Homologs in group_1488

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_08840 FBDBKF_08840 96.2 Morganella morganii S1 pepA leucyl aminopeptidase
EHELCC_12680 EHELCC_12680 96.2 Morganella morganii S2 pepA leucyl aminopeptidase
NLDBIP_13020 NLDBIP_13020 96.2 Morganella morganii S4 pepA leucyl aminopeptidase
LHKJJB_13530 LHKJJB_13530 96.2 Morganella morganii S3 pepA leucyl aminopeptidase
HKOGLL_11495 HKOGLL_11495 96.2 Morganella morganii S5 pepA leucyl aminopeptidase
PMI_RS17265 PMI_RS17265 89.6 Proteus mirabilis HI4320 pepA leucyl aminopeptidase

Distribution of the homologs in the orthogroup group_1488

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1488

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B4F2N1 0.0 954 89 1 503 3 pepA Probable cytosol aminopeptidase Proteus mirabilis (strain HI4320)
A1JJ31 0.0 936 87 0 503 3 pepA Probable cytosol aminopeptidase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
B1JLS9 0.0 932 87 0 503 3 pepA Probable cytosol aminopeptidase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66F09 0.0 932 87 0 503 3 pepA Probable cytosol aminopeptidase Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TQP6 0.0 932 87 0 503 3 pepA Probable cytosol aminopeptidase Yersinia pestis (strain Pestoides F)
Q1CM01 0.0 932 87 0 503 3 pepA Probable cytosol aminopeptidase Yersinia pestis bv. Antiqua (strain Nepal516)
A9R5F5 0.0 932 87 0 503 3 pepA Probable cytosol aminopeptidase Yersinia pestis bv. Antiqua (strain Angola)
Q8ZBH3 0.0 932 87 0 503 3 pepA Probable cytosol aminopeptidase Yersinia pestis
B2K3E9 0.0 932 87 0 503 3 pepA Probable cytosol aminopeptidase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C3R8 0.0 932 87 0 503 3 pepA Probable cytosol aminopeptidase Yersinia pestis bv. Antiqua (strain Antiqua)
A7FML9 0.0 932 87 0 503 3 pepA Probable cytosol aminopeptidase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A8G978 0.0 922 85 0 503 3 pepA Probable cytosol aminopeptidase Serratia proteamaculans (strain 568)
Q7MZ27 0.0 907 86 1 506 3 pepA Probable cytosol aminopeptidase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
B2VL42 0.0 902 85 0 503 3 pepA Probable cytosol aminopeptidase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
C6DJN2 0.0 901 86 0 498 3 pepA Probable cytosol aminopeptidase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q6DA52 0.0 900 87 0 498 3 pepA Probable cytosol aminopeptidase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A8AMA5 0.0 900 85 0 503 3 pepA Probable cytosol aminopeptidase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
C5BBY4 0.0 899 85 0 503 3 pepA Probable cytosol aminopeptidase Edwardsiella ictaluri (strain 93-146)
A9MET9 0.0 899 85 0 503 3 pepA Probable cytosol aminopeptidase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q8ZK29 0.0 898 85 0 503 3 pepA Probable cytosol aminopeptidase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TTA0 0.0 898 85 0 503 3 pepA Probable cytosol aminopeptidase Salmonella schwarzengrund (strain CVM19633)
B5BKS6 0.0 898 85 0 503 3 pepA Probable cytosol aminopeptidase Salmonella paratyphi A (strain AKU_12601)
C0Q7D6 0.0 898 85 0 503 3 pepA Probable cytosol aminopeptidase Salmonella paratyphi C (strain RKS4594)
A9N680 0.0 898 85 0 503 3 pepA Probable cytosol aminopeptidase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PJD4 0.0 898 85 0 503 3 pepA Probable cytosol aminopeptidase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4T3M4 0.0 898 85 0 503 3 pepA Probable cytosol aminopeptidase Salmonella newport (strain SL254)
B4TG58 0.0 898 85 0 503 3 pepA Probable cytosol aminopeptidase Salmonella heidelberg (strain SL476)
B5R9L5 0.0 898 85 0 503 3 pepA Probable cytosol aminopeptidase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5R1K2 0.0 898 85 0 503 3 pepA Probable cytosol aminopeptidase Salmonella enteritidis PT4 (strain P125109)
B5FSH0 0.0 898 85 0 503 3 pepA Probable cytosol aminopeptidase Salmonella dublin (strain CT_02021853)
Q57GC3 0.0 898 85 0 503 3 pepA Probable cytosol aminopeptidase Salmonella choleraesuis (strain SC-B67)
B5F465 0.0 898 85 0 503 3 pepA Probable cytosol aminopeptidase Salmonella agona (strain SL483)
Q3YU89 0.0 897 85 0 503 3 pepA Probable cytosol aminopeptidase Shigella sonnei (strain Ss046)
Q0SXK0 0.0 897 85 0 503 3 pepA Probable cytosol aminopeptidase Shigella flexneri serotype 5b (strain 8401)
Q328S1 0.0 897 85 0 503 3 pepA Probable cytosol aminopeptidase Shigella dysenteriae serotype 1 (strain Sd197)
Q1R2Z4 0.0 897 85 0 503 3 pepA Probable cytosol aminopeptidase Escherichia coli (strain UTI89 / UPEC)
B1LRE5 0.0 897 85 0 503 3 pepA Probable cytosol aminopeptidase Escherichia coli (strain SMS-3-5 / SECEC)
B6I2H3 0.0 897 85 0 503 3 pepA Probable cytosol aminopeptidase Escherichia coli (strain SE11)
B7NGJ2 0.0 897 85 0 503 3 pepA Probable cytosol aminopeptidase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P68767 0.0 897 85 0 503 1 pepA Cytosol aminopeptidase Escherichia coli (strain K12)
B1ISB1 0.0 897 85 0 503 3 pepA Probable cytosol aminopeptidase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P68766 0.0 897 85 0 503 3 pepA Cytosol aminopeptidase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0T9D1 0.0 897 85 0 503 3 pepA Probable cytosol aminopeptidase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AJG3 0.0 897 85 0 503 3 pepA Probable cytosol aminopeptidase Escherichia coli O1:K1 / APEC
A8A816 0.0 897 85 0 503 3 pepA Probable cytosol aminopeptidase Escherichia coli O9:H4 (strain HS)
B1XEN9 0.0 897 85 0 503 3 pepA Probable cytosol aminopeptidase Escherichia coli (strain K12 / DH10B)
C4ZRD1 0.0 897 85 0 503 3 pepA Probable cytosol aminopeptidase Escherichia coli (strain K12 / MC4100 / BW2952)
B7M9L9 0.0 897 85 0 503 3 pepA Probable cytosol aminopeptidase Escherichia coli O8 (strain IAI1)
B7MSZ3 0.0 897 85 0 503 3 pepA Probable cytosol aminopeptidase Escherichia coli O81 (strain ED1a)
B7NUH4 0.0 897 85 0 503 3 pepA Probable cytosol aminopeptidase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5Z3L7 0.0 897 85 0 503 3 pepA Probable cytosol aminopeptidase Escherichia coli O157:H7 (strain EC4115 / EHEC)
P68768 0.0 897 85 0 503 3 pepA Cytosol aminopeptidase Escherichia coli O157:H7
B7LCX0 0.0 897 85 0 503 3 pepA Probable cytosol aminopeptidase Escherichia coli (strain 55989 / EAEC)
B7MLR5 0.0 897 85 0 503 3 pepA Probable cytosol aminopeptidase Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UQR7 0.0 897 85 0 503 3 pepA Probable cytosol aminopeptidase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A7ZVE0 0.0 897 85 0 503 3 pepA Probable cytosol aminopeptidase Escherichia coli O139:H28 (strain E24377A / ETEC)
Q31TK2 0.0 896 85 0 503 3 pepA Probable cytosol aminopeptidase Shigella boydii serotype 4 (strain Sb227)
B2TYY4 0.0 896 85 0 503 3 pepA Probable cytosol aminopeptidase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q8Z116 0.0 895 85 0 503 3 pepA Probable cytosol aminopeptidase Salmonella typhi
A6THI2 0.0 895 85 0 503 3 pepA Probable cytosol aminopeptidase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B5Y2T8 0.0 895 85 0 503 3 pepA Probable cytosol aminopeptidase Klebsiella pneumoniae (strain 342)
