCIMB 10815 / 0-1)
Q8XHI3 1.83e-85 275 34 7 494 3 pepA Probable cytosol aminopeptidase Clostridium perfringens (strain 13 / Type A)
Q5V9F0 1.89e-85 276 37 11 488 1 lap Cytosol aminopeptidase Dictyostelium discoideum
A9VXD6 3.29e-85 274 38 6 427 3 pepA Probable cytosol aminopeptidase Methylorubrum extorquens (strain PA1)
Q2IX74 3.42e-85 274 39 9 434 3 pepA Probable cytosol aminopeptidase Rhodopseudomonas palustris (strain HaA2)
A4ISE0 3.67e-85 274 35 6 497 3 pepA Probable cytosol aminopeptidase Geobacillus thermodenitrificans (strain NG80-2)
B7KYK4 4.21e-85 274 38 6 426 3 pepA Probable cytosol aminopeptidase Methylorubrum extorquens (strain CM4 / NCIMB 13688)
P30184 4.98e-85 275 34 10 507 1 LAP1 Leucine aminopeptidase 1 Arabidopsis thaliana
C0QC86 8e-85 274 37 9 448 3 pepA Probable cytosol aminopeptidase Desulforapulum autotrophicum (strain ATCC 43914 / DSM 3382 / VKM B-1955 / HRM2)
Q65FE6 1.24e-84 273 34 5 491 3 pepA Probable cytosol aminopeptidase Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q8RHT8 1.3e-84 272 36 9 467 3 pepA Probable cytosol aminopeptidase Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
B8J457 1.31e-84 273 36 12 507 3 pepA Probable cytosol aminopeptidase Desulfovibrio desulfuricans (strain ATCC 27774 / DSM 6949 / MB)
Q1IPU7 1.37e-84 273 35 7 464 3 pepA Probable cytosol aminopeptidase Koribacter versatilis (strain Ellin345)
B3QVE8 1.6e-84 273 42 6 360 3 pepA Probable cytosol aminopeptidase Chloroherpeton thalassium (strain ATCC 35110 / GB-78)
Q73IU2 2.71e-84 272 35 17 517 3 pepA Probable cytosol aminopeptidase Wolbachia pipientis wMel
Q1QKW6 5.03e-84 271 48 3 294 3 pepA Probable cytosol aminopeptidase Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
Q5FFZ5 6.92e-84 271 36 16 502 3 pepA Probable cytosol aminopeptidase Ehrlichia ruminantium (strain Gardel)
Q5HAP2 7.54e-84 271 36 16 502 3 pepA Probable cytosol aminopeptidase Ehrlichia ruminantium (strain Welgevonden)
Q0SQ50 1.5e-83 270 36 5 431 3 pepA Probable cytosol aminopeptidase Clostridium perfringens (strain SM101 / Type A)
A7Z8B5 1.52e-83 270 34 8 492 3 pepA Probable cytosol aminopeptidase Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
Q135P8 2.74e-83 269 48 3 291 3 pepA Probable cytosol aminopeptidase Rhodopseudomonas palustris (strain BisB5)
Q8F0Q1 6.52e-83 268 40 5 371 3 pepA Probable cytosol aminopeptidase Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q11A96 7.06e-83 268 34 8 508 3 pepA Probable cytosol aminopeptidase Trichodesmium erythraeum (strain IMS101)
Q72UC6 1.85e-82 267 40 5 371 3 pepA Probable cytosol aminopeptidase Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
B1YKV4 1.39e-81 264 34 8 474 3 pepA Probable cytosol aminopeptidase Exiguobacterium sibiricum (strain DSM 17290 / CCUG 55495 / CIP 109462 / JCM 13490 / 255-15)
A3PEG6 2.06e-81 264 34 15 515 3 pepA Probable cytosol aminopeptidase Prochlorococcus marinus (strain MIT 9301)
Q319F5 3.09e-81 264 34 14 509 3 pepA Probable cytosol aminopeptidase Prochlorococcus marinus (strain MIT 9312)
