Homologs in group_1324

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_08200 FBDBKF_08200 100.0 Morganella morganii S1 gppA guanosine-5'-triphosphate,3'-diphosphate diphosphatase
EHELCC_13325 EHELCC_13325 100.0 Morganella morganii S2 gppA guanosine-5'-triphosphate,3'-diphosphate diphosphatase
NLDBIP_13665 NLDBIP_13665 100.0 Morganella morganii S4 gppA guanosine-5'-triphosphate,3'-diphosphate diphosphatase
HKOGLL_12140 HKOGLL_12140 100.0 Morganella morganii S5 gppA guanosine-5'-triphosphate,3'-diphosphate diphosphatase
F4V73_RS18750 F4V73_RS18750 91.2 Morganella psychrotolerans gppA guanosine-5'-triphosphate,3'-diphosphate diphosphatase
PMI_RS16460 PMI_RS16460 77.1 Proteus mirabilis HI4320 gppA guanosine-5'-triphosphate,3'-diphosphate diphosphatase

Distribution of the homologs in the orthogroup group_1324

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1324

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B4F1V2 0.0 767 77 0 502 3 gppA Guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase Proteus mirabilis (strain HI4320)
Q7MYL1 0.0 759 74 0 500 3 gppA Guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A8G827 0.0 749 73 1 498 3 gppA Guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase Serratia proteamaculans (strain 568)
C6DHF6 0.0 734 73 0 495 3 gppA Guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q6CZD8 0.0 731 72 0 495 3 gppA Guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A1JI66 0.0 728 73 0 495 3 gppA Guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
B1JQ12 0.0 727 72 0 495 3 gppA Guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66G20 0.0 727 72 0 495 3 gppA Guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TRC9 0.0 727 72 0 495 3 gppA Guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase Yersinia pestis (strain Pestoides F)
A9R8H6 0.0 727 72 0 495 3 gppA Guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase Yersinia pestis bv. Antiqua (strain Angola)
Q74R94 0.0 727 72 0 495 3 gppA Guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase Yersinia pestis
B2K045 0.0 727 72 0 495 3 gppA Guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
A7FD46 0.0 727 72 0 495 3 gppA Guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
B2VG72 0.0 725 72 0 493 3 gppA Guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
Q2NQB1 0.0 723 72 0 495 3 gppA Guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase Sodalis glossinidius (strain morsitans)
B7LU76 0.0 719 72 0 491 3 gppA Guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B7NF84 0.0 719 72 0 491 3 gppA Guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q1R4G0 0.0 717 72 0 491 3 gppA Guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase Escherichia coli (strain UTI89 / UPEC)
B1LLV2 0.0 717 72 0 491 3 gppA Guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase Escherichia coli (strain SMS-3-5 / SECEC)
A1AHU9 0.0 717 72 0 491 3 gppA Guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase Escherichia coli O1:K1 / APEC
B7MGI9 0.0 717 72 0 491 3 gppA Guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UMN4 0.0 717 72 0 491 3 gppA Guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q3YVI5 0.0 717 72 0 491 3 gppA Guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase Shigella sonnei (strain Ss046)
P25552 0.0 717 72 0 491 1 gppA Guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase Escherichia coli (strain K12)
B1IWC1 0.0 717 72 0 491 3 gppA Guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A6N3 0.0 717 72 0 491 3 gppA Guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase Escherichia coli O9:H4 (strain HS)
B1X9Z3 0.0 717 72 0 491 3 gppA Guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase Escherichia coli (strain K12 / DH10B)
C4ZZ47 0.0 717 72 0 491 3 gppA Guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase Escherichia coli (strain K12 / MC4100 / BW2952)
B7NTG3 0.0 717 72 0 491 3 gppA Guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5YY27 0.0 717 72 0 491 3 gppA Guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8XAT5 0.0 717 72 0 491 3 gppA Guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase Escherichia coli O157:H7
Q83PI3 0.0 717 72 0 491 3 gppA Guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase Shigella flexneri
Q31UK6 0.0 717 72 0 491 3 gppA Guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase Shigella boydii serotype 4 (strain Sb227)
B2TU13 0.0 717 72 0 491 3 gppA Guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B6I4B5 0.0 717 72 0 491 3 gppA Guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase Escherichia coli (strain SE11)
B7M5C6 0.0 717 72 0 491 3 gppA Guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase Escherichia coli O8 (strain IAI1)
B7L8C0 0.0 717 72 0 491 3 gppA Guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase Escherichia coli (strain 55989 / EAEC)
A7ZTY0 0.0 717 72 0 491 3 gppA Guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase Escherichia coli O139:H28 (strain E24377A / ETEC)
Q329V7 0.0 716 72 0 491 3 gppA Guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase Shigella dysenteriae serotype 1 (strain Sd197)
Q8FBR0 0.0 716 72 0 491 3 gppA Guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
B7N272 0.0 716 72 0 491 3 gppA Guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase Escherichia coli O81 (strain ED1a)
A8ACT2 0.0 716 72 0 491 3 gppA Guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q0SYW9 0.0 715 72 0 491 3 gppA Guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase Shigella flexneri serotype 5b (strain 8401)
B5XYZ0 0.0 714 71 0 490 3 gppA Guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase Klebsiella pneumoniae (strain 342)