B7LMT2 0.0 895 85 0 503 3 pepA Probable cytosol aminopeptidase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q83P64 0.0 894 85 0 503 3 pepA Probable cytosol aminopeptidase Shigella flexneri
A4WF25 0.0 892 85 0 503 3 pepA Probable cytosol aminopeptidase Enterobacter sp. (strain 638)
Q2NR41 0.0 888 84 0 503 3 pepA Probable cytosol aminopeptidase Sodalis glossinidius (strain morsitans)
C3LR42 0.0 865 80 1 498 3 pepA Probable cytosol aminopeptidase Vibrio cholerae serotype O1 (strain M66-2)
P0C6E1 0.0 865 80 1 498 3 pepA Cytosol aminopeptidase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F5D8 0.0 865 80 1 498 3 pepA Cytosol aminopeptidase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
A7MSE5 0.0 858 78 1 503 3 pepA Probable cytosol aminopeptidase Vibrio campbellii (strain ATCC BAA-1116)
Q87LG8 0.0 858 78 1 503 3 pepA Probable cytosol aminopeptidase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
B6EMT2 0.0 854 78 1 498 3 pepA Probable cytosol aminopeptidase Aliivibrio salmonicida (strain LFI1238)
Q6LUW0 0.0 854 78 1 499 3 pepA Probable cytosol aminopeptidase Photobacterium profundum (strain SS9)
B5F9Q6 0.0 852 78 1 498 3 pepA Probable cytosol aminopeptidase Aliivibrio fischeri (strain MJ11)
Q7MHG4 0.0 851 77 1 503 3 pepA Probable cytosol aminopeptidase Vibrio vulnificus (strain YJ016)
Q8DCE5 0.0 851 77 1 503 3 pepA Probable cytosol aminopeptidase Vibrio vulnificus (strain CMCP6)
Q5E7T8 0.0 851 78 1 498 3 pepA Probable cytosol aminopeptidase Aliivibrio fischeri (strain ATCC 700601 / ES114)
A4SSA7 0.0 835 77 2 503 3 pepA Probable cytosol aminopeptidase Aeromonas salmonicida (strain A449)
A0KPF3 0.0 835 77 2 503 3 pepA Probable cytosol aminopeptidase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
C4LA51 0.0 830 78 2 503 3 pepA Probable cytosol aminopeptidase Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
A3QBG2 0.0 808 76 1 499 3 pepA Probable cytosol aminopeptidase Shewanella loihica (strain ATCC BAA-1088 / PV-4)
A8FS02 0.0 806 75 1 503 3 pepA Probable cytosol aminopeptidase Shewanella sediminis (strain HAW-EB3)
B8CU18 0.0 804 75 1 499 3 pepA Probable cytosol aminopeptidase Shewanella piezotolerans (strain WP3 / JCM 13877)
Q12QW7 0.0 800 74 1 503 3 pepA Probable cytosol aminopeptidase Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q8EH62 0.0 800 75 1 499 3 pepA2 Probable cytosol aminopeptidase 2 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q086N8 0.0 795 73 1 503 3 pepA Probable cytosol aminopeptidase Shewanella frigidimarina (strain NCIMB 400)
Q488M4 0.0 794 74 2 498 3 pepA Probable cytosol aminopeptidase Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q15PX4 0.0 778 72 2 503 3 pepA Probable cytosol aminopeptidase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q5QY05 0.0 753 69 2 496 3 pepA Probable cytosol aminopeptidase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
A3N1A7 0.0 738 69 1 497 3 pepA Probable cytosol aminopeptidase Actinobacillus pleuropneumoniae serotype 5b (strain L20)
B3GXY6 0.0 733 69 1 497 3 pepA Probable cytosol aminopeptidase Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
B0BQ37 0.0 729 69 1 497 3 pepA Probable cytosol aminopeptidase Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
B8F6N9 0.0 729 66 1 499 3 pepA Probable cytosol aminopeptidase Glaesserella parasuis serovar 5 (strain SH0165)
A1SRZ1 0.0 722 67 2 497 3 pepA Probable cytosol aminopeptidase Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q1LTH8 0.0 703 67 2 497 3 pepA Probable cytosol aminopeptidase Baumannia cicadellinicola subsp. Homalodisca coagulata
C4K346 0.0 680 65 4 498 3 pepA Probable cytosol aminopeptidase Hamiltonella defensa subsp. Acyrthosiphon pisum (strain 5AT)
Q7VNH9 0.0 660 62 1 497 3 pepA Probable cytosol aminopeptidase Haemophilus ducreyi (strain 35000HP / ATCC 700724)
B0UVX4 0.0 634 60 3 497 3 pepA Probable cytosol aminopeptidase Histophilus somni (strain 2336)
B8GTX6 0.0 628 58 2 497 3 pepA Probable cytosol aminopeptidase Thioalkalivibrio sulfidiphilus (strain HL-EbGR7)
Q0I236 0.0 622 59 3 497 3 pepA Probable cytosol aminopeptidase Histophilus somni (strain 129Pt)
A5UBH1 0.0 619 59 4 496 3 pepA Probable cytosol aminopeptidase Haemophilus influenzae (strain PittEE)
Q4QJN7 0.0 619 59 4 496 3 pepA Probable cytosol aminopeptidase Haemophilus influenzae (strain 86-028NP)
P57823 0.0 617 58 3 497 3 pepA Probable cytosol aminopeptidase Pasteurella multocida (strain Pm70)
P45334 0.0 617 58 4 496 3 pepA Cytosol aminopeptidase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A5UFE2 0.0 614 58 4 496 3 pepA Probable cytosol aminopeptidase Haemophilus influenzae (strain PittGG)
Q65SA3 0.0 608 60 4 496 3 pepA Probable cytosol aminopeptidase Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q47BG9 0.0 606 57 2 498 3 pepA Probable cytosol aminopeptidase Dechloromonas aromatica (strain RCB)
Q7NTY9 0.0 591 54 1 500 3 pepA Probable cytosol aminopeptidase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q1H4U4 0.0 588 55 2 498 3 pepA Probable cytosol aminopeptidase Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q2YB18 0.0 583 55 3 499 3 pepA Probable cytosol aminopeptidase Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
A6VMX3 0.0 572 55 5 483 3 pepA Probable cytosol aminopeptidase Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
Q89AG2 0.0 565 50 1 498 3 pepA Probable cytosol aminopeptidase Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q8K9I0 0.0 554 52 4 503 3 pepA Probable cytosol aminopeptidase Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q82X54 0.0 553 54 4 498 3 pepA Probable cytosol aminopeptidase Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q4ZXH7 0.0 547 54 5 500 3 pepA Probable cytosol aminopeptidase Pseudomonas syringae pv. syringae (strain B728a)
C3K6G5 0.0 547 55 5 498 3 pepA Probable cytosol aminopeptidase Pseudomonas fluorescens (strain SBW25)
C1DPG2 0.0 546 55 5 498 3 pepA Probable cytosol aminopeptidase Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
B8D7Q4 0.0 543 51 2 497 3 pepA Probable cytosol aminopeptidase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain Tuc7)
Q887M0 0.0 542 55 5 500 3 pepA Probable cytosol aminopeptidase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
P57448 0.0 541 51 2 497 3 pepA Cytosol aminopeptidase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
B8D9F2 0.0 540 51 2 497 3 pepA Probable cytosol aminopeptidase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain 5A)
Q3KHM4 0.0 538 54 5 498 3 pepA Probable cytosol aminopeptidase Pseudomonas fluorescens (strain Pf0-1)
Q0AIF5 0.0 537 51 2 497 3 pepA Probable cytosol aminopeptidase Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q3JEC8 0.0 536 51 2 497 3 pepA Probable cytosol aminopeptidase Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
A6V0T2 0.0 535 54 4 498 3 pepA Probable cytosol aminopeptidase Pseudomonas aeruginosa (strain PA7)
Q0AB75 0.0 530 50 2 498 3 pepA Probable cytosol aminopeptidase Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q1I5F9 0.0 530 54 6 500 3 pepA Probable cytosol aminopeptidase Pseudomonas entomophila (strain L48)
O68822 0.0 529 54 4 498 3 pepA Cytosol aminopeptidase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02RY8 0.0 529 54 4 498 1 pepA Probable cytosol aminopeptidase Pseudomonas aeruginosa (strain UCBPP-PA14)