A8LI79 3.83e-81 263 36 11 487 3 pepA Probable cytosol aminopeptidase Dinoroseobacter shibae (strain DSM 16493 / NCIMB 14021 / DFL 12)
C1F4B7 3.96e-81 264 36 4 447 3 pepA Probable cytosol aminopeptidase Acidobacterium capsulatum (strain ATCC 51196 / DSM 11244 / BCRC 80197 / JCM 7670 / NBRC 15755 / NCIMB 13165 / 161)
Q8RX72 4.14e-81 266 35 10 474 2 LAP3 Leucine aminopeptidase 3, chloroplastic Arabidopsis thaliana
B8HTK3 5.07e-81 263 34 10 487 3 pepA Probable cytosol aminopeptidase Cyanothece sp. (strain PCC 7425 / ATCC 29141)
Q3B4B5 5.3e-81 264 37 12 472 3 pepA Probable cytosol aminopeptidase Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
B3R0N4 1.1e-80 263 41 4 331 3 pepA Probable cytosol aminopeptidase Phytoplasma mali (strain AT)
Q0I816 1.22e-80 262 35 15 506 3 pepA Probable cytosol aminopeptidase Synechococcus sp. (strain CC9311)
Q73QZ3 3.65e-80 260 35 12 489 3 pepA Probable cytosol aminopeptidase Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
O32106 8.62e-80 260 33 5 464 3 pepA Probable cytosol aminopeptidase Bacillus subtilis (strain 168)
Q68XM6 1.22e-79 260 46 7 323 3 pepA Probable cytosol aminopeptidase Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q6K669 1.23e-79 263 35 7 471 2 Os02g0794700 Leucine aminopeptidase 2, chloroplastic Oryza sativa subsp. japonica
A2BSQ4 2.76e-79 259 33 14 509 3 pepA Probable cytosol aminopeptidase Prochlorococcus marinus (strain AS9601)
Q7NHC6 6.34e-79 258 33 7 512 3 pepA Probable cytosol aminopeptidase Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q2JRU4 7.17e-79 258 37 14 515 3 pepA Probable cytosol aminopeptidase Synechococcus sp. (strain JA-3-3Ab)
B1V932 7.76e-79 258 37 13 431 3 pepA Probable cytosol aminopeptidase Phytoplasma australiense
P27888 1.71e-78 257 46 7 323 3 pepA Cytosol aminopeptidase Rickettsia prowazekii (strain Madrid E)
A8G6E3 3.14e-78 256 33 15 513 3 pepA Probable cytosol aminopeptidase Prochlorococcus marinus (strain MIT 9215)
Q8DI46 3.39e-78 256 36 9 487 3 pepA Probable cytosol aminopeptidase Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q6AJZ3 4.07e-78 256 38 11 459 3 pepA Probable cytosol aminopeptidase Desulfotalea psychrophila (strain LSv54 / DSM 12343)
Q7V0D4 5.37e-78 255 33 15 511 3 pepA Probable cytosol aminopeptidase Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
P28839 7.53e-78 256 40 5 374 1 LAP3 Cytosol aminopeptidase Sus scrofa
B1WR01 1.53e-77 254 35 10 488 3 pepA Probable cytosol aminopeptidase Crocosphaera subtropica (strain ATCC 51142 / BH68)
P28838 3.35e-77 254 39 4 374 1 LAP3 Cytosol aminopeptidase Homo sapiens
B7K4A4 3.59e-77 253 34 11 492 3 pepA Probable cytosol aminopeptidase Rippkaea orientalis (strain PCC 8801 / RF-1)
Q7UJ62 6.85e-77 253 42 5 329 3 pepA Probable cytosol aminopeptidase Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
P00727 1.3e-76 253 39 5 374 1 LAP3 Cytosol aminopeptidase Bos taurus
Q68FS4 9.33e-76 250 39 4 374 1 Lap3 Cytosol aminopeptidase Rattus norvegicus
Q42876 1.22e-75 251 36 13 477 2 LAPA2 Leucine aminopeptidase 2, chloroplastic Solanum lycopersicum
Q9CPY7 1.57e-75 249 39 4 374 1 Lap3 Cytosol aminopeptidase Mus musculus