A6TGG8 0.0 713 72 0 490 3 gppA Guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q57HT7 0.0 709 71 0 490 3 gppA Guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase Salmonella choleraesuis (strain SC-B67)
A9MXF2 0.0 709 71 0 490 3 gppA Guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
P0A267 0.0 707 71 0 490 3 gppA Guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A268 0.0 707 71 0 490 3 gppA Guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase Salmonella typhi
B4TNT2 0.0 707 71 0 490 3 gppA Guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase Salmonella schwarzengrund (strain CVM19633)
B4SZ25 0.0 707 71 0 490 3 gppA Guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase Salmonella newport (strain SL254)
B5QVH1 0.0 707 71 0 490 3 gppA Guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase Salmonella enteritidis PT4 (strain P125109)
B5EZ39 0.0 707 71 0 490 3 gppA Guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase Salmonella agona (strain SL483)
B5FN73 0.0 707 71 0 490 3 gppA Guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase Salmonella dublin (strain CT_02021853)
A4WG31 0.0 707 70 0 491 3 gppA Guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase Enterobacter sp. (strain 638)
C0Q2V8 0.0 706 71 0 490 3 gppA Guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase Salmonella paratyphi C (strain RKS4594)
B5RFS4 0.0 706 71 0 490 3 gppA Guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5BIS8 0.0 706 71 0 490 3 gppA Guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase Salmonella paratyphi A (strain AKU_12601)
Q5PKK4 0.0 706 71 0 490 3 gppA Guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4TB12 0.0 706 71 0 490 3 gppA Guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase Salmonella heidelberg (strain SL476)
A9MJ30 0.0 704 71 0 491 3 gppA Guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
A7MQI3 0.0 694 71 0 488 3 gppA Guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase Cronobacter sakazakii (strain ATCC BAA-894)
Q6LLL4 0.0 544 55 1 493 3 gppA Guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase Photobacterium profundum (strain SS9)
A0KEG8 0.0 527 54 1 495 3 gppA Guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q5E8U7 0.0 523 53 1 490 3 gppA Guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase Aliivibrio fischeri (strain ATCC 700601 / ES114)
B5FF86 2.61e-180 518 53 2 496 3 gppA Guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase Aliivibrio fischeri (strain MJ11)
A4STJ8 2.38e-178 513 53 1 495 3 gppA Guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase Aeromonas salmonicida (strain A449)
C3LQR0 1.73e-176 508 55 2 492 3 gppA Guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase Vibrio cholerae serotype O1 (strain M66-2)
Q9KV53 1.73e-176 508 55 2 492 3 gppA Guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F3R3 1.73e-176 508 55 2 492 3 gppA Guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q7MGP6 4.6e-176 507 55 2 492 3 gppA Guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase Vibrio vulnificus (strain YJ016)
Q8DDN5 4.6e-176 507 55 2 492 3 gppA Guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase Vibrio vulnificus (strain CMCP6)
A7MXT2 2.8e-174 503 54 2 489 3 gppA Guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase Vibrio campbellii (strain ATCC BAA-1116)
B7VMF0 5.27e-174 502 54 2 492 3 gppA Guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase Vibrio atlanticus (strain LGP32)
Q87KH4 2.58e-172 498 54 2 491 3 gppA Guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q3IDD5 1.27e-148 437 46 4 495 3 gppA Guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase Pseudoalteromonas translucida (strain TAC 125)
Q15N19 2.59e-136 406 43 3 490 3 gppA Guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q9S605 1.93e-115 352 40 5 489 1 ppx Exopolyphosphatase Pseudomonas aeruginosa
Q9ZN70 8.11e-115 351 40 5 489 1 ppx Exopolyphosphatase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9KU08 2.27e-110 339 39 4 490 3 ppx Exopolyphosphatase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P0A269 6.21e-99 310 36 5 498 3 ppx Exopolyphosphatase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A270 6.21e-99 310 36 5 498 3 ppx Exopolyphosphatase Salmonella typhi
P0AFL6 5.38e-97 305 34 6 509 1 ppx Exopolyphosphatase Escherichia coli (strain K12)
P0AFL7 5.38e-97 305 34 6 509 3 ppx Exopolyphosphatase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AFL8 5.38e-97 305 34 6 509 1 ppx Exopolyphosphatase Escherichia coli O157:H7
P44828 2.78e-77 248 43 2 306 5 ppx Putative exopolyphosphatase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P96374 9.34e-18 87 32 5 229 1 ppx2 Exopolyphosphatase 2 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
L7N5A6 9.34e-18 87 32 5 229 1 ppx2 Exopolyphosphatase 2 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q8RF47 7.93e-14 77 24 12 317 3 aroB Bifunctional 3-dehydroquinate synthase/phosphatase Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
P9WHV5 4.84e-11 67 25 4 300 1 ppx1 Exopolyphosphatase 1 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WHV4 4.84e-11 67 25 4 300 1 ppx Exopolyphosphatase 1 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P65787 4.84e-11 67 25 4 300 3 BQ2027_MB0507 Exopolyphosphatase 1 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P54882 1.5e-10 66 23 4 330 3 ML2434 Exopolyphosphatase 1 Mycobacterium leprae (strain TN)
Q9X8H1 2.88e-09 62 33 4 159 3 SCO3348 Uncharacterized protein SCO3348 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P32608 3.71e-07 56 26 8 253 1 RTG2 Retrograde regulation protein 2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)