B7UVT6 0.0 529 54 4 498 3 pepA Probable cytosol aminopeptidase Pseudomonas aeruginosa (strain LESB58)
B1JBA9 0.0 528 53 6 499 3 pepA Probable cytosol aminopeptidase Pseudomonas putida (strain W619)
A5VZ69 0.0 526 52 7 502 3 pepA Probable cytosol aminopeptidase Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
B0KQK8 0.0 523 52 7 502 3 pepA Probable cytosol aminopeptidase Pseudomonas putida (strain GB-1)
Q88P73 0.0 521 52 7 502 3 pepA Probable cytosol aminopeptidase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
O86436 0.0 520 52 6 500 1 pepA Cytosol aminopeptidase Pseudomonas putida
Q606B9 1.55e-179 516 50 3 498 3 pepA Probable cytosol aminopeptidase Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
A4VNZ7 3.01e-179 515 51 5 497 3 pepA Probable cytosol aminopeptidase Stutzerimonas stutzeri (strain A1501)
Q7VQT0 7.53e-179 514 49 5 504 3 pepA Probable cytosol aminopeptidase Blochmanniella floridana
A1WUV1 1.01e-176 509 50 2 498 3 pepA Probable cytosol aminopeptidase Halorhodospira halophila (strain DSM 244 / SL1)
B2JET5 5.18e-175 504 48 4 505 3 pepA Probable cytosol aminopeptidase Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
A9AHG9 3.99e-172 497 49 4 506 3 pepA Probable cytosol aminopeptidase Burkholderia multivorans (strain ATCC 17616 / 249)
B2T146 7.55e-172 497 48 4 505 3 pepA Probable cytosol aminopeptidase Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
Q143Y9 1.14e-171 496 48 4 505 3 pepA Probable cytosol aminopeptidase Paraburkholderia xenovorans (strain LB400)
Q2SKR0 5.74e-171 494 50 5 497 3 pepA Probable cytosol aminopeptidase Hahella chejuensis (strain KCTC 2396)
Q39DS5 1e-170 494 48 4 506 3 pepA Probable cytosol aminopeptidase Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q1BUE7 4.17e-170 492 48 4 506 3 pepA Probable cytosol aminopeptidase Burkholderia orbicola (strain AU 1054)
A0K9N9 4.17e-170 492 48 4 506 3 pepA Probable cytosol aminopeptidase Burkholderia cenocepacia (strain HI2424)
B4E8G9 5.13e-170 492 48 4 506 3 pepA Probable cytosol aminopeptidase Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
Q0BCQ2 1.92e-169 490 47 4 506 3 pepA Probable cytosol aminopeptidase Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
B1YUW5 2.09e-169 490 47 4 506 3 pepA Probable cytosol aminopeptidase Burkholderia ambifaria (strain MC40-6)
A1K9L5 1.06e-168 488 48 5 506 3 pepA Probable cytosol aminopeptidase Azoarcus sp. (strain BH72)
Q2T0C0 1.97e-168 488 48 5 507 3 pepA Probable cytosol aminopeptidase Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
B1JWV2 4.92e-168 487 48 4 506 3 pepA Probable cytosol aminopeptidase Burkholderia orbicola (strain MC0-3)
A4G7P5 9.05e-168 486 48 6 505 3 pepA Probable cytosol aminopeptidase Herminiimonas arsenicoxydans
Q3JV16 2.69e-167 485 48 5 507 3 pepA Probable cytosol aminopeptidase Burkholderia pseudomallei (strain 1710b)
Q63WC3 3.1e-167 485 48 5 507 3 pepA Probable cytosol aminopeptidase Burkholderia pseudomallei (strain K96243)
A3N6U4 3.1e-167 485 48 5 507 3 pepA Probable cytosol aminopeptidase Burkholderia pseudomallei (strain 668)
A3NSI1 3.1e-167 485 48 5 507 3 pepA Probable cytosol aminopeptidase Burkholderia pseudomallei (strain 1106a)
A1V5Z5 7.82e-167 484 48 5 507 3 pepA Probable cytosol aminopeptidase Burkholderia mallei (strain SAVP1)
Q62LH2 7.82e-167 484 48 5 507 3 pepA Probable cytosol aminopeptidase Burkholderia mallei (strain ATCC 23344)
A2SAC2 7.82e-167 484 48 5 507 3 pepA Probable cytosol aminopeptidase Burkholderia mallei (strain NCTC 10229)
A3MLR1 7.82e-167 484 48 5 507 3 pepA Probable cytosol aminopeptidase Burkholderia mallei (strain NCTC 10247)
A6T0V4 1.46e-166 483 47 6 505 3 pepA Probable cytosol aminopeptidase Janthinobacterium sp. (strain Marseille)
B2UAK8 8.2e-166 481 48 5 505 3 pepA Probable cytosol aminopeptidase Ralstonia pickettii (strain 12J)
Q5NXM1 1.15e-164 478 48 4 500 3 pepA Probable cytosol aminopeptidase Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
A4JGZ2 1.85e-164 478 48 4 506 3 pepA Probable cytosol aminopeptidase Burkholderia vietnamiensis (strain G4 / LMG 22486)
Q0K7F5 1.24e-163 476 47 6 518 3 pepA Probable cytosol aminopeptidase Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q8D295 4.19e-163 474 46 0 495 3 pepA Probable cytosol aminopeptidase Wigglesworthia glossinidia brevipalpis
Q46XT9 1.02e-162 474 46 6 516 3 pepA Probable cytosol aminopeptidase Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q1LJJ6 3.68e-162 472 46 6 516 3 pepA Probable cytosol aminopeptidase Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
B3R663 5.49e-161 469 46 6 522 3 pepA Probable cytosol aminopeptidase Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
Q1QTE5 1.88e-157 460 48 1 496 3 pepA Probable cytosol aminopeptidase Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q8XWQ8 7.2e-156 456 46 5 510 3 pepA Probable cytosol aminopeptidase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
B0U1L5 6.39e-152 445 45 4 496 3 pepA Probable cytosol aminopeptidase Xylella fastidiosa (strain M12)
Q9PH08 1.08e-151 445 45 4 496 3 pepA Probable cytosol aminopeptidase Xylella fastidiosa (strain 9a5c)
Q87F32 1.32e-151 444 45 4 496 3 pepA Probable cytosol aminopeptidase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I6L3 1.32e-151 444 45 4 496 3 pepA Probable cytosol aminopeptidase Xylella fastidiosa (strain M23)
Q3BPA1 7.54e-151 442 45 3 497 3 pepA Probable cytosol aminopeptidase Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q2KWX0 3.01e-150 441 45 3 504 3 pepA Probable cytosol aminopeptidase Bordetella avium (strain 197N)
B2FMS4 3.94e-149 438 45 5 499 3 pepA Probable cytosol aminopeptidase Stenotrophomonas maltophilia (strain K279a)
Q5H4N2 2.37e-148 436 46 4 499 1 pepA Probable cytosol aminopeptidase Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
B2SPE7 2.37e-148 436 46 4 499 3 pepA Probable cytosol aminopeptidase Xanthomonas oryzae pv. oryzae (strain PXO99A)
Q2P7G2 2.37e-148 436 46 4 499 3 pepA Probable cytosol aminopeptidase Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q7VW48 2.73e-148 436 47 4 501 3 pepA Probable cytosol aminopeptidase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7WD42 2.73e-148 436 47 4 501 3 pepA Probable cytosol aminopeptidase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q8PCR4 2.76e-148 436 45 4 499 3 pepA Probable cytosol aminopeptidase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
B0RVI0 2.76e-148 436 45 4 499 3 pepA Probable cytosol aminopeptidase Xanthomonas campestris pv. campestris (strain B100)
Q4UQP6 2.76e-148 436 45 4 499 3 pepA Probable cytosol aminopeptidase Xanthomonas campestris pv. campestris (strain 8004)
Q7W5K6 9.64e-148 435 47 4 501 3 pepA Probable cytosol aminopeptidase Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q8PGR0 1.1e-146 432 45 4 499 3 pepA Probable cytosol aminopeptidase Xanthomonas axonopodis pv. citri (strain 306)
A9IIK3 2.08e-146 431 46 4 500 3 pepA Probable cytosol aminopeptidase Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
B4SJ73 4.5e-146 431 45 4 499 3 pepA Probable cytosol aminopeptidase Stenotrophomonas maltophilia (strain R551-3)
Q21KZ5 2.2e-142 421 45 9 504 3 pepA Probable cytosol aminopeptidase Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
B5EKZ2 2.55e-141 419 43 3 499 3 pepA Probable cytosol aminopeptidase Acidithiobacillus ferrooxidans (strain ATCC 53993 / BNL-5-31)