B1XK83 1.8e-75 249 35 9 485 3 pepA Probable cytosol aminopeptidase Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
Q6MH10 2.77e-75 248 32 7 455 3 pepA Probable cytosol aminopeptidase Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
Q9Z8F8 4.45e-75 248 36 9 433 3 pepA Probable cytosol aminopeptidase Chlamydia pneumoniae
Q67NI4 1.41e-74 246 36 8 448 3 pepA Probable cytosol aminopeptidase Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
A5GN62 1.83e-74 246 42 9 344 3 pepA Probable cytosol aminopeptidase Synechococcus sp. (strain WH7803)
Q5XGB9 2.14e-74 247 44 7 331 2 lap3 Cytosol aminopeptidase Xenopus tropicalis
Q7VAP4 5.76e-74 245 35 15 505 3 pepA Probable cytosol aminopeptidase Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
A9BBV5 7.49e-74 244 34 15 510 3 pepA Probable cytosol aminopeptidase Prochlorococcus marinus (strain MIT 9211)
Q7M8W6 4.34e-73 242 38 7 366 3 pepA Probable cytosol aminopeptidase Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
Q2JKL5 6.63e-73 243 36 10 480 3 pepA Probable cytosol aminopeptidase Synechococcus sp. (strain JA-2-3B'a(2-13))
B0CCF6 7.82e-73 242 40 4 327 3 pepA Probable cytosol aminopeptidase Acaryochloris marina (strain MBIC 11017)
Q6MC72 1.35e-72 241 32 15 516 3 pepA Probable cytosol aminopeptidase Protochlamydia amoebophila (strain UWE25)
B7KCB0 2.65e-72 240 34 7 485 3 pepA Probable cytosol aminopeptidase Gloeothece citriformis (strain PCC 7424)
Q3AZE8 4.12e-72 240 35 14 514 3 pepA Probable cytosol aminopeptidase Synechococcus sp. (strain CC9902)
O84049 1.23e-71 239 34 12 470 1 pepA Probable cytosol aminopeptidase Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
P38019 1.35e-71 239 34 12 470 3 pepA Probable cytosol aminopeptidase Chlamydia muridarum (strain MoPn / Nigg)
Q3KMX6 1.48e-71 239 34 11 470 3 pepA Probable cytosol aminopeptidase Chlamydia trachomatis serovar A (strain ATCC VR-571B / DSM 19440 / HAR-13)
Q8IL11 1.61e-71 241 34 15 474 1 LAP Leucine aminopeptidase Plasmodium falciparum (isolate 3D7)
B0BB32 3.46e-71 238 34 12 470 3 pepA Probable cytosol aminopeptidase Chlamydia trachomatis serovar L2b (strain UCH-1/proctitis)
B0B9F3 3.46e-71 238 34 12 470 3 pepA Probable cytosol aminopeptidase Chlamydia trachomatis serovar L2 (strain ATCC VR-902B / DSM 19102 / 434/Bu)
P73971 3.95e-71 237 33 10 490 3 pepA Probable cytosol aminopeptidase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q3AHT4 1.27e-70 236 35 17 513 3 pepA Probable cytosol aminopeptidase Synechococcus sp. (strain CC9605)
O32956 7.84e-70 235 35 14 502 3 pepA Probable cytosol aminopeptidase Mycobacterium leprae (strain TN)
A5GV03 1.01e-69 234 43 8 333 3 pepA Probable cytosol aminopeptidase Synechococcus sp. (strain RCC307)
Q3M9J6 1.39e-69 233 33 8 487 3 pepA Probable cytosol aminopeptidase Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q7V5X8 1.64e-69 233 34 13 516 3 pepA Probable cytosol aminopeptidase Prochlorococcus marinus (strain MIT 9313)
Q7VGF0 2e-69 232 41 4 298 3 pepA Probable cytosol aminopeptidase Helicobacter hepaticus (strain ATCC 51449 / 3B1)
