Homologs in group_1327

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_08215 FBDBKF_08215 100.0 Morganella morganii S1 rho transcription termination factor Rho
EHELCC_13310 EHELCC_13310 100.0 Morganella morganii S2 rho transcription termination factor Rho
NLDBIP_13650 NLDBIP_13650 100.0 Morganella morganii S4 rho transcription termination factor Rho
HKOGLL_12125 HKOGLL_12125 100.0 Morganella morganii S5 rho transcription termination factor Rho
F4V73_RS18765 F4V73_RS18765 98.8 Morganella psychrotolerans rho transcription termination factor Rho
PMI_RS16475 PMI_RS16475 98.6 Proteus mirabilis HI4320 rho transcription termination factor Rho

Distribution of the homologs in the orthogroup group_1327

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1327

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0AG33 0.0 829 95 0 419 3 rho Transcription termination factor Rho Shigella flexneri
P0AG30 0.0 829 95 0 419 1 rho Transcription termination factor Rho Escherichia coli (strain K12)
P0AG31 0.0 829 95 0 419 3 rho Transcription termination factor Rho Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AG32 0.0 829 95 0 419 3 rho Transcription termination factor Rho Escherichia coli O157:H7
P0A295 0.0 826 95 0 419 3 rho Transcription termination factor Rho Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A296 0.0 826 95 0 419 3 rho Transcription termination factor Rho Salmonella typhi
P57652 0.0 813 94 0 419 3 rho Transcription termination factor Rho Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
O51891 0.0 810 94 0 419 3 rho Transcription termination factor Rho Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q89A22 0.0 807 93 0 419 3 rho Transcription termination factor Rho Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
P44619 0.0 758 87 1 420 3 rho Transcription termination factor Rho Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9HTV1 0.0 723 82 0 418 3 rho Transcription termination factor Rho Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P52155 0.0 710 81 0 418 3 rho Transcription termination factor Rho Pseudomonas fluorescens biotype C
P52152 0.0 704 80 0 417 3 rho Transcription termination factor Rho Allochromatium vinosum (strain ATCC 17899 / DSM 180 / NBRC 103801 / NCIMB 10441 / D)
Q7NXP1 0.0 621 69 0 418 3 rho Transcription termination factor Rho Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q9PA21 0.0 619 72 1 410 3 rho Transcription termination factor Rho Xylella fastidiosa (strain 9a5c)
Q06447 0.0 608 68 0 417 3 rho Transcription termination factor Rho Neisseria gonorrhoeae
P52156 0.0 594 67 0 416 3 rho Transcription termination factor Rho Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q1RIJ6 0.0 581 67 1 417 3 rho Transcription termination factor Rho Rickettsia bellii (strain RML369-C)
Q68WL0 0.0 580 67 1 419 3 rho Transcription termination factor Rho Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q4ULF7 0.0 573 66 1 419 3 rho Transcription termination factor Rho Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q9ZD24 0.0 572 66 1 419 3 rho Transcription termination factor Rho Rickettsia prowazekii (strain Madrid E)
Q92HL2 0.0 571 66 1 419 3 rho Transcription termination factor Rho Rickettsia conorii (strain ATCC VR-613 / Malish 7)