B7J5I9 2.55e-141 419 43 3 499 3 pepA Probable cytosol aminopeptidase Acidithiobacillus ferrooxidans (strain ATCC 23270 / DSM 14882 / CIP 104768 / NCIMB 8455)
Q6FFD8 1.13e-138 411 45 7 505 3 pepA Probable cytosol aminopeptidase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q0VSA5 5.89e-136 404 43 8 499 3 pepA Probable cytosol aminopeptidase Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
C5BMG6 6.1e-136 405 43 8 515 3 pepA Probable cytosol aminopeptidase Teredinibacter turnerae (strain ATCC 39867 / T7901)
Q31ET3 1.19e-128 386 42 5 453 3 pepA Probable cytosol aminopeptidase Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
B0VDC8 1.59e-128 385 54 3 362 3 pepA Probable cytosol aminopeptidase Acinetobacter baumannii (strain AYE)
A3M1A8 1.59e-128 385 54 3 362 3 pepA Probable cytosol aminopeptidase Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
B2I1U0 1.59e-128 385 54 3 362 3 pepA Probable cytosol aminopeptidase Acinetobacter baumannii (strain ACICU)
B7I309 1.59e-128 385 54 3 362 3 pepA Probable cytosol aminopeptidase Acinetobacter baumannii (strain AB0057)
B7H1P9 1.59e-128 385 54 3 362 3 pepA Probable cytosol aminopeptidase Acinetobacter baumannii (strain AB307-0294)
B0VMG3 1.75e-128 385 54 3 362 3 pepA Probable cytosol aminopeptidase Acinetobacter baumannii (strain SDF)
A1VP99 2.69e-128 385 46 7 451 3 pepA Probable cytosol aminopeptidase Polaromonas naphthalenivorans (strain CJ2)
A5CXK2 1.8e-127 382 43 7 460 3 pepA Probable cytosol aminopeptidase Vesicomyosocius okutanii subsp. Calyptogena okutanii (strain HA)
Q12AW5 2.59e-127 383 45 7 446 3 pepA Probable cytosol aminopeptidase Polaromonas sp. (strain JS666 / ATCC BAA-500)
Q5X1Q9 4.6e-127 382 43 9 488 3 pepA Probable cytosol aminopeptidase Legionella pneumophila (strain Paris)
A5IAU5 1.08e-126 380 43 9 488 3 pepA Probable cytosol aminopeptidase Legionella pneumophila (strain Corby)
Q5WTG8 4.57e-126 379 43 9 488 3 pepA Probable cytosol aminopeptidase Legionella pneumophila (strain Lens)
C5CLU5 2.76e-125 378 44 4 455 3 pepA Probable cytosol aminopeptidase Variovorax paradoxus (strain S110)
A2SH61 7.57e-124 373 44 4 467 3 pepA Probable cytosol aminopeptidase Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
A1W776 1.34e-121 368 44 9 485 3 pepA Probable cytosol aminopeptidase Acidovorax sp. (strain JS42)
B9MJ44 1.39e-121 368 45 7 455 3 pepA Probable cytosol aminopeptidase Acidovorax ebreus (strain TPSY)
A7NG41 4.22e-118 359 43 9 501 3 pepA Probable cytosol aminopeptidase Roseiflexus castenholzii (strain DSM 13941 / HLO8)
Q21WL3 4.66e-118 358 45 7 457 3 pepA Probable cytosol aminopeptidase Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
C6E543 1.76e-115 352 39 8 498 3 pepA Probable cytosol aminopeptidase Geobacter sp. (strain M21)
A1WSK3 1.96e-115 353 45 8 448 3 pepA Probable cytosol aminopeptidase Verminephrobacter eiseniae (strain EF01-2)
Q3A831 3.64e-115 352 41 6 489 3 pepA Probable cytosol aminopeptidase Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
A5G9C7 2.03e-111 342 39 6 498 3 pepA Probable cytosol aminopeptidase Geotalea uraniireducens (strain Rf4)
Q9JTI8 1.96e-107 331 49 3 331 3 pepA Probable cytosol aminopeptidase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
A0RUA5 5.43e-102 317 40 10 463 3 pepA Probable cytosol aminopeptidase Cenarchaeum symbiosum (strain A)
Q74GB4 1.46e-101 317 38 6 498 3 pepA Probable cytosol aminopeptidase Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
A8ML24 4.01e-101 315 37 9 503 3 pepA Probable cytosol aminopeptidase Alkaliphilus oremlandii (strain OhILAs)
Q029J4 7.74e-101 314 37 8 501 3 pepA Probable cytosol aminopeptidase Solibacter usitatus (strain Ellin6076)
Q9A7M9 3.72e-99 310 37 5 464 3 pepA Probable cytosol aminopeptidase Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q1MIZ4 2.57e-98 308 43 10 415 3 pepA Probable cytosol aminopeptidase Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
C3M9C8 5.26e-98 307 41 7 436 3 pepA Probable cytosol aminopeptidase Sinorhizobium fredii (strain NBRC 101917 / NGR234)
B5ZWY7 1.43e-97 306 42 9 414 3 pepA Probable cytosol aminopeptidase Rhizobium leguminosarum bv. trifolii (strain WSM2304)
B3PUV3 3.35e-97 305 40 9 444 3 pepA Probable cytosol aminopeptidase Rhizobium etli (strain CIAT 652)
Q2KA77 7.3e-97 304 42 5 413 3 pepA Probable cytosol aminopeptidase Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
C0QSL9 3.57e-96 303 37 10 506 3 pepA Probable cytosol aminopeptidase Persephonella marina (strain DSM 14350 / EX-H1)
B7HUR5 4.93e-96 302 37 7 487 3 pepA Probable cytosol aminopeptidase Bacillus cereus (strain AH187)
A6TWW9 3.22e-95 300 36 8 500 3 pepA Probable cytosol aminopeptidase Alkaliphilus metalliredigens (strain QYMF)
A5VPM3 4.12e-95 300 41 5 413 3 pepA Probable cytosol aminopeptidase Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q632E1 6.06e-95 299 37 7 487 3 pepA Probable cytosol aminopeptidase Bacillus cereus (strain ZK / E33L)
Q11HH5 9.17e-95 299 39 6 439 3 pepA Probable cytosol aminopeptidase Chelativorans sp. (strain BNC1)
Q8YG99 1.02e-94 298 40 6 434 3 pepA Probable cytosol aminopeptidase Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
C1EX85 1.17e-94 298 37 7 487 3 pepA Probable cytosol aminopeptidase Bacillus cereus (strain 03BB102)
A0RKB5 1.17e-94 298 37 7 487 3 pepA Probable cytosol aminopeptidase Bacillus thuringiensis (strain Al Hakam)
Q6HBY2 1.4e-94 298 37 7 487 3 pepA Probable cytosol aminopeptidase Bacillus thuringiensis subsp. konkukian (strain 97-27)
B7JDH9 1.4e-94 298 37 7 487 3 pepA Probable cytosol aminopeptidase Bacillus cereus (strain AH820)
Q81XS5 1.4e-94 298 37 7 487 3 pepA Probable cytosol aminopeptidase Bacillus anthracis
C3LC57 1.4e-94 298 37 7 487 3 pepA Probable cytosol aminopeptidase Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3PDF7 1.4e-94 298 37 7 487 3 pepA Probable cytosol aminopeptidase Bacillus anthracis (strain A0248)
Q8G1M4 1.71e-94 298 40 5 413 3 pepA Probable cytosol aminopeptidase Brucella suis biovar 1 (strain 1330)
B9J3C5 1.77e-94 298 37 7 487 3 pepA Probable cytosol aminopeptidase Bacillus cereus (strain Q1)
Q92QY7 1.85e-94 298 46 5 341 3 pepA Probable cytosol aminopeptidase Rhizobium meliloti (strain 1021)
A8GXC3 7.69e-94 297 38 14 500 3 pepA Probable cytosol aminopeptidase Rickettsia bellii (strain OSU 85-389)
A6X259 7.73e-94 296 40 7 432 3 pepA Probable cytosol aminopeptidase Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
Q1RJN2 7.78e-94 297 37 13 499 3 pepA Probable cytosol aminopeptidase Rickettsia bellii (strain RML369-C)
B2V6F5 1.82e-93 296 34 9 505 3 pepA Probable cytosol aminopeptidase Sulfurihydrogenibium sp. (strain YO3AOP1)
A6U7J2 3.48e-93 295 45 5 341 3 pepA Probable cytosol aminopeptidase Sinorhizobium medicae (strain WSM419)
Q72YG1 3.63e-93 295 37 7 487 3 pepA Probable cytosol aminopeptidase Bacillus cereus (strain ATCC 10987 / NRS 248)
Q984S1 3.7e-93 295 41 8 413 3 pepA Probable cytosol aminopeptidase Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
C5D720 4.6e-93 295 36 6 497 3 pepA Probable cytosol aminopeptidase Geobacillus sp. (strain WCH70)
B9JUW1 1.97e-92 293 48 4 324 3 pepA Probable cytosol aminopeptidase Allorhizobium ampelinum (strain ATCC BAA-846 / DSM 112012 / S4)