Q2QSB9 2.19e-69 234 40 5 336 3 Os12g0434400 Putative leucine aminopeptidase 1 Oryza sativa subsp. japonica
A0PTP9 2.31e-69 233 40 9 361 3 pepA Probable cytosol aminopeptidase Mycobacterium ulcerans (strain Agy99)
C1AQC8 3.41e-69 233 37 13 445 3 pepA Probable cytosol aminopeptidase Mycobacterium bovis (strain BCG / Tokyo 172 / ATCC 35737 / TMC 1019)
A1KKQ5 3.41e-69 233 37 13 445 3 pepA Probable cytosol aminopeptidase Mycobacterium bovis (strain BCG / Pasteur 1173P2)
Q7VEN5 3.41e-69 233 37 13 445 3 pepA Probable cytosol aminopeptidase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q254B9 3.67e-69 232 35 12 443 3 pepA Probable cytosol aminopeptidase Chlamydia felis (strain Fe/C-56)
Q8Z064 4.99e-69 232 33 8 487 3 pepA Probable cytosol aminopeptidase Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q5YZ53 5.13e-69 232 35 9 431 3 pepA Probable cytosol aminopeptidase Nocardia farcinica (strain IFM 10152)
B9DIX2 6.8e-69 231 34 7 432 3 pepA Probable cytosol aminopeptidase Staphylococcus carnosus (strain TM300)
P9WHT3 7.2e-69 232 37 13 445 1 pepA Probable cytosol aminopeptidase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WHT2 7.2e-69 232 37 13 445 3 pepA Probable cytosol aminopeptidase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U4P1 7.2e-69 232 37 13 445 3 pepA Probable cytosol aminopeptidase Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
B2J3G8 2.2e-68 230 32 10 501 3 pepA Probable cytosol aminopeptidase Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
B2HGY2 2.36e-68 231 40 8 360 3 pepA Probable cytosol aminopeptidase Mycobacterium marinum (strain ATCC BAA-535 / M)
B0JL23 2.86e-68 230 40 4 327 3 pepA Probable cytosol aminopeptidase Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
Q8EI85 4.27e-68 229 37 13 454 3 pepA1 Probable cytosol aminopeptidase 1 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q7U8Q1 9.93e-68 228 34 12 506 3 pepA Probable cytosol aminopeptidase Parasynechococcus marenigrum (strain WH8102)
Q9PP04 1.03e-67 228 39 8 348 3 pepA Probable cytosol aminopeptidase Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
B5Z6U1 1.1e-67 228 38 5 351 3 pepA Probable cytosol aminopeptidase Helicobacter pylori (strain G27)
Q823J9 1.43e-67 228 42 6 300 3 pepA Probable cytosol aminopeptidase Chlamydia caviae (strain ATCC VR-813 / DSM 19441 / 03DC25 / GPIC)
Q5L681 1.64e-67 228 42 7 305 3 pepA Probable cytosol aminopeptidase Chlamydia abortus (strain DSM 27085 / S26/3)
O25294 2.42e-67 228 38 5 351 1 pepA Cytosol aminopeptidase Helicobacter pylori (strain ATCC 700392 / 26695)
B6JLF2 5.92e-67 226 37 6 375 3 pepA Probable cytosol aminopeptidase Helicobacter pylori (strain P12)
P31427 5.96e-67 228 35 13 475 2 LAP Leucine aminopeptidase, chloroplastic Solanum tuberosum
Q6NG90 7.01e-67 226 34 10 452 3 pepA Probable cytosol aminopeptidase Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
B2UTQ8 7.7e-67 226 37 7 379 3 pepA Probable cytosol aminopeptidase Helicobacter pylori (strain Shi470)
Q1CTV6 8.46e-67 226 37 6 375 3 pepA Probable cytosol aminopeptidase Helicobacter pylori (strain HPAG1)