  • Number of RefSeq hits:

General

Source Morganella morganii S3
Locus tag LHKJJB_12890
Feature type CDS
Gene gppA
Product guanosine-5'-triphosphate,3'-diphosphate diphosphatase
Location 15268 - 16776 (strand: -1)
Length 1509 (nucleotides) / 502 (amino acids)

Contig

Accession ZDB_370
Length 162442 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1324
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF02541 Ppx/GppA phosphatase family
PF21447 Ppx/GppA phosphatase, domain III

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0248 Nucleotide transport and metabolism (F)
Signal transduction mechanisms (T)
FT Exopolyphosphatase/pppGpp-phosphohydrolase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K01524 exopolyphosphatase / guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase [EC:3.6.1.11 3.6.1.40] Purine metabolism
Metabolic pathways
-

Protein Sequence

MLRSSSLYAAIDLGSNSFHMLVVREIAGSIQVLSRIKRKVRLAAGLDKENILSPAAMARGWQCLRLFSEHLQDIPDSQIRVVATATLRLARNAGEFLETAAEILGHPVTVIRGEEEARLIYQGVAHTTGGSDKRLVVDIGGGSTELVTGSGTRTTALFSLEMGCVTWLERYFTDRSLTTENFAGAEQAARDIIAPVAPALLEQGWQVCVGASGTVQALQEIMIAQGMDEQITLPKLQQLKRKAIECGKLEELEIEGLTLERALVFPSGLAILIAIFETLGIDGMTLAGGALREGLVYGMLELPVEQDIRTRTLKNIQKRFQIDADQGKRVRQLADHFFQQVATAWQLDIRCRELLSSASLIHEIGLSVDFRKGPEHAGYLVSNLDLPGFTPAQRRLLAVLLRNQSGPLDIHSLNQQNALTPREAGCLCRLLRLAIIFASRRRDDTLPSLRIRASAEGLIITLPVGWQQLHPLRAEALQQEIQWQSYVQWSLMLEEQKPSTLG