Q07LG0 4.25e-92 292 40 7 440 3 pepA Probable cytosol aminopeptidase Rhodopseudomonas palustris (strain BisA53)
B9JCD8 6.58e-92 291 40 8 412 3 pepA Probable cytosol aminopeptidase Rhizobium rhizogenes (strain K84 / ATCC BAA-868)
B7IMU0 7.69e-92 291 36 7 487 3 pepA Probable cytosol aminopeptidase Bacillus cereus (strain G9842)
A5EIB4 8.39e-92 291 40 7 430 3 pepA Probable cytosol aminopeptidase Bradyrhizobium sp. (strain BTAi1 / ATCC BAA-1182)
Q816E3 1.59e-91 290 36 8 488 3 pepA Probable cytosol aminopeptidase Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
A7GUC8 3.42e-91 290 37 9 488 3 pepA Probable cytosol aminopeptidase Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q8UGC8 3.78e-91 290 45 5 337 3 pepA Probable cytosol aminopeptidase Agrobacterium fabrum (strain C58 / ATCC 33970)
A9VMY8 4.31e-91 289 36 8 488 3 pepA Probable cytosol aminopeptidase Bacillus mycoides (strain KBAB4)
A8F0Q0 1.36e-90 288 37 15 508 3 pepA Probable cytosol aminopeptidase Rickettsia massiliae (strain Mtu5)
Q92J85 2.48e-90 288 38 16 507 3 pepA Probable cytosol aminopeptidase Rickettsia conorii (strain ATCC VR-613 / Malish 7)
C3PMI0 2.48e-90 288 38 16 507 3 pepA Probable cytosol aminopeptidase Rickettsia africae (strain ESF-5)
B7HBG1 3.47e-90 287 36 7 487 3 pepA Probable cytosol aminopeptidase Bacillus cereus (strain B4264)
Q8KD74 3.7e-90 287 46 10 377 3 pepA Probable cytosol aminopeptidase Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
C4K1N6 1.15e-89 286 38 16 507 3 pepA Probable cytosol aminopeptidase Rickettsia peacockii (strain Rustic)
Q893F8 1.64e-89 285 48 4 312 3 pepA Probable cytosol aminopeptidase Clostridium tetani (strain Massachusetts / E88)
Q4UKD7 1.85e-89 285 38 19 517 3 pepA Probable cytosol aminopeptidase Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q72F03 1.96e-89 285 35 7 503 3 pepA Probable cytosol aminopeptidase Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
B6JGL8 3.03e-89 285 39 5 423 3 pepA Probable cytosol aminopeptidase Afipia carboxidovorans (strain ATCC 49405 / DSM 1227 / KCTC 32145 / OM5)
O67868 3.4e-89 285 34 10 503 3 pepA Probable cytosol aminopeptidase Aquifex aeolicus (strain VF5)
B1ZAK8 4.42e-89 284 39 6 426 3 pepA Probable cytosol aminopeptidase Methylorubrum populi (strain ATCC BAA-705 / NCIMB 13946 / BJ001)
B3QNM5 8.08e-89 284 44 8 373 3 pepA Probable cytosol aminopeptidase Chlorobaculum parvum (strain DSM 263 / NCIMB 8327)
A7IFB7 5.03e-88 281 38 10 449 3 pepA Probable cytosol aminopeptidase Xanthobacter autotrophicus (strain ATCC BAA-1158 / Py2)
Q3SS04 5.14e-88 281 39 9 442 3 pepA Probable cytosol aminopeptidase Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
A0LK12 9.74e-88 281 36 6 487 3 pepA Probable cytosol aminopeptidase Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
A8FH04 1.17e-87 281 35 9 490 3 pepA Probable cytosol aminopeptidase Bacillus pumilus (strain SAFR-032)
Q215R8 1.92e-87 280 38 7 424 3 pepA Probable cytosol aminopeptidase Rhodopseudomonas palustris (strain BisB18)
Q8RHT8 1.94e-87 280 36 11 477 3 pepA Probable cytosol aminopeptidase Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q944P7 3.91e-87 282 36 8 473 2 LAP2 Leucine aminopeptidase 2, chloroplastic Arabidopsis thaliana
B3ED46 5.85e-87 279 45 8 342 3 pepA Probable cytosol aminopeptidase Chlorobium limicola (strain DSM 245 / NBRC 103803 / 6330)
B1LVC3 6.72e-87 279 48 3 298 3 pepA Probable cytosol aminopeptidase Methylobacterium radiotolerans (strain ATCC 27329 / DSM 1819 / JCM 2831 / NBRC 15690 / NCIMB 10815 / 0-1)
B3QVE8 8.34e-87 279 43 6 360 3 pepA Probable cytosol aminopeptidase Chloroherpeton thalassium (strain ATCC 35110 / GB-78)
Q8XHI3 8.36e-87 278 34 7 494 3 pepA Probable cytosol aminopeptidase Clostridium perfringens (strain 13 / Type A)
A8EXL1 9.91e-87 278 37 13 493 3 pepA Probable cytosol aminopeptidase Rickettsia canadensis (strain McKiel)
A8GQW7 1.29e-86 278 37 15 500 3 pepA Probable cytosol aminopeptidase Rickettsia rickettsii (strain Sheila Smith)
B0BWB2 1.29e-86 278 37 15 500 3 pepA Probable cytosol aminopeptidase Rickettsia rickettsii (strain Iowa)
C0QC86 1.35e-86 278 38 9 448 3 pepA Probable cytosol aminopeptidase Desulforapulum autotrophicum (strain ATCC 43914 / DSM 3382 / VKM B-1955 / HRM2)
A4WRK9 3.27e-86 276 45 7 352 3 pepA Probable cytosol aminopeptidase Cereibacter sphaeroides (strain ATCC 17025 / ATH 2.4.3)
Q5FU70 4.68e-86 276 38 11 466 3 pepA Probable cytosol aminopeptidase Gluconobacter oxydans (strain 621H)
Q6N5B9 6.98e-86 276 38 7 433 3 pepA Probable cytosol aminopeptidase Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
A9VXD6 9.87e-86 276 38 6 428 3 pepA Probable cytosol aminopeptidase Methylorubrum extorquens (strain PA1)
B7KYK4 1.37e-85 275 38 6 426 3 pepA Probable cytosol aminopeptidase Methylorubrum extorquens (strain CM4 / NCIMB 13688)
A4ISE0 1.66e-85 275 35 6 497 3 pepA Probable cytosol aminopeptidase Geobacillus thermodenitrificans (strain NG80-2)
Q1QKW6 1.95e-85 275 49 3 291 3 pepA Probable cytosol aminopeptidase Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
B1YKV4 1.95e-85 274 35 9 486 3 pepA Probable cytosol aminopeptidase Exiguobacterium sibiricum (strain DSM 17290 / CCUG 55495 / CIP 109462 / JCM 13490 / 255-15)
Q89MT4 2.37e-85 275 40 7 425 3 pepA Probable cytosol aminopeptidase Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
B3Q9R8 2.51e-85 275 37 7 433 3 pepA Probable cytosol aminopeptidase Rhodopseudomonas palustris (strain TIE-1)
A1BGN2 2.67e-85 275 47 6 313 3 pepA Probable cytosol aminopeptidase Chlorobium phaeobacteroides (strain DSM 266 / SMG 266 / 2430)
A7Z8B5 3.35e-85 274 34 8 492 3 pepA Probable cytosol aminopeptidase Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
Q315M7 5.25e-85 274 34 11 466 3 pepA Probable cytosol aminopeptidase Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
Q0SQ50 7.72e-85 273 36 5 431 3 pepA Probable cytosol aminopeptidase Clostridium perfringens (strain SM101 / Type A)
Q1IPU7 8.67e-85 273 35 7 464 3 pepA Probable cytosol aminopeptidase Koribacter versatilis (strain Ellin345)
Q65FE6 9.32e-85 273 34 5 491 3 pepA Probable cytosol aminopeptidase Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q5FFZ5 9.33e-85 273 37 16 502 3 pepA Probable cytosol aminopeptidase Ehrlichia ruminantium (strain Gardel)
Q5HAP2 9.53e-85 273 37 16 502 3 pepA Probable cytosol aminopeptidase Ehrlichia ruminantium (strain Welgevonden)
P30184 1.14e-84 273 33 10 507 1 LAP1 Leucine aminopeptidase 1 Arabidopsis thaliana
Q73IU2 4.38e-84 271 35 17 517 3 pepA Probable cytosol aminopeptidase Wolbachia pipientis wMel
Q2IX74 2.65e-83 269 39 9 434 3 pepA Probable cytosol aminopeptidase Rhodopseudomonas palustris (strain HaA2)
B8J457 2.81e-83 269 35 10 505 3 pepA Probable cytosol aminopeptidase Desulfovibrio desulfuricans (strain ATCC 27774 / DSM 6949 / MB)
Q11A96 3.35e-83 269 34 8 508 3 pepA Probable cytosol aminopeptidase Trichodesmium erythraeum (strain IMS101)
Q5V9F0 2.06e-82 268 37 11 488 1 lap Cytosol aminopeptidase Dictyostelium discoideum
Q8F0Q1 3.4e-82 266 39 5 375 3 pepA Probable cytosol aminopeptidase Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q3B4B5 4.74e-82 266 37 12 472 3 pepA Probable cytosol aminopeptidase Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
Q135P8 1.25e-81 265 47 3 291 3 pepA Probable cytosol aminopeptidase Rhodopseudomonas palustris (strain BisB5)