Q1B6R7 1.11e-65 224 34 14 472 3 pepA Probable cytosol aminopeptidase Mycobacterium sp. (strain MCS)
A1UIA8 1.11e-65 224 34 14 472 3 pepA Probable cytosol aminopeptidase Mycobacterium sp. (strain KMS)
A3Q1S2 1.39e-65 223 34 13 472 3 pepA Probable cytosol aminopeptidase Mycobacterium sp. (strain JLS)
B1VZN5 2.71e-65 223 35 11 506 3 pepA Probable cytosol aminopeptidase Streptomyces griseus subsp. griseus (strain JCM 4626 / CBS 651.72 / NBRC 13350 / KCC S-0626 / ISP 5235)
Q8NNJ4 2.86e-65 222 41 7 317 3 pepA Probable cytosol aminopeptidase Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
A5K3U9 2.99e-65 225 33 17 483 1 LAP Leucine aminopeptidase Plasmodium vivax (strain Salvador I)
Q73YK2 6.89e-65 221 36 9 424 3 pepA Probable cytosol aminopeptidase Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q17W06 2.21e-64 219 37 5 351 3 pepA Probable cytosol aminopeptidase Helicobacter acinonychis (strain Sheeba)
Q82AN2 3.23e-64 219 33 8 496 3 pepA Probable cytosol aminopeptidase Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q9ZLR1 3.98e-64 219 37 5 353 3 pepA Cytosol aminopeptidase Helicobacter pylori (strain J99 / ATCC 700824)
C1A138 4.14e-64 219 34 11 453 3 pepA Probable cytosol aminopeptidase Rhodococcus erythropolis (strain PR4 / NBRC 100887)
Q10712 1.41e-63 219 34 11 474 1 LAPA1 Leucine aminopeptidase 1, chloroplastic Solanum lycopersicum
Q8SQZ7 2.44e-63 217 36 8 363 1 ECU10_1770i Cytosol aminopeptidase Encephalitozoon cuniculi (strain GB-M1)
C1AUB5 3.12e-63 217 35 10 427 3 pepA Probable cytosol aminopeptidase Rhodococcus opacus (strain B4)
Q6A9W5 4.04e-63 217 36 8 422 3 pepA Probable cytosol aminopeptidase Cutibacterium acnes (strain DSM 16379 / KPA171202)
Q0SHL0 1.14e-62 215 35 9 425 3 pepA Probable cytosol aminopeptidase Rhodococcus jostii (strain RHA1)
Q9Y935 3.72e-62 214 33 10 404 3 pepA Probable cytosol aminopeptidase Aeropyrum pernix (strain ATCC 700893 / DSM 11879 / JCM 9820 / NBRC 100138 / K1)
Q9S2Q7 4.52e-62 214 43 5 324 3 pepA Probable cytosol aminopeptidase Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
O06865 1.54e-61 212 40 5 331 3 pepA Probable cytosol aminopeptidase Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P47707 3.12e-61 212 33 9 452 3 pepA Probable cytosol aminopeptidase Metamycoplasma salivarium
C5CCM4 3.85e-61 211 36 10 450 3 pepA Probable cytosol aminopeptidase Micrococcus luteus (strain ATCC 4698 / DSM 20030 / JCM 1464 / CCM 169 / CCUG 5858 / IAM 1056 / NBRC 3333 / NCIMB 9278 / NCTC 2665 / VKM Ac-2230)
Q7MNF5 4.26e-61 209 41 6 321 3 pepB Peptidase B Vibrio vulnificus (strain YJ016)
Q8DEZ4 4.26e-61 209 41 6 321 3 pepB Peptidase B Vibrio vulnificus (strain CMCP6)
A7MU37 6.49e-61 209 41 6 321 3 pepB Peptidase B Vibrio campbellii (strain ATCC BAA-1116)
B7VJT3 1.13e-60 208 41 6 321 3 pepB Peptidase B Vibrio atlanticus (strain LGP32)
Q6AFG2 1.44e-60 209 42 7 322 3 pepA Probable cytosol aminopeptidase Leifsonia xyli subsp. xyli (strain CTCB07)
Q83G32 1.68e-60 209 38 11 400 3 pepA Probable cytosol aminopeptidase Tropheryma whipplei (strain Twist)
Q83I32 1.68e-60 209 38 11 400 3 pepA Probable cytosol aminopeptidase Tropheryma whipplei (strain TW08/27)