Flanking regions ( +/- flanking 50bp)

AGCAACGGGCCGCGTCATAACAATAACCGCACCAAACGCTGAAGGCTGCCATGCTGAGATCGTCCTCGCTTTATGCTGCCATCGATCTGGGTTCCAACAGCTTTCATATGCTGGTGGTACGGGAGATTGCGGGCAGTATTCAGGTACTGTCACGGATAAAACGCAAGGTTCGTCTGGCGGCCGGTCTGGATAAAGAGAATATCCTGTCTCCGGCAGCGATGGCCCGCGGCTGGCAGTGTCTGCGTCTGTTTTCCGAACATCTGCAGGATATCCCGGACTCCCAGATCCGCGTGGTGGCGACAGCCACCCTGCGCCTGGCCAGAAATGCCGGTGAATTTCTGGAAACAGCAGCGGAGATCCTCGGTCATCCGGTCACAGTTATCCGGGGTGAGGAAGAAGCACGTCTGATTTATCAGGGCGTTGCCCACACCACCGGCGGGTCAGACAAACGCCTGGTGGTCGATATCGGCGGCGGCAGTACCGAACTGGTGACCGGCAGCGGCACCCGGACCACCGCCCTGTTCAGCCTGGAGATGGGCTGCGTCACCTGGCTGGAGCGCTATTTTACCGATCGCTCCCTGACCACCGAGAATTTCGCCGGTGCCGAACAGGCTGCCCGCGATATTATCGCCCCGGTTGCTCCCGCACTTCTGGAGCAGGGCTGGCAGGTGTGTGTCGGCGCATCAGGTACTGTCCAGGCACTTCAGGAAATCATGATTGCCCAGGGCATGGATGAACAAATCACCCTGCCGAAACTGCAGCAGCTCAAACGCAAAGCGATTGAGTGCGGCAAACTGGAAGAGCTGGAGATTGAAGGGCTGACGCTGGAACGGGCACTGGTATTCCCGAGCGGGCTGGCCATTCTTATCGCGATTTTTGAAACGCTCGGCATTGACGGCATGACACTCGCCGGGGGTGCACTGCGTGAAGGGCTGGTCTACGGCATGCTGGAATTGCCGGTAGAGCAGGACATCCGCACCCGGACACTGAAAAATATTCAGAAGCGTTTTCAGATAGATGCCGACCAGGGTAAACGTGTCCGTCAGTTAGCGGATCACTTTTTTCAGCAGGTGGCGACCGCCTGGCAGCTGGATATCCGCTGCCGTGAACTGCTCAGCAGCGCCTCTCTGATCCATGAAATCGGGCTGAGTGTTGATTTCCGCAAAGGCCCGGAACATGCCGGTTATCTGGTCAGTAATCTGGATTTACCCGGTTTCACACCGGCACAACGCCGCCTGTTAGCGGTGCTGTTGCGCAATCAGAGCGGCCCGCTGGATATCCATTCTCTCAATCAGCAAAATGCGCTGACACCGCGTGAAGCCGGTTGCCTGTGTCGTCTGCTGCGTCTGGCGATTATTTTTGCCAGCCGCCGCCGTGATGACACGCTGCCGTCACTGCGCATCCGGGCGTCTGCGGAAGGGCTGATTATCACACTGCCGGTCGGCTGGCAGCAATTGCATCCGCTGCGCGCGGAAGCATTACAGCAGGAAATTCAGTGGCAGAGTTATGTGCAGTGGTCACTGATGCTGGAAGAACAGAAGCCGTCCACTCTCGGCTGATAAATAATAAGCCCTGATTATCCGTTTCCGGACACTATCAGGGCTTTAAT