P0CH93 0.0 513 59 1 419 3 rho2 Transcription termination factor Rho 2 Ehrlichia chaffeensis (strain ATCC CRL-10679 / Arkansas)
P0CH92 0.0 513 59 1 419 3 rho1 Transcription termination factor Rho 1 Ehrlichia chaffeensis (strain ATCC CRL-10679 / Arkansas)
O83281 1.5e-179 513 62 1 393 3 rho Transcription termination factor Rho Treponema pallidum (strain Nichols)
Q03222 3.4e-170 486 56 4 419 3 rho Transcription termination factor Rho Bacillus subtilis (strain 168)
P56466 1.97e-169 484 54 1 415 3 rho Transcription termination factor Rho Helicobacter pylori (strain ATCC 700392 / 26695)
P33561 1.03e-168 486 58 2 416 3 rho Transcription termination factor Rho Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
Q9ZLS9 1.49e-168 482 53 1 415 3 rho Transcription termination factor Rho Helicobacter pylori (strain J99 / ATCC 700824)
O67031 1.62e-163 469 57 3 416 3 rho Transcription termination factor Rho Aquifex aeolicus (strain VF5)
Q7UGV0 2.16e-159 462 54 3 417 3 rho Transcription termination factor Rho Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
P38527 4.35e-158 455 54 1 418 1 rho Transcription termination factor Rho Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
C7LJY3 3e-152 439 58 2 358 3 rho Transcription termination factor Rho Karelsulcia muelleri (strain SMDSEM)
P52157 6.13e-151 447 59 4 364 1 rho Transcription termination factor Rho Streptomyces lividans
P52153 9.55e-143 416 51 5 417 3 rho Transcription termination factor Rho Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
P9WHF3 7.14e-141 418 56 4 367 1 rho Transcription termination factor Rho Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WHF2 7.14e-141 418 56 4 367 3 rho Transcription termination factor Rho Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P66029 7.14e-141 418 56 4 367 3 rho Transcription termination factor Rho Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P45835 3.67e-139 414 56 5 368 3 rho Transcription termination factor Rho Mycobacterium leprae (strain TN)
C9RLJ9 2.77e-136 409 48 4 426 3 rho Transcription termination factor Rho Fibrobacter succinogenes (strain ATCC 19169 / S85)
P52154 1.69e-133 402 52 5 379 1 rho Transcription termination factor Rho Micrococcus luteus
D2B129 2.31e-124 368 50 5 367 3 rho Transcription termination factor Rho Streptosporangium roseum (strain ATCC 12428 / DSM 43021 / JCM 3005 / KCTC 9067 / NCIMB 10171 / NRRL 2505 / NI 9100)
B2UR37 1.47e-121 364 44 2 413 3 rho Transcription termination factor Rho Akkermansia muciniphila (strain ATCC BAA-835 / DSM 22959 / JCM 33894 / BCRC 81048 / CCUG 64013 / CIP 107961 / Muc)
D1AWS1 1.64e-115 347 44 3 415 3 rho Transcription termination factor Rho Streptobacillus moniliformis (strain ATCC 14647 / DSM 12112 / NCTC 10651 / 9901)
Q8RG42 2.83e-115 346 46 5 388 3 rho Transcription termination factor Rho Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q9FC33 9.92e-113 339 51 7 373 3 rho Transcription termination factor Rho Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
C1A5H8 2.46e-106 333 47 4 369 3 rho Transcription termination factor Rho Gemmatimonas aurantiaca (strain DSM 14586 / JCM 11422 / NBRC 100505 / T-27)