Q72UC6 1.37e-81 265 39 5 375 3 pepA Probable cytosol aminopeptidase Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q0I816 3.13e-81 264 36 14 504 3 pepA Probable cytosol aminopeptidase Synechococcus sp. (strain CC9311)
A3PEG6 4.26e-81 263 34 14 513 3 pepA Probable cytosol aminopeptidase Prochlorococcus marinus (strain MIT 9301)
Q319F5 4.94e-81 263 34 13 507 3 pepA Probable cytosol aminopeptidase Prochlorococcus marinus (strain MIT 9312)
Q8RX72 5.06e-81 266 35 10 475 2 LAP3 Leucine aminopeptidase 3, chloroplastic Arabidopsis thaliana
B3R0N4 5.73e-81 263 41 4 331 3 pepA Probable cytosol aminopeptidase Phytoplasma mali (strain AT)
B8HTK3 6.21e-81 263 34 10 487 3 pepA Probable cytosol aminopeptidase Cyanothece sp. (strain PCC 7425 / ATCC 29141)
A8LI79 6.73e-81 263 36 11 487 3 pepA Probable cytosol aminopeptidase Dinoroseobacter shibae (strain DSM 16493 / NCIMB 14021 / DFL 12)
O32106 3.89e-80 261 33 7 490 3 pepA Probable cytosol aminopeptidase Bacillus subtilis (strain 168)
B1V932 1.11e-79 259 38 12 411 3 pepA Probable cytosol aminopeptidase Phytoplasma australiense
Q6K669 5.11e-79 261 35 7 471 2 Os02g0794700 Leucine aminopeptidase 2, chloroplastic Oryza sativa subsp. japonica
Q6AJZ3 5.77e-79 258 37 9 456 3 pepA Probable cytosol aminopeptidase Desulfotalea psychrophila (strain LSv54 / DSM 12343)
Q73QZ3 9.99e-79 257 35 12 489 3 pepA Probable cytosol aminopeptidase Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q8DI46 1e-78 257 36 8 467 3 pepA Probable cytosol aminopeptidase Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
A2BSQ4 1.06e-78 257 33 13 507 3 pepA Probable cytosol aminopeptidase Prochlorococcus marinus (strain AS9601)
Q7V0D4 1.23e-78 257 33 14 509 3 pepA Probable cytosol aminopeptidase Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
C1F4B7 1.27e-78 257 35 4 447 3 pepA Probable cytosol aminopeptidase Acidobacterium capsulatum (strain ATCC 51196 / DSM 11244 / BCRC 80197 / JCM 7670 / NBRC 15755 / NCIMB 13165 / 161)
B1WR01 2.65e-78 256 35 10 488 3 pepA Probable cytosol aminopeptidase Crocosphaera subtropica (strain ATCC 51142 / BH68)
A8G6E3 6.97e-78 255 33 14 511 3 pepA Probable cytosol aminopeptidase Prochlorococcus marinus (strain MIT 9215)
Q7NHC6 7.44e-78 255 33 7 512 3 pepA Probable cytosol aminopeptidase Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q68XM6 1.03e-77 255 45 6 322 3 pepA Probable cytosol aminopeptidase Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q6MH10 4.58e-77 253 33 6 445 3 pepA Probable cytosol aminopeptidase Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
P27888 5.61e-77 253 45 6 322 3 pepA Cytosol aminopeptidase Rickettsia prowazekii (strain Madrid E)
P28839 1.06e-76 253 39 5 374 1 LAP3 Cytosol aminopeptidase Sus scrofa
B7K4A4 2.23e-76 251 34 10 491 3 pepA Probable cytosol aminopeptidase Rippkaea orientalis (strain PCC 8801 / RF-1)
Q42876 3.29e-76 253 36 13 477 2 LAPA2 Leucine aminopeptidase 2, chloroplastic Solanum lycopersicum
Q7UJ62 3.43e-76 251 41 5 329 3 pepA Probable cytosol aminopeptidase Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
Q2JRU4 6.91e-76 250 36 14 515 3 pepA Probable cytosol aminopeptidase Synechococcus sp. (strain JA-3-3Ab)
P28838 2.02e-75 249 38 4 374 1 LAP3 Cytosol aminopeptidase Homo sapiens
A5GN62 4.29e-75 248 42 8 342 3 pepA Probable cytosol aminopeptidase Synechococcus sp. (strain WH7803)
Q5XGB9 1.26e-74 247 42 5 336 2 lap3 Cytosol aminopeptidase Xenopus tropicalis
P00727 1.61e-74 247 39 5 374 1 LAP3 Cytosol aminopeptidase Bos taurus
B1XK83 2.2e-74 246 34 9 485 3 pepA Probable cytosol aminopeptidase Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
A9BBV5 3.53e-74 245 34 17 513 3 pepA Probable cytosol aminopeptidase Prochlorococcus marinus (strain MIT 9211)
Q68FS4 3.78e-74 246 38 4 374 1 Lap3 Cytosol aminopeptidase Rattus norvegicus
Q6MC72 4.33e-74 245 32 16 517 3 pepA Probable cytosol aminopeptidase Protochlamydia amoebophila (strain UWE25)
Q9CPY7 1.02e-73 245 38 4 374 1 Lap3 Cytosol aminopeptidase Mus musculus
Q7VAP4 1.13e-73 244 34 13 501 3 pepA Probable cytosol aminopeptidase Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
B0CCF6 1.53e-73 244 40 4 327 3 pepA Probable cytosol aminopeptidase Acaryochloris marina (strain MBIC 11017)
Q9Z8F8 3.6e-73 243 35 12 463 3 pepA Probable cytosol aminopeptidase Chlamydia pneumoniae
B7KCB0 4.33e-73 242 34 10 506 3 pepA Probable cytosol aminopeptidase Gloeothece citriformis (strain PCC 7424)
P38019 5.98e-73 242 34 12 470 3 pepA Probable cytosol aminopeptidase Chlamydia muridarum (strain MoPn / Nigg)
O84049 7.38e-73 242 34 12 470 1 pepA Probable cytosol aminopeptidase Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
Q67NI4 8.39e-73 242 35 8 448 3 pepA Probable cytosol aminopeptidase Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q3KMX6 1.09e-72 241 34 12 470 3 pepA Probable cytosol aminopeptidase Chlamydia trachomatis serovar A (strain ATCC VR-571B / DSM 19440 / HAR-13)
Q3AZE8 1.42e-72 241 34 13 509 3 pepA Probable cytosol aminopeptidase Synechococcus sp. (strain CC9902)
B0BB32 3.68e-72 240 34 12 470 3 pepA Probable cytosol aminopeptidase Chlamydia trachomatis serovar L2b (strain UCH-1/proctitis)
B0B9F3 3.68e-72 240 34 12 470 3 pepA Probable cytosol aminopeptidase Chlamydia trachomatis serovar L2 (strain ATCC VR-902B / DSM 19102 / 434/Bu)
Q3AHT4 6.34e-72 239 35 16 511 3 pepA Probable cytosol aminopeptidase Synechococcus sp. (strain CC9605)
P73971 7.67e-72 239 33 10 490 3 pepA Probable cytosol aminopeptidase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q8IL11 2.93e-71 241 34 15 474 1 LAP Leucine aminopeptidase Plasmodium falciparum (isolate 3D7)
Q7M8W6 4.02e-71 237 37 7 366 3 pepA Probable cytosol aminopeptidase Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
Q3M9J6 7.33e-71 236 32 8 487 3 pepA Probable cytosol aminopeptidase Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q7V5X8 8.21e-71 236 35 13 510 3 pepA Probable cytosol aminopeptidase Prochlorococcus marinus (strain MIT 9313)
A5GV03 1.09e-70 236 44 7 323 3 pepA Probable cytosol aminopeptidase Synechococcus sp. (strain RCC307)
Q8Z064 2.72e-70 235 33 8 487 3 pepA Probable cytosol aminopeptidase Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
B9DIX2 5.41e-70 234 34 7 432 3 pepA Probable cytosol aminopeptidase Staphylococcus carnosus (strain TM300)
Q5YZ53 1.63e-69 233 36 10 431 3 pepA Probable cytosol aminopeptidase Nocardia farcinica (strain IFM 10152)
Q2JKL5 1.66e-69 234 35 10 480 3 pepA Probable cytosol aminopeptidase Synechococcus sp. (strain JA-2-3B'a(2-13))
Q7U8Q1 2.64e-69 232 35 12 504 3 pepA Probable cytosol aminopeptidase Parasynechococcus marenigrum (strain WH8102)
C1AQC8 2.79e-69 233 40 10 361 3 pepA Probable cytosol aminopeptidase Mycobacterium bovis (strain BCG / Tokyo 172 / ATCC 35737 / TMC 1019)
A1KKQ5 2.79e-69 233 40 10 361 3 pepA Probable cytosol aminopeptidase Mycobacterium bovis (strain BCG / Pasteur 1173P2)
Q7VEN5 2.79e-69 233 40 10 361 3 pepA Probable cytosol aminopeptidase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
A0PTP9 2.88e-69 233 40 9 361 3 pepA Probable cytosol aminopeptidase Mycobacterium ulcerans (strain Agy99)
B2J3G8 6.54e-69 231 32 10 501 3 pepA Probable cytosol aminopeptidase Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