Q5N569 3.4e-60 208 40 5 331 3 pepA Probable cytosol aminopeptidase Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q6D266 6.16e-60 206 40 8 327 3 pepB Peptidase B Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q87S21 8.06e-60 206 40 7 332 3 pepB Peptidase B Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
A5CRI6 9.76e-60 207 43 7 295 3 pepA Probable cytosol aminopeptidase Clavibacter michiganensis subsp. michiganensis (strain NCPPB 382)
Q9KTX5 7.29e-59 203 39 7 338 3 pepB Peptidase B Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q8FNP8 1.4e-58 204 32 15 502 3 pepA Probable cytosol aminopeptidase Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
A8GHX6 1.54e-58 202 40 9 343 3 pepB Peptidase B Serratia proteamaculans (strain 568)
A6TCE4 2.01e-58 202 41 6 320 3 pepB Peptidase B Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B5Z0Z6 2.68e-58 202 41 6 320 3 pepB Peptidase B Escherichia coli O157:H7 (strain EC4115 / EHEC)
P58473 2.68e-58 202 41 6 320 3 pepB Peptidase B Escherichia coli O157:H7
Q0T1Z6 1.08e-57 200 40 6 320 3 pepB Peptidase B Shigella flexneri serotype 5b (strain 8401)
Q3YZ29 1.32e-57 200 40 6 320 3 pepB Peptidase B Shigella sonnei (strain Ss046)
B6I595 1.32e-57 200 40 6 320 3 pepB Peptidase B Escherichia coli (strain SE11)
B7M7M6 1.32e-57 200 40 6 320 3 pepB Peptidase B Escherichia coli O8 (strain IAI1)
B7LDB5 1.32e-57 200 40 6 320 3 pepB Peptidase B Escherichia coli (strain 55989 / EAEC)
A7MGW9 1.45e-57 200 41 6 320 3 pepB Peptidase B Cronobacter sakazakii (strain ATCC BAA-894)
Q32D41 1.59e-57 199 40 6 320 3 pepB Peptidase B Shigella dysenteriae serotype 1 (strain Sd197)
A7ZPW6 1.75e-57 199 40 6 320 3 pepB Peptidase B Escherichia coli O139:H28 (strain E24377A / ETEC)
B1IWD8 1.82e-57 199 40 6 320 3 pepB Peptidase B Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A329 1.82e-57 199 40 6 320 3 pepB Peptidase B Escherichia coli O9:H4 (strain HS)
P37095 2.04e-57 199 40 6 320 1 pepB Peptidase B Escherichia coli (strain K12)
B1XAZ8 2.04e-57 199 40 6 320 3 pepB Peptidase B Escherichia coli (strain K12 / DH10B)
C4ZX98 2.04e-57 199 40 6 320 3 pepB Peptidase B Escherichia coli (strain K12 / MC4100 / BW2952)
Q83QK5 2.13e-57 199 40 6 320 3 pepB Peptidase B Shigella flexneri
Q1R8K9 2.49e-57 199 40 6 320 3 pepB Peptidase B Escherichia coli (strain UTI89 / UPEC)
A1AE61 2.49e-57 199 40 6 320 3 pepB Peptidase B Escherichia coli O1:K1 / APEC
B7MI07 2.49e-57 199 40 6 320 3 pepB Peptidase B Escherichia coli O45:K1 (strain S88 / ExPEC)
Q8FF47 2.65e-57 199 40 6 320 3 pepB Peptidase B Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TEW2 2.65e-57 199 40 6 320 3 pepB Peptidase B Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B7MYF7 2.65e-57 199 40 6 320 3 pepB Peptidase B Escherichia coli O81 (strain ED1a)
B7UGW9 2.65e-57 199 40 6 320 3 pepB Peptidase B Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B7LKB6 3.75e-57 199 40 6 320 3 pepB Peptidase B Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q7N231 4.3e-57 199 40 5 289 3 pepB Peptidase B Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q9CM16 5.24e-57 198 38 8 327 3 pepB Peptidase B Pasteurella multocida (strain Pm70)