P74857 3.8e-16 83 30 6 250 1 sctN2 SPI-2 type 3 secretion system ATPase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P55717 7.57e-15 79 29 9 298 3 sctN Type 3 secretion system ATPase Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P0A1B9 2.06e-13 75 28 6 242 1 sctN1 SPI-1 type 3 secretion system ATPase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A1C0 2.06e-13 75 28 6 242 3 sctN1 SPI-1 type 3 secretion system ATPase Salmonella typhi
O83417 2.4e-13 75 28 5 247 3 fliI Flagellum-specific ATP synthase Treponema pallidum (strain Nichols)
O67531 2.69e-13 74 29 6 252 3 fliI Flagellum-specific ATP synthase Aquifex aeolicus (strain VF5)
P40290 5.92e-13 73 28 7 255 1 sctN Type 3 secretion system ATPase Yersinia enterocolitica
P40291 6.13e-13 73 28 7 255 1 sctN Type 3 secretion system ATPase Yersinia pseudotuberculosis serotype I (strain IP32953)
Q7ARI8 6.13e-13 73 28 7 255 1 sctN Type 3 secretion system ATPase Yersinia pestis
P80153 1.16e-12 72 27 8 292 3 sctN Type 3 secretion system ATPase Xanthomonas euvesicatoria
Q887B5 5.67e-12 70 28 6 246 3 sctN Type 3 secretion system ATPase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
P52607 5.85e-12 70 27 14 322 3 fliI Flagellum-specific ATP synthase Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
Q52371 2.17e-11 68 28 10 259 1 sctN Type 3 secretion system ATPase Pseudomonas syringae pv. syringae
P0A1C2 5.03e-11 67 28 8 250 3 sctN Type 3 secretion system ATPase Shigella sonnei
P0A1C1 5.03e-11 67 28 8 250 1 sctN Type 3 secretion system ATPase Shigella flexneri
Q8RK01 6.18e-11 67 27 6 247 1 sctN Type 3 secretion system ATPase Pseudomonas savastanoi pv. phaseolicola
P23445 8.65e-11 67 26 5 241 3 fliI Flagellum-specific ATP synthase Bacillus subtilis (strain 168)
Q9I4N1 1.19e-10 66 27 6 241 3 fliI Flagellum-specific ATP synthase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
B8H363 1.41e-10 66 28 5 234 3 fliI Flagellum-specific ATP synthase Caulobacter vibrioides (strain NA1000 / CB15N)
P0CAT8 1.41e-10 66 28 5 234 3 fliI Flagellum-specific ATP synthase Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
P52158 3.63e-10 58 50 1 59 3 rho Transcription termination factor Rho (Fragment) Acidithiobacillus ferridurans
O34171 6.1e-10 64 27 7 242 3 fliI Flagellum-specific ATP synthase Agrobacterium fabrum (strain C58 / ATCC 33970)
O54249 1.39e-09 63 27 8 242 3 fliI Flagellum-specific ATP synthase Rhizobium meliloti (strain 1021)
Q3A076 4.53e-09 62 27 9 223 3 atpA2 ATP synthase subunit alpha 2 Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
Q8KA42 5.53e-09 61 24 3 240 3 fliI Flagellum-specific ATP synthase Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
P26465 5.62e-09 61 25 5 241 1 fliI Flagellum-specific ATP synthase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A1SS62 7.61e-07 55 25 9 254 3 atpA1 ATP synthase subunit alpha 1 Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q74MJ7 1.31e-06 54 25 7 233 1 atpA V-type ATP synthase alpha chain Nanoarchaeum equitans (strain Kin4-M)
Q0AEI9 1.41e-06 53 26 9 222 3 atpA2 ATP synthase subunit alpha 2 Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
P57178 3.14e-06 52 23 6 248 3 fliI Flagellum-specific ATP synthase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
A8LN46 3.29e-06 52 25 11 294 3 atpA1 ATP synthase subunit alpha 1 Dinoroseobacter shibae (strain DSM 16493 / NCIMB 14021 / DFL 12)