P9WHT3 7.13e-69 232 36 14 445 1 pepA Probable cytosol aminopeptidase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WHT2 7.13e-69 232 36 14 445 3 pepA Probable cytosol aminopeptidase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U4P1 7.13e-69 232 36 14 445 3 pepA Probable cytosol aminopeptidase Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
O32956 8.18e-69 232 39 9 369 3 pepA Probable cytosol aminopeptidase Mycobacterium leprae (strain TN)
B0JL23 8.7e-69 231 40 4 327 3 pepA Probable cytosol aminopeptidase Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
Q254B9 1.54e-68 231 35 9 442 3 pepA Probable cytosol aminopeptidase Chlamydia felis (strain Fe/C-56)
Q2QSB9 1.56e-68 232 39 5 336 3 Os12g0434400 Putative leucine aminopeptidase 1 Oryza sativa subsp. japonica
B2HGY2 2.29e-68 231 39 8 360 3 pepA Probable cytosol aminopeptidase Mycobacterium marinum (strain ATCC BAA-535 / M)
Q5L681 5e-68 229 34 9 432 3 pepA Probable cytosol aminopeptidase Chlamydia abortus (strain DSM 27085 / S26/3)
P31427 1.87e-67 230 35 11 473 2 LAP Leucine aminopeptidase, chloroplastic Solanum tuberosum
Q823J9 6.7e-67 226 42 6 302 3 pepA Probable cytosol aminopeptidase Chlamydia caviae (strain ATCC VR-813 / DSM 19441 / 03DC25 / GPIC)
Q7VGF0 8.51e-67 225 38 5 334 3 pepA Probable cytosol aminopeptidase Helicobacter hepaticus (strain ATCC 51449 / 3B1)
Q8EI85 2.63e-66 225 37 12 451 3 pepA1 Probable cytosol aminopeptidase 1 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q6NG90 6.85e-66 224 34 10 452 3 pepA Probable cytosol aminopeptidase Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
A5K3U9 2.1e-65 225 33 17 483 1 LAP Leucine aminopeptidase Plasmodium vivax (strain Salvador I)
O25294 3.53e-65 222 38 6 352 1 pepA Cytosol aminopeptidase Helicobacter pylori (strain ATCC 700392 / 26695)
B5Z6U1 3.64e-65 222 37 6 352 3 pepA Probable cytosol aminopeptidase Helicobacter pylori (strain G27)
Q9PP04 4.62e-65 221 37 9 373 3 pepA Probable cytosol aminopeptidase Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q10712 6.12e-65 223 34 11 473 1 LAPA1 Leucine aminopeptidase 1, chloroplastic Solanum lycopersicum
B2UTQ8 7.35e-65 221 37 6 352 3 pepA Probable cytosol aminopeptidase Helicobacter pylori (strain Shi470)
B1VZN5 1.01e-64 221 35 11 506 3 pepA Probable cytosol aminopeptidase Streptomyces griseus subsp. griseus (strain JCM 4626 / CBS 651.72 / NBRC 13350 / KCC S-0626 / ISP 5235)
B6JLF2 1.44e-64 220 38 6 352 3 pepA Probable cytosol aminopeptidase Helicobacter pylori (strain P12)
Q8NNJ4 1.55e-64 220 41 6 314 3 pepA Probable cytosol aminopeptidase Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q1CTV6 1.58e-64 220 37 6 352 3 pepA Probable cytosol aminopeptidase Helicobacter pylori (strain HPAG1)
Q82AN2 4.57e-64 219 33 7 494 3 pepA Probable cytosol aminopeptidase Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q73YK2 1.12e-63 218 38 7 359 3 pepA Probable cytosol aminopeptidase Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
C1AUB5 1.13e-63 218 35 10 427 3 pepA Probable cytosol aminopeptidase Rhodococcus opacus (strain B4)
Q1B6R7 1.64e-63 218 33 14 473 3 pepA Probable cytosol aminopeptidase Mycobacterium sp. (strain MCS)
A1UIA8 1.64e-63 218 33 14 473 3 pepA Probable cytosol aminopeptidase Mycobacterium sp. (strain KMS)
A3Q1S2 2.29e-63 218 32 13 473 3 pepA Probable cytosol aminopeptidase Mycobacterium sp. (strain JLS)
C1A138 2.33e-63 217 34 11 453 3 pepA Probable cytosol aminopeptidase Rhodococcus erythropolis (strain PR4 / NBRC 100887)
Q0SHL0 5.33e-63 216 35 10 427 3 pepA Probable cytosol aminopeptidase Rhodococcus jostii (strain RHA1)
Q6A9W5 1.8e-62 215 34 9 452 3 pepA Probable cytosol aminopeptidase Cutibacterium acnes (strain DSM 16379 / KPA171202)
Q9ZLR1 3.37e-62 214 36 6 354 3 pepA Cytosol aminopeptidase Helicobacter pylori (strain J99 / ATCC 700824)
Q17W06 4.12e-62 214 36 5 351 3 pepA Probable cytosol aminopeptidase Helicobacter acinonychis (strain Sheeba)
Q9Y935 1.51e-61 212 32 9 403 3 pepA Probable cytosol aminopeptidase Aeropyrum pernix (strain ATCC 700893 / DSM 11879 / JCM 9820 / NBRC 100138 / K1)
Q8SQZ7 2.83e-61 211 35 8 363 1 ECU10_1770i Cytosol aminopeptidase Encephalitozoon cuniculi (strain GB-M1)
Q9S2Q7 3.91e-61 212 42 5 326 3 pepA Probable cytosol aminopeptidase Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
O06865 6.39e-61 210 40 5 331 3 pepA Probable cytosol aminopeptidase Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q6AFG2 9.07e-61 210 41 6 322 3 pepA Probable cytosol aminopeptidase Leifsonia xyli subsp. xyli (strain CTCB07)
Q83G32 1.61e-60 209 36 15 457 3 pepA Probable cytosol aminopeptidase Tropheryma whipplei (strain Twist)
Q83I32 1.61e-60 209 36 15 457 3 pepA Probable cytosol aminopeptidase Tropheryma whipplei (strain TW08/27)
Q5N569 1.23e-59 207 39 5 331 3 pepA Probable cytosol aminopeptidase Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
P47707 6.91e-59 206 32 9 452 3 pepA Probable cytosol aminopeptidase Metamycoplasma salivarium
Q4QM33 7.73e-59 203 40 5 294 3 pepB Peptidase B Haemophilus influenzae (strain 86-028NP)
C5CCM4 8.05e-59 205 35 10 470 3 pepA Probable cytosol aminopeptidase Micrococcus luteus (strain ATCC 4698 / DSM 20030 / JCM 1464 / CCM 169 / CCUG 5858 / IAM 1056 / NBRC 3333 / NCIMB 9278 / NCTC 2665 / VKM Ac-2230)
A7MU37 9.17e-59 203 43 5 290 3 pepB Peptidase B Vibrio campbellii (strain ATCC BAA-1116)
B7VJT3 1.66e-58 202 42 5 292 3 pepB Peptidase B Vibrio atlanticus (strain LGP32)
A5CRI6 5.77e-58 203 41 6 295 3 pepA Probable cytosol aminopeptidase Clavibacter michiganensis subsp. michiganensis (strain NCPPB 382)
Q8FNP8 9.22e-58 202 31 14 503 3 pepA Probable cytosol aminopeptidase Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q9CM16 2.6e-57 199 38 7 325 3 pepB Peptidase B Pasteurella multocida (strain Pm70)
Q87S21 2.67e-57 199 42 5 290 3 pepB Peptidase B Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q7MNF5 3.46e-57 199 39 7 332 3 pepB Peptidase B Vibrio vulnificus (strain YJ016)
Q8DEZ4 3.46e-57 199 39 7 332 3 pepB Peptidase B Vibrio vulnificus (strain CMCP6)
P58474 3.67e-57 199 40 5 294 5 pepB Putative peptidase B Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
B5Z0Z6 3.99e-57 199 40 6 320 3 pepB Peptidase B Escherichia coli O157:H7 (strain EC4115 / EHEC)
P58473 3.99e-57 199 40 6 320 3 pepB Peptidase B Escherichia coli O157:H7
Q6D266 4.19e-57 199 38 8 327 3 pepB Peptidase B Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q9KTX5 1.63e-56 197 40 6 299 3 pepB Peptidase B Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q0T1Z6 1.86e-56 197 40 6 320 3 pepB Peptidase B Shigella flexneri serotype 5b (strain 8401)
Q3YZ29 1.93e-56 197 40 6 320 3 pepB Peptidase B Shigella sonnei (strain Ss046)
B6I595 1.93e-56 197 40 6 320 3 pepB Peptidase B Escherichia coli (strain SE11)
B7M7M6 1.93e-56 197 40 6 320 3 pepB Peptidase B Escherichia coli O8 (strain IAI1)
B7LDB5 1.93e-56 197 40 6 320 3 pepB Peptidase B Escherichia coli (strain 55989 / EAEC)
Q32D41 2.22e-56 197 40 6 320 3 pepB Peptidase B Shigella dysenteriae serotype 1 (strain Sd197)
A8GHX6 2.29e-56 197 39 9 343 3 pepB Peptidase B Serratia proteamaculans (strain 568)
A7ZPW6 2.59e-56 196 40 6 320 3 pepB Peptidase B Escherichia coli O139:H28 (strain E24377A / ETEC)