B1LNH8 5.88e-57 198 40 6 320 3 pepB Peptidase B Escherichia coli (strain SMS-3-5 / SECEC)
B7N6B0 6.39e-57 198 40 6 320 3 pepB Peptidase B Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q31XW7 8.13e-57 198 40 6 320 3 pepB Peptidase B Shigella boydii serotype 4 (strain Sb227)
B2TXU8 8.13e-57 198 40 6 320 3 pepB Peptidase B Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q4QM33 1.47e-56 197 40 5 289 3 pepB Peptidase B Haemophilus influenzae (strain 86-028NP)
B5XNK4 3.22e-55 194 40 6 320 3 pepB Peptidase B Klebsiella pneumoniae (strain 342)
B5RD05 4.43e-55 193 40 6 320 3 pepB Peptidase B Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5R595 4.43e-55 193 40 6 320 3 pepB Peptidase B Salmonella enteritidis PT4 (strain P125109)
B5FR78 4.43e-55 193 40 6 320 3 pepB Peptidase B Salmonella dublin (strain CT_02021853)
P58474 4.95e-55 193 40 5 289 5 pepB Putative peptidase B Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A9MHK1 1.06e-54 192 40 6 320 3 pepB Peptidase B Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q09735 1.41e-54 194 36 6 339 3 SPAC13A11.05 Putative aminopeptidase C13A11.05 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
A4WDA4 1.54e-54 192 38 7 334 3 pepB Peptidase B Enterobacter sp. (strain 638)
Q9RF52 1.56e-54 192 40 6 320 1 pepB Peptidase B Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
C0PYL4 1.56e-54 192 40 6 320 3 pepB Peptidase B Salmonella paratyphi C (strain RKS4594)
A9N1Y3 1.56e-54 192 40 6 320 3 pepB Peptidase B Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4T0R5 1.56e-54 192 40 6 320 3 pepB Peptidase B Salmonella newport (strain SL254)
B5F1B3 1.56e-54 192 40 6 320 3 pepB Peptidase B Salmonella agona (strain SL483)
Q8Z4N3 2.12e-54 191 40 6 320 3 pepB Peptidase B Salmonella typhi
A8AD60 3.91e-54 191 40 6 320 3 pepB Peptidase B Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q57LH5 6.58e-54 190 39 6 320 3 pepB Peptidase B Salmonella choleraesuis (strain SC-B67)
B7NRH2 1.14e-53 189 40 6 320 3 pepB Peptidase B Escherichia coli O7:K1 (strain IAI39 / ExPEC)
C6DBI4 1.21e-52 187 39 7 326 3 pepB Peptidase B Pectobacterium carotovorum subsp. carotovorum (strain PC1)
B1JRZ6 3.75e-51 183 40 9 345 3 pepB Peptidase B Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
A4TMU7 3.75e-51 183 40 9 345 3 pepB Peptidase B Yersinia pestis (strain Pestoides F)
Q1CKA2 3.75e-51 183 40 9 345 3 pepB Peptidase B Yersinia pestis bv. Antiqua (strain Nepal516)
A9R811 3.75e-51 183 40 9 345 3 pepB Peptidase B Yersinia pestis bv. Antiqua (strain Angola)
P58475 3.75e-51 183 40 9 345 1 pepB Peptidase B Yersinia pestis
Q1C5H7 3.75e-51 183 40 9 345 3 pepB Peptidase B Yersinia pestis bv. Antiqua (strain Antiqua)
Q667Y8 3.83e-51 183 40 9 345 3 pepB Peptidase B Yersinia pseudotuberculosis serotype I (strain IP32953)
B2K9R0 3.83e-51 183 40 9 345 3 pepB Peptidase B Yersinia pseudotuberculosis serotype IB (strain PB1/+)
A7FFX8 2.76e-50 181 40 9 345 3 pepB Peptidase B Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