Q13DP2 4.03e-06 52 21 10 312 3 atpD ATP synthase subunit beta Rhodopseudomonas palustris (strain BisB5)
Q07UZ5 4.14e-06 52 21 10 312 3 atpD ATP synthase subunit beta Rhodopseudomonas palustris (strain BisA53)
A1VPQ8 4.77e-06 52 23 9 259 3 atpA2 ATP synthase subunit alpha 2 Polaromonas naphthalenivorans (strain CJ2)
A8ZNS4 1.03e-05 51 23 8 230 3 atpA2 ATP synthase subunit alpha 2 Acaryochloris marina (strain MBIC 11017)
Q2LY34 1.14e-05 51 23 10 260 3 atpA2 ATP synthase subunit alpha 2 Syntrophus aciditrophicus (strain SB)
Q05FY1 1.34e-05 50 24 5 210 3 atpD ATP synthase subunit beta Carsonella ruddii (strain PV)
Q891P1 1.47e-05 50 25 12 339 3 atpA2 V-type ATP synthase alpha chain 2 Clostridium tetani (strain Massachusetts / E88)
A6VWQ6 1.53e-05 50 23 9 261 3 atpA1 ATP synthase subunit alpha 1 Marinomonas sp. (strain MWYL1)
Q21Z99 1.66e-05 50 24 9 254 3 atpA2 ATP synthase subunit alpha 2 Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
B9LBM0 1.78e-05 50 25 8 227 3 atpD ATP synthase subunit beta Chloroflexus aurantiacus (strain ATCC 29364 / DSM 637 / Y-400-fl)
A9WGS4 1.78e-05 50 25 8 227 3 atpD ATP synthase subunit beta Chloroflexus aurantiacus (strain ATCC 29366 / DSM 635 / J-10-fl)
Q2J3I4 1.83e-05 50 21 10 312 3 atpD ATP synthase subunit beta Rhodopseudomonas palustris (strain HaA2)
B8G6G6 2.07e-05 50 25 8 227 3 atpD ATP synthase subunit beta Chloroflexus aggregans (strain MD-66 / DSM 9485)
Q89AZ7 2.17e-05 50 27 7 220 3 fliI Flagellum-specific ATP synthase Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q21CY7 2.27e-05 50 22 10 312 3 atpD ATP synthase subunit beta Rhodopseudomonas palustris (strain BisB18)
A8ZNR6 2.46e-05 50 22 10 262 3 atpD ATP synthase subunit beta Acaryochloris marina (strain MBIC 11017)
A0AFQ9 4.06e-05 49 26 8 219 3 atpA1 ATP synthase subunit alpha 1 Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
C1D5G2 4.56e-05 49 22 4 285 3 atpD ATP synthase subunit beta Laribacter hongkongensis (strain HLHK9)
A9AVV4 4.93e-05 48 23 9 284 3 atpD ATP synthase subunit beta Herpetosiphon aurantiacus (strain ATCC 23779 / DSM 785 / 114-95)
P42466 5.07e-05 48 23 9 284 3 atpD ATP synthase subunit beta Herpetosiphon aurantiacus
Q3J9F3 5.15e-05 49 26 9 242 3 atpA V-type ATP synthase alpha chain Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
Q47M82 5.64e-05 48 25 6 216 3 atpD ATP synthase subunit beta Thermobifida fusca (strain YX)
Q3B406 5.76e-05 48 26 9 224 3 atpD2 ATP synthase subunit beta 2 Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
Q8XID4 6.26e-05 48 25 8 221 3 atpD ATP synthase subunit beta Clostridium perfringens (strain 13 / Type A)
Q0TNC4 6.26e-05 48 25 8 221 3 atpD ATP synthase subunit beta Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q0SQZ5 6.43e-05 48 25 8 221 3 atpD ATP synthase subunit beta Clostridium perfringens (strain SM101 / Type A)
A5V3X5 6.81e-05 48 24 12 309 3 atpD ATP synthase subunit beta Rhizorhabdus wittichii (strain DSM 6014 / CCUG 31198 / JCM 15750 / NBRC 105917 / EY 4224 / RW1)
Q3SVJ1 9.92e-05 48 21 10 312 3 atpD ATP synthase subunit beta Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
B8D6S7 9.96e-05 48 22 3 249 3 atpD ATP synthase subunit beta Buchnera aphidicola subsp. Acyrthosiphon pisum (strain Tuc7)