B1IWD8 2.82e-56 196 40 6 320 3 pepB Peptidase B Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A329 2.82e-56 196 40 6 320 3 pepB Peptidase B Escherichia coli O9:H4 (strain HS)
A6TCE4 2.86e-56 196 40 6 320 3 pepB Peptidase B Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q83QK5 3.55e-56 196 40 6 320 3 pepB Peptidase B Shigella flexneri
P37095 3.7e-56 196 40 6 320 1 pepB Peptidase B Escherichia coli (strain K12)
B1XAZ8 3.7e-56 196 40 6 320 3 pepB Peptidase B Escherichia coli (strain K12 / DH10B)
C4ZX98 3.7e-56 196 40 6 320 3 pepB Peptidase B Escherichia coli (strain K12 / MC4100 / BW2952)
Q1R8K9 3.74e-56 196 40 6 320 3 pepB Peptidase B Escherichia coli (strain UTI89 / UPEC)
A1AE61 3.74e-56 196 40 6 320 3 pepB Peptidase B Escherichia coli O1:K1 / APEC
B7MI07 3.74e-56 196 40 6 320 3 pepB Peptidase B Escherichia coli O45:K1 (strain S88 / ExPEC)
Q8FF47 3.81e-56 196 40 6 320 3 pepB Peptidase B Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TEW2 3.81e-56 196 40 6 320 3 pepB Peptidase B Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B7MYF7 3.81e-56 196 40 6 320 3 pepB Peptidase B Escherichia coli O81 (strain ED1a)
B7UGW9 3.81e-56 196 40 6 320 3 pepB Peptidase B Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B7LKB6 6.63e-56 195 40 6 320 3 pepB Peptidase B Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q09735 8.31e-56 197 37 6 339 3 SPAC13A11.05 Putative aminopeptidase C13A11.05 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
B7N6B0 9.87e-56 195 40 6 320 3 pepB Peptidase B Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B1LNH8 1.08e-55 195 40 6 320 3 pepB Peptidase B Escherichia coli (strain SMS-3-5 / SECEC)
Q7N231 1.2e-55 195 37 8 343 3 pepB Peptidase B Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q31XW7 1.42e-55 194 40 6 320 3 pepB Peptidase B Shigella boydii serotype 4 (strain Sb227)
B2TXU8 1.42e-55 194 40 6 320 3 pepB Peptidase B Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
A7MGW9 2.96e-55 194 40 6 320 3 pepB Peptidase B Cronobacter sakazakii (strain ATCC BAA-894)
B5XNK4 3.83e-53 188 39 6 320 3 pepB Peptidase B Klebsiella pneumoniae (strain 342)
B5RD05 6.98e-53 187 39 6 320 3 pepB Peptidase B Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5R595 6.98e-53 187 39 6 320 3 pepB Peptidase B Salmonella enteritidis PT4 (strain P125109)
B5FR78 6.98e-53 187 39 6 320 3 pepB Peptidase B Salmonella dublin (strain CT_02021853)
A4WDA4 7.29e-53 187 37 7 335 3 pepB Peptidase B Enterobacter sp. (strain 638)
A9MHK1 9.05e-53 187 39 7 323 3 pepB Peptidase B Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B7NRH2 1.76e-52 186 40 6 320 3 pepB Peptidase B Escherichia coli O7:K1 (strain IAI39 / ExPEC)
Q9RF52 2.19e-52 186 38 6 320 1 pepB Peptidase B Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
C0PYL4 2.19e-52 186 38 6 320 3 pepB Peptidase B Salmonella paratyphi C (strain RKS4594)
A9N1Y3 2.19e-52 186 38 6 320 3 pepB Peptidase B Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4T0R5 2.19e-52 186 38 6 320 3 pepB Peptidase B Salmonella newport (strain SL254)
B5F1B3 2.19e-52 186 38 6 320 3 pepB Peptidase B Salmonella agona (strain SL483)
A8AD60 3.42e-52 186 39 7 323 3 pepB Peptidase B Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q8Z4N3 3.46e-52 186 38 6 320 3 pepB Peptidase B Salmonella typhi
Q57LH5 1.08e-51 184 38 6 320 3 pepB Peptidase B Salmonella choleraesuis (strain SC-B67)
C6DBI4 4.7e-50 180 38 7 326 3 pepB Peptidase B Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q667Y8 6.45e-50 179 39 9 345 3 pepB Peptidase B Yersinia pseudotuberculosis serotype I (strain IP32953)
B2K9R0 6.45e-50 179 39 9 345 3 pepB Peptidase B Yersinia pseudotuberculosis serotype IB (strain PB1/+)
B1JRZ6 6.72e-50 179 39 9 345 3 pepB Peptidase B Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
A4TMU7 6.72e-50 179 39 9 345 3 pepB Peptidase B Yersinia pestis (strain Pestoides F)
Q1CKA2 6.72e-50 179 39 9 345 3 pepB Peptidase B Yersinia pestis bv. Antiqua (strain Nepal516)
A9R811 6.72e-50 179 39 9 345 3 pepB Peptidase B Yersinia pestis bv. Antiqua (strain Angola)
P58475 6.72e-50 179 39 9 345 1 pepB Peptidase B Yersinia pestis
Q1C5H7 6.72e-50 179 39 9 345 3 pepB Peptidase B Yersinia pestis bv. Antiqua (strain Antiqua)
P75206 2.03e-49 179 41 4 246 3 pepA Probable cytosol aminopeptidase Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
A7FFX8 3.97e-49 177 39 9 345 3 pepB Peptidase B Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS10060
Feature type CDS
Gene pepA
Product leucyl aminopeptidase
Location 118943 - 120454 (strand: -1)
Length 1512 (nucleotides) / 503 (amino acids)
In genomic island -

Contig

Accession NZ_VXKB01000002
Length 573139 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1488
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00883 Cytosol aminopeptidase family, catalytic domain
PF02789 Cytosol aminopeptidase family, N-terminal domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0260 Amino acid transport and metabolism (E) E Leucyl aminopeptidase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K01255 leucyl aminopeptidase [EC:3.4.11.1] Glutathione metabolism
Metabolic pathways
-

Protein Sequence

MEFSVKSGSPEKQRSACIVVGIFEPRRLSPVVEQLDKISDGYISALLRRGELEGKVGQSLLLHHVPNVLSERILLIGCGKERELDERQYKQIIQKTISTLNETGSMEAVCFLTELHVKGRNNYWKVRQAVETAKESLYVFDQLKSNKTELRRPLRKLVFNVPTRRELPAGEKAISHGLAISAGIKAAKDLANMPPNICNAAYLASQARQLADNHSSVLSTRVIGEEQMKELGMLAYLAVGQGSRNESLMSVIEYKGNPDPEARPIVLVGKGLTFDSGGISIKPADGMDEMKYDMCGAATVYGVMRMVAELSLPLNVVGILAGCENMPGSNAYRPGDILTTMSGQTVEVLNTDAEGRLVLCDALTYVERFEPETVIDIATLTGACMVALGNHFSGLMANHNPLAHELLNASEQAGDRAWRLPLADEFYEQIESNFADLANTGGRLGGAITAGCFLSRFATRYNWAHLDIAGTAWRSGKNKGATGRPVALLAQFLLNRAGISTDD

Flanking regions ( +/- flanking 50bp)

TACATTTTAGCGACAGCAGATGTCTTTGTCTTTAAGATTCAGGAGAGCGCATGGAGTTTAGTGTAAAAAGCGGCAGTCCGGAAAAGCAACGCAGTGCTTGTATTGTGGTCGGCATTTTCGAACCGCGTCGTCTGTCCCCGGTTGTGGAACAGCTCGATAAAATCAGCGACGGCTACATCAGTGCTCTGCTGCGCCGCGGCGAGCTGGAGGGCAAGGTCGGGCAGTCTCTGCTTCTGCACCATGTCCCGAATGTCCTGTCCGAGCGTATCCTGTTAATCGGCTGCGGGAAAGAACGCGAGCTGGATGAGCGCCAGTACAAACAGATTATTCAGAAAACCATCAGTACCCTGAACGAAACCGGGTCGATGGAAGCGGTCTGTTTTCTGACTGAGTTGCACGTCAAAGGACGCAACAATTACTGGAAAGTAAGACAAGCTGTTGAAACAGCAAAAGAATCTCTCTATGTCTTTGATCAGCTGAAGAGCAATAAAACCGAATTACGCCGCCCGCTGCGTAAACTGGTCTTCAATGTACCTACCCGCCGTGAGCTACCTGCCGGTGAGAAAGCGATCAGTCATGGTCTGGCAATTTCTGCCGGCATCAAAGCAGCAAAAGATCTGGCGAATATGCCGCCGAACATCTGTAACGCGGCTTACCTCGCGTCGCAGGCGCGTCAGCTGGCAGACAATCATTCATCTGTCCTCAGCACCCGGGTTATCGGCGAAGAGCAGATGAAAGAGCTGGGAATGCTGGCGTATCTGGCGGTCGGTCAGGGGTCACGCAATGAATCACTGATGTCGGTGATTGAGTATAAAGGTAATCCGGACCCGGAAGCTCGTCCGATTGTATTAGTCGGGAAAGGGCTGACGTTCGACTCCGGCGGTATTTCTATCAAACCTGCCGATGGCATGGATGAGATGAAATATGACATGTGCGGCGCAGCGACTGTCTACGGCGTAATGCGGATGGTGGCTGAACTGAGTCTGCCGCTCAATGTGGTCGGGATCCTGGCGGGATGTGAAAATATGCCGGGCAGCAATGCCTATCGCCCGGGAGATATCCTCACCACCATGTCGGGCCAGACTGTCGAAGTTCTCAATACGGATGCAGAAGGCCGCCTGGTACTGTGTGATGCACTGACCTATGTGGAGCGTTTCGAGCCGGAAACCGTAATTGATATCGCGACCCTGACCGGCGCCTGTATGGTCGCACTGGGTAACCATTTCAGTGGTCTGATGGCAAATCACAATCCACTGGCGCACGAACTGCTGAATGCATCTGAACAAGCCGGTGACCGCGCATGGCGACTGCCGCTGGCAGATGAGTTCTACGAGCAAATTGAGTCGAACTTTGCCGACCTCGCCAATACCGGCGGGCGTCTGGGTGGCGCGATTACTGCGGGTTGCTTCCTGTCACGCTTTGCAACGCGCTATAATTGGGCGCACCTGGATATCGCCGGTACGGCATGGCGTTCAGGTAAAAATAAAGGCGCAACAGGTCGTCCGGTTGCACTGCTGGCACAATTCCTGTTAAATCGTGCGGGTATCAGCACCGACGACTGACCGGTATTGCAGGACAGGTCCGGATAAATAAAGGTAACGGGGATTGTGAT