P47631 1.99e-49 179 36 8 294 3 pepA Probable cytosol aminopeptidase Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)

  • Number of RefSeq hits:

General

Source Morganella morganii S3
Locus tag LHKJJB_13530
Feature type CDS
Gene pepA
Product leucyl aminopeptidase
Location 147189 - 148700 (strand: -1)
Length 1512 (nucleotides) / 503 (amino acids)

Contig

Accession ZDB_370
Length 162442 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1431
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00883 Cytosol aminopeptidase family, catalytic domain
PF02789 Cytosol aminopeptidase family, N-terminal domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0260 Amino acid transport and metabolism (E) E Leucyl aminopeptidase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K01255 leucyl aminopeptidase [EC:3.4.11.1] Glutathione metabolism
Metabolic pathways
-

Protein Sequence

MEFSVKSGSPEKQRSACIVVGVFEPRRLSPVVEQLDKISDGYISALLRRGELEGKVGQSLLLHHVPNVLSERILLIGCGKERELDERQYKQIIRTTINTLNETGSMEAVCFLTELHVKGRNNYWKVRQAVETAKESLYVFDQLKSNKTELRRPLRKLVFNVPTRRELPTGEKAISHGLAIAAGIKAAKDLANMPPNICNAAYLASQARQLADSNSPVLSTRVIGEEQMKELGMLAYLAVGQGSRNESLMSVIEYKGNPDPEARPIVLVGKGLTFDSGGISIKPADSMDEMKYDMCGAATVYGVMRVVAELGLPLNVIGILAGCENMPGGNAYRPGDILTTMSGQTVEVLNTDAEGRLVLCDTLTYAERFDPETVIDIATLTGACMVALGNHFSGLMANHNPLAHELLNASEQAGDRAWRLPLAEEFYEQIESNFADLANTGGRLGGAITAGCFLSRFATRYNWAHLDIAGTAWRSGKNKGATGRPVALLSQFLLNRAGISTDD

Flanking regions ( +/- flanking 50bp)

TACATTTTAGCGGCAGCAGTTGTCTTTGTCTTTAAGATTCAGGAGAGCGCATGGAGTTTAGTGTAAAAAGCGGCAGCCCGGAAAAGCAGCGCAGTGCTTGTATTGTGGTCGGGGTTTTCGAACCGCGTCGTCTGTCTCCTGTGGTGGAGCAGCTCGATAAAATCAGCGACGGCTACATCAGTGCTCTGCTGCGCCGCGGCGAGCTGGAGGGCAAGGTCGGGCAGTCTCTGCTTCTGCACCATGTCCCGAATGTCCTGTCCGAGCGTATCCTGTTAATCGGCTGCGGGAAAGAGCGTGAACTGGATGAACGCCAGTACAAACAGATTATCCGGACGACCATCAATACCCTGAATGAAACCGGGTCAATGGAAGCCGTCTGTTTTCTGACCGAGTTACATGTCAAAGGCCGCAATAACTACTGGAAAGTCCGGCAGGCGGTTGAAACAGCCAAAGAATCTCTCTATGTCTTTGATCAGCTGAAGAGTAACAAAACCGAATTACGCCGTCCGCTGCGCAAGCTGGTCTTCAATGTACCGACCCGCCGCGAACTGCCGACCGGCGAAAAAGCGATCAGCCACGGTCTGGCGATTGCCGCCGGTATCAAAGCCGCGAAAGATCTGGCCAATATGCCGCCGAACATCTGTAATGCCGCTTATCTGGCATCTCAGGCACGTCAGCTGGCAGACAGCAACTCTCCGGTGCTCAGTACCCGTGTGATCGGCGAAGAGCAGATGAAAGAGCTGGGCATGCTGGCGTATCTGGCCGTCGGCCAGGGATCACGTAATGAATCCCTGATGTCGGTGATTGAATATAAAGGTAATCCGGATCCGGAAGCGCGTCCGATCGTGTTAGTCGGCAAAGGCCTGACCTTTGACTCCGGCGGTATTTCCATCAAACCGGCTGACAGCATGGATGAGATGAAATACGACATGTGCGGCGCGGCAACCGTCTACGGCGTGATGCGCGTGGTGGCGGAGCTGGGTTTACCGCTCAATGTGATCGGAATTCTCGCGGGCTGTGAAAACATGCCGGGCGGCAATGCCTATCGTCCGGGGGATATCCTCACCACCATGTCAGGCCAGACAGTCGAAGTGCTCAATACCGATGCGGAAGGCCGCCTGGTACTGTGTGACACCCTGACCTACGCCGAGCGTTTTGATCCGGAAACGGTGATTGATATCGCCACACTGACCGGCGCCTGCATGGTCGCACTCGGTAACCACTTCAGCGGCCTGATGGCAAACCACAATCCGCTGGCGCACGAGTTACTGAATGCCTCTGAACAGGCGGGTGACCGTGCATGGCGTCTGCCGCTGGCAGAAGAGTTCTACGAGCAGATCGAGTCCAATTTTGCGGATCTGGCAAACACCGGCGGCCGTCTCGGCGGCGCTATCACAGCGGGCTGCTTCCTGTCCCGTTTTGCCACCCGTTATAACTGGGCGCATCTGGATATCGCCGGAACCGCATGGCGCTCCGGAAAAAACAAAGGTGCGACAGGTCGTCCGGTTGCACTGCTGTCACAATTCCTGTTAAATCGTGCGGGTATCAGCACCGACGACTGACCGGAATTGCCGGGCCTTTACGGCCCGGAAAAAGCATAAAGGTAACGGGG