P57124 9.96e-05 48 22 3 249 3 atpD ATP synthase subunit beta Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
B8D8H3 9.96e-05 48 22 3 249 3 atpD ATP synthase subunit beta Buchnera aphidicola subsp. Acyrthosiphon pisum (strain 5A)
Q7UH05 0.000116 48 25 8 223 3 atpA1 ATP synthase subunit alpha 1 Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
Q724W6 0.000144 47 26 8 219 3 atpA1 ATP synthase subunit alpha 1 Listeria monocytogenes serotype 4b (strain F2365)
Q89X74 0.000153 47 23 8 277 3 atpD ATP synthase subunit beta Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
A4IW24 0.000166 47 22 7 264 3 atpD ATP synthase subunit beta Francisella tularensis subsp. tularensis (strain WY96-3418)
Q5NIK3 0.000166 47 22 7 264 3 atpD ATP synthase subunit beta Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q14K06 0.000166 47 22 7 264 3 atpD ATP synthase subunit beta Francisella tularensis subsp. tularensis (strain FSC 198)
Q6MS92 0.000173 47 23 9 264 3 atpA ATP synthase subunit alpha Mycoplasma mycoides subsp. mycoides SC (strain CCUG 32753 / NCTC 10114 / PG1)
Q8YAM8 0.000186 47 27 7 218 3 atpA1 ATP synthase subunit alpha 1 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q1QQS8 0.000193 47 21 10 312 3 atpD ATP synthase subunit beta Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
Q1AVH9 0.000194 47 26 9 215 3 atpD ATP synthase subunit beta Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
O50292 0.000215 47 24 12 311 3 atpD ATP synthase subunit beta Aquifex pyrophilus
A3CS71 0.00022 47 26 8 228 3 atpA V-type ATP synthase alpha chain Methanoculleus marisnigri (strain ATCC 35101 / DSM 1498 / JR1)
A5HY52 0.000223 47 23 5 218 3 atpD ATP synthase subunit beta Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
C3KYJ3 0.000223 47 23 5 218 3 atpD ATP synthase subunit beta Clostridium botulinum (strain 657 / Type Ba4)
A7FQH9 0.000223 47 23 5 218 3 atpD ATP synthase subunit beta Clostridium botulinum (strain ATCC 19397 / Type A)
P52612 0.000223 47 25 5 241 1 fliI Flagellum-specific ATP synthase Escherichia coli (strain K12)
B1KSS8 0.000225 47 23 5 218 3 atpD ATP synthase subunit beta Clostridium botulinum (strain Loch Maree / Type A3)
Q98EV8 0.00023 47 22 8 273 3 atpD ATP synthase subunit beta Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
B2TK00 0.000235 47 23 5 218 3 atpD ATP synthase subunit beta Clostridium botulinum (strain Eklund 17B / Type B)
B2UZK0 0.000239 47 23 5 218 3 atpD ATP synthase subunit beta Clostridium botulinum (strain Alaska E43 / Type E3)
A1RX21 0.000245 47 22 7 245 3 atpA V-type ATP synthase alpha chain Thermofilum pendens (strain DSM 2475 / Hrk 5)
P0A301 0.000247 47 25 6 216 1 atpD ATP synthase subunit beta Streptomyces lividans
P0A300 0.000247 47 25 6 216 3 atpD ATP synthase subunit beta Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
C1FQP5 0.000265 46 23 5 218 3 atpD ATP synthase subunit beta Clostridium botulinum (strain Kyoto / Type A2)
A4YKE0 0.000266 47 23 8 277 3 atpD ATP synthase subunit beta Bradyrhizobium sp. (strain ORS 278)
A5E950 0.000278 46 23 8 277 3 atpD1 ATP synthase subunit beta 1 Bradyrhizobium sp. (strain BTAi1 / ATCC BAA-1182)
A7G9Q9 0.00028 46 23 5 218 3 atpD ATP synthase subunit beta Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
B1IE34 0.00028 46 23 5 218 3 atpD ATP synthase subunit beta Clostridium botulinum (strain Okra / Type B1)
Q3B3Z9 0.000282 46 23 9 263 3 atpA1 ATP synthase subunit alpha 1 Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
Q82J84 0.000284 46 25 6 216 3 atpD ATP synthase subunit beta Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
P05038 0.000312 46 22 11 312 1 atpD ATP synthase subunit beta Rhodospirillum rubrum
Q2RV18 0.000312 46 22 11 312 3 atpD ATP synthase subunit beta Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
A5UQN3 0.000316 46 23 7 226 3 atpD ATP synthase subunit beta Roseiflexus sp. (strain RS-1)
Q0BK84 0.000346 46 23 9 265 3 atpD ATP synthase subunit beta Francisella tularensis subsp. holarctica (strain OSU18)
Q2A1I2 0.000346 46 23 9 265 3 atpD ATP synthase subunit beta Francisella tularensis subsp. holarctica (strain LVS)
A7NEH4 0.000346 46 23 9 265 3 atpD ATP synthase subunit beta Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
Q11DD5 0.00035 46 22 8 273 3 atpD ATP synthase subunit beta Chelativorans sp. (strain BNC1)
B5ZAW1 0.000355 46 22 6 264 3 atpD ATP synthase subunit beta Ureaplasma urealyticum serovar 10 (strain ATCC 33699 / Western)
B5YI22 0.000356 46 22 6 222 3 atpA ATP synthase subunit alpha Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
A0AFR1 0.000357 46 24 9 252 3 atpD1 ATP synthase subunit beta 1 Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
B2SEY1 0.000365 46 22 7 264 3 atpD ATP synthase subunit beta Francisella tularensis subsp. mediasiatica (strain FSC147)
Q9PR15 0.000367 46 22 6 264 3 atpD ATP synthase subunit beta Ureaplasma parvum serovar 3 (strain ATCC 700970)
B1AIB8 0.000367 46 22 6 264 3 atpD ATP synthase subunit beta Ureaplasma parvum serovar 3 (strain ATCC 27815 / 27 / NCTC 11736)
Q92FH0 0.000374 46 25 8 219 3 atpA1 ATP synthase subunit alpha 1 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
A6UDM1 0.000375 46 21 6 271 3 atpD ATP synthase subunit beta Sinorhizobium medicae (strain WSM419)
A6TK63 0.000377 46 25 2 125 3 atpA ATP synthase subunit alpha Alkaliphilus metalliredigens (strain QYMF)
B5EFI7 0.00038 46 22 7 287 3 atpD ATP synthase subunit beta Citrifermentans bemidjiense (strain ATCC BAA-1014 / DSM 16622 / JCM 12645 / Bem)
Q9Z689 0.000426 46 22 6 248 3 atpA ATP synthase subunit alpha Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q50331 0.000488 45 24 8 256 3 atpD ATP synthase subunit beta Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
O67828 0.000502 45 24 12 311 3 atpD ATP synthase subunit beta Aquifex aeolicus (strain VF5)
A1JTC6 0.000514 45 21 4 280 3 atpD ATP synthase subunit beta Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q3J6N1 0.000531 45 21 5 290 3 atpD ATP synthase subunit beta Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
A8HS10 0.000553 45 22 7 277 3 atpD ATP synthase subunit beta Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q60CR4 0.000556 45 23 7 281 3 atpD ATP synthase subunit beta Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q6KI79 0.000562 45 26 5 176 3 atpA ATP synthase subunit alpha Mycoplasma mobile (strain ATCC 43663 / 163K / NCTC 11711)
C6E9F1 0.000568 45 23 6 264 3 atpD ATP synthase subunit beta Geobacter sp. (strain M21)
Q15SF1 0.000575 45 23 8 223 3 atpA1 ATP synthase subunit alpha 1 Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q92LK8 0.000583 45 21 6 271 3 atpD ATP synthase subunit beta Rhizobium meliloti (strain 1021)
P23704 0.000601 45 23 14 377 2 atp-2 ATP synthase subunit beta, mitochondrial Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q8EM83 0.000621 45 23 6 255 3 atpD ATP synthase subunit beta Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q8YAM6 0.000626 45 24 10 255 3 atpD1 ATP synthase subunit beta 1 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
C3M9S1 0.000659 45 21 6 271 3 atpD ATP synthase subunit beta Sinorhizobium fredii (strain NBRC 101917 / NGR234)
B1W0A3 0.000684 45 24 4 215 3 atpD ATP synthase subunit beta Streptomyces griseus subsp. griseus (strain JCM 4626 / CBS 651.72 / NBRC 13350 / KCC S-0626 / ISP 5235)
Q724W4 0.000701 45 24 7 219 3 atpD1 ATP synthase subunit beta 1 Listeria monocytogenes serotype 4b (strain F2365)
Q2G5N5 0.000727 45 24 11 308 3 atpD ATP synthase subunit beta Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
Q92FG8 0.000733 45 24 11 255 3 atpD1 ATP synthase subunit beta 1 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
A0Q8D9 0.000735 45 21 7 264 3 atpD ATP synthase subunit beta Francisella tularensis subsp. novicida (strain U112)
Q03V29 0.000741 45 23 9 259 3 atpD ATP synthase subunit beta Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
A7NIQ9 0.000786 45 23 7 226 3 atpD ATP synthase subunit beta Roseiflexus castenholzii (strain DSM 13941 / HLO8)
Q2ST36 0.000812 45 24 6 219 3 atpA ATP synthase subunit alpha Mycoplasma capricolum subsp. capricolum (strain California kid / ATCC 27343 / NCTC 10154)
Q8TWL6 0.000823 45 24 10 250 3 atpA V-type ATP synthase alpha chain Methanopyrus kandleri (strain AV19 / DSM 6324 / JCM 9639 / NBRC 100938)
Q6MAK5 0.000851 45 22 2 125 3 atpA ATP synthase subunit alpha Protochlamydia amoebophila (strain UWE25)
Q8UC76 0.000854 45 22 7 271 3 atpD ATP synthase subunit beta Agrobacterium fabrum (strain C58 / ATCC 33970)
A9NBD0 0.000871 45 23 8 290 3 atpD ATP synthase subunit beta Coxiella burnetii (strain RSA 331 / Henzerling II)
Q8FYR5 0.000899 45 23 9 273 3 atpD ATP synthase subunit beta Brucella suis biovar 1 (strain 1330)
A9WWS2 0.000899 45 23 9 273 3 atpD ATP synthase subunit beta Brucella suis (strain ATCC 23445 / NCTC 10510)
A5VSE1 0.000899 45 23 9 273 3 atpD ATP synthase subunit beta Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q8YJ35 0.000899 45 23 9 273 3 atpD ATP synthase subunit beta Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
A9M837 0.000899 45 23 9 273 3 atpD ATP synthase subunit beta Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q83AF5 0.001 45 23 8 290 3 atpD ATP synthase subunit beta Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
A9KBF7 0.001 45 23 8 290 3 atpD ATP synthase subunit beta Coxiella burnetii (strain Dugway 5J108-111)
Q1QSD0 0.001 45 23 5 250 3 atpD ATP synthase subunit beta Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
B0TWS7 0.001 45 21 7 264 3 atpD ATP synthase subunit beta Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
Q9LA80 0.001 45 24 11 270 3 atpD ATP synthase subunit beta Geobacillus thermoleovorans
Q57B88 0.001 45 23 9 273 3 atpD ATP synthase subunit beta Brucella abortus biovar 1 (strain 9-941)
Q2YLE6 0.001 45 23 9 273 3 atpD ATP synthase subunit beta Brucella abortus (strain 2308)
A0Q2Z4 0.001 45 23 5 218 3 atpD ATP synthase subunit beta Clostridium novyi (strain NT)
Q6F202 0.001 45 23 8 293 3 atpD ATP synthase subunit beta Mesoplasma florum (strain ATCC 33453 / NBRC 100688 / NCTC 11704 / L1)
Q0I7R2 0.001 45 26 2 120 3 atpA ATP synthase subunit alpha Synechococcus sp. (strain CC9311)
Q5KUJ3 0.001 45 24 11 270 1 atpD ATP synthase subunit beta Geobacillus kaustophilus (strain HTA426)

  • Number of RefSeq hits:

General

Source Morganella morganii S3
Locus tag LHKJJB_12905
Feature type CDS
Gene rho
Product transcription termination factor Rho
Location 18999 - 20258 (strand: 1)
Length 1260 (nucleotides) / 419 (amino acids)

Contig

Accession ZDB_370
Length 162442 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1327
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00006 ATP synthase alpha/beta family, nucleotide-binding domain
PF07497 Rho termination factor, RNA-binding domain
PF07498 Rho termination factor, N-terminal domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1158 Transcription (K) K Transcription termination factor Rho

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K03628 transcription termination factor Rho RNA degradation -

Protein Sequence

MNLTELKNTPVSELITLGENMGLENLARMRKQDIIFSILKQHAKSGEDIFGDGVLEILQDGFGFLRSADSSYLAGPDDIYVSPSQIRRFNLRTGDTISGKIRPPKEGERYFALLKVNEVNFDKPENARSKILFENLTPLHANRRLRMERGNGSTEDLTARVLDLAAPIGRGQRGLIVAPPKAGKTMLLQNIAANIAHNYPDCVLMVLLIDERPEEVTEMQRLVKGEVIASTFDEPAARHVQVAEMVIEKAKRLVEHKKDVIILLDSITRLARAYNTVVPSSGKVLTGGVDANALHRPKRFFGAARNVEEGGSLTIIATALVDTGSKMDEVIYEEFKGTGNMELHLSRKIAEKRVFPAIDYNRSGTRKEELLTTQDELQKMWILRKIIHPMGEIDAMEFLINKLAMTKTNEEFFDFMKRS

Flanking regions ( +/- flanking 50bp)

TATTCACGTTCATAATTCGAGATACACCCCGAGTCAAAGAACCCACCATTATGAATCTTACCGAATTAAAGAATACGCCGGTATCAGAGCTGATTACTCTTGGCGAAAATATGGGGCTGGAAAACCTGGCCCGCATGAGAAAACAGGACATCATCTTCTCTATCCTCAAGCAGCACGCGAAGAGCGGCGAGGATATTTTCGGTGACGGTGTGCTGGAAATATTGCAGGACGGCTTTGGTTTCCTCCGCTCTGCTGACAGTTCATACCTCGCAGGTCCTGATGATATCTACGTTTCTCCCAGCCAAATCCGCCGTTTTAACCTCCGTACCGGTGATACCATTTCAGGTAAAATCCGTCCGCCGAAAGAAGGTGAGCGCTATTTTGCCCTGCTGAAAGTTAACGAAGTTAACTTTGACAAACCTGAAAACGCCCGCAGTAAAATCCTGTTTGAAAACTTAACTCCACTGCACGCAAACCGTCGTCTGCGTATGGAGCGCGGTAATGGTTCAACAGAAGATTTAACCGCCCGTGTTCTTGATCTGGCTGCTCCTATCGGCCGTGGTCAGCGTGGTCTGATTGTGGCACCGCCGAAAGCCGGTAAAACCATGCTGCTGCAGAATATCGCAGCCAATATCGCACATAACTACCCTGACTGTGTGCTGATGGTTCTGCTGATCGACGAACGTCCGGAAGAAGTGACCGAGATGCAGCGTCTGGTCAAAGGTGAAGTTATCGCATCCACCTTTGATGAACCAGCTGCGCGTCACGTTCAGGTCGCGGAAATGGTTATCGAGAAAGCCAAACGCCTGGTTGAGCATAAAAAAGATGTCATCATCCTGCTCGACTCCATTACCCGTCTGGCCCGTGCCTATAACACCGTGGTTCCGTCCTCCGGTAAAGTACTGACCGGTGGTGTGGATGCTAACGCCCTGCATCGTCCTAAGCGTTTCTTCGGTGCTGCGCGTAACGTGGAAGAGGGCGGAAGCCTGACTATCATCGCAACGGCGCTGGTTGATACCGGGTCGAAGATGGATGAAGTTATCTACGAAGAGTTTAAAGGTACAGGTAACATGGAATTACACTTGTCCCGTAAGATTGCAGAAAAACGTGTCTTCCCGGCGATTGATTACAACCGTTCCGGTACACGTAAAGAAGAGCTGCTGACCACTCAGGACGAACTGCAGAAAATGTGGATCCTGCGCAAAATTATCCATCCGATGGGTGAGATTGATGCGATGGAGTTCCTGATTAACAAACTCGCGATGACGAAGACCAACGAAGAGTTCTTCGACTTCATGAAACGCTCGTAGCTTTTTGACGACACTTTATAACTAACGCCGCATGCATTGTGGCGTTTTTT