Homologs in group_1016

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_05175 FBDBKF_05175 100.0 Morganella morganii S1 trpB tryptophan synthase subunit beta
EHELCC_12415 EHELCC_12415 100.0 Morganella morganii S2 trpB tryptophan synthase subunit beta
NLDBIP_12755 NLDBIP_12755 100.0 Morganella morganii S4 trpB tryptophan synthase subunit beta
HKOGLL_11230 HKOGLL_11230 100.0 Morganella morganii S5 trpB tryptophan synthase subunit beta
F4V73_RS05630 F4V73_RS05630 94.2 Morganella psychrotolerans trpB tryptophan synthase subunit beta
PMI_RS06500 PMI_RS06500 86.4 Proteus mirabilis HI4320 trpB tryptophan synthase subunit beta

Distribution of the homologs in the orthogroup group_1016

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1016

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q7N486 0.0 726 86 0 396 3 trpB Tryptophan synthase beta chain Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A8GF82 0.0 724 85 0 396 3 trpB Tryptophan synthase beta chain Serratia proteamaculans (strain 568)
C6DGZ5 0.0 722 86 0 396 3 trpB Tryptophan synthase beta chain Pectobacterium carotovorum subsp. carotovorum (strain PC1)
A6T7W6 0.0 722 86 0 393 3 trpB Tryptophan synthase beta chain Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B5XT02 0.0 722 86 0 393 3 trpB Tryptophan synthase beta chain Klebsiella pneumoniae (strain 342)
B4EWH7 0.0 721 86 0 396 3 trpB Tryptophan synthase beta chain Proteus mirabilis (strain HI4320)
B7LS19 0.0 721 86 0 393 3 trpB Tryptophan synthase beta chain Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
P0A2K1 0.0 720 86 0 393 1 trpB Tryptophan synthase beta chain Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2K2 0.0 720 86 0 393 3 trpB Tryptophan synthase beta chain Salmonella typhi
B4TX38 0.0 720 86 0 393 3 trpB Tryptophan synthase beta chain Salmonella schwarzengrund (strain CVM19633)
B5BIC1 0.0 720 86 0 393 3 trpB Tryptophan synthase beta chain Salmonella paratyphi A (strain AKU_12601)
C0Q3N4 0.0 720 86 0 393 3 trpB Tryptophan synthase beta chain Salmonella paratyphi C (strain RKS4594)
A9MWR4 0.0 720 86 0 393 3 trpB Tryptophan synthase beta chain Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PD17 0.0 720 86 0 393 3 trpB Tryptophan synthase beta chain Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4T6X1 0.0 720 86 0 393 3 trpB Tryptophan synthase beta chain Salmonella newport (strain SL254)
B4TJK8 0.0 720 86 0 393 3 trpB Tryptophan synthase beta chain Salmonella heidelberg (strain SL476)
B5R6M5 0.0 720 86 0 393 3 trpB Tryptophan synthase beta chain Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5R3P4 0.0 720 86 0 393 3 trpB Tryptophan synthase beta chain Salmonella enteritidis PT4 (strain P125109)
B5FU66 0.0 720 86 0 393 3 trpB Tryptophan synthase beta chain Salmonella dublin (strain CT_02021853)
B5F4M4 0.0 720 86 0 393 3 trpB Tryptophan synthase beta chain Salmonella agona (strain SL483)
Q3Z109 0.0 720 86 0 393 3 trpB Tryptophan synthase beta chain Shigella sonnei (strain Ss046)
Q6D4U0 0.0 720 86 0 396 3 trpB Tryptophan synthase beta chain Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
B5YZP1 0.0 720 86 0 393 3 trpB Tryptophan synthase beta chain Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X7B6 0.0 720 86 0 393 3 trpB Tryptophan synthase beta chain Escherichia coli O157:H7
A8AG61 0.0 719 85 0 393 3 trpB Tryptophan synthase beta chain Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q32GS9 0.0 719 86 0 393 3 trpB Tryptophan synthase beta chain Shigella dysenteriae serotype 1 (strain Sd197)
B1LH31 0.0 719 86 0 393 3 trpB Tryptophan synthase beta chain Escherichia coli (strain SMS-3-5 / SECEC)
Q8FHV9 0.0 719 86 0 393 3 trpB Tryptophan synthase beta chain Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TIA9 0.0 719 86 0 393 3 trpB Tryptophan synthase beta chain Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B7MUA0 0.0 719 86 0 393 3 trpB Tryptophan synthase beta chain Escherichia coli O81 (strain ED1a)
B7NVN1 0.0 719 86 0 393 3 trpB Tryptophan synthase beta chain Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7UR67 0.0 719 86 0 393 3 trpB Tryptophan synthase beta chain Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A7MMG1 0.0 719 85 0 393 3 trpB Tryptophan synthase beta chain Cronobacter sakazakii (strain ATCC BAA-894)
Q57NT3 0.0 719 85 0 393 3 trpB Tryptophan synthase beta chain Salmonella choleraesuis (strain SC-B67)
P0A880 0.0 718 85 0 393 3 trpB Tryptophan synthase beta chain Shigella flexneri
Q0T5D5 0.0 718 85 0 393 3 trpB Tryptophan synthase beta chain Shigella flexneri serotype 5b (strain 8401)
B6I9X5 0.0 718 85 0 393 3 trpB Tryptophan synthase beta chain Escherichia coli (strain SE11)
P0A879 0.0 718 85 0 393 1 trpB Tryptophan synthase beta chain Escherichia coli (strain K12)
B1ITJ4 0.0 718 85 0 393 3 trpB Tryptophan synthase beta chain Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A7ZZJ7 0.0 718 85 0 393 3 trpB Tryptophan synthase beta chain Escherichia coli O9:H4 (strain HS)
B1XBL0 0.0 718 85 0 393 3 trpB Tryptophan synthase beta chain Escherichia coli (strain K12 / DH10B)
B7LY17 0.0 718 85 0 393 3 trpB Tryptophan synthase beta chain Escherichia coli O8 (strain IAI1)
B7L493 0.0 718 85 0 393 3 trpB Tryptophan synthase beta chain Escherichia coli (strain 55989 / EAEC)
A7ZL79 0.0 718 85 0 393 3 trpB Tryptophan synthase beta chain Escherichia coli O139:H28 (strain E24377A / ETEC)
A1JPX6 0.0 718 85 0 396 3 trpB Tryptophan synthase beta chain Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q1RCA6 0.0 717 85 0 393 3 trpB Tryptophan synthase beta chain Escherichia coli (strain UTI89 / UPEC)
A1AAN1 0.0 717 85 0 393 3 trpB Tryptophan synthase beta chain Escherichia coli O1:K1 / APEC
B7ML77 0.0 717 85 0 393 3 trpB Tryptophan synthase beta chain Escherichia coli O45:K1 (strain S88 / ExPEC)
B7N474 0.0 717 85 0 393 3 trpB Tryptophan synthase beta chain Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B1JKS2 0.0 716 85 0 396 3 trpB Tryptophan synthase beta chain Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66AK4 0.0 716 85 0 396 3 trpB Tryptophan synthase beta chain Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TJ67 0.0 716 85 0 396 3 trpB Tryptophan synthase beta chain Yersinia pestis (strain Pestoides F)
Q1CJ28 0.0 716 85 0 396 3 trpB Tryptophan synthase beta chain Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZEG9 0.0 716 85 0 396 3 trpB Tryptophan synthase beta chain Yersinia pestis
B2K3W2 0.0 716 85 0 396 3 trpB Tryptophan synthase beta chain Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C7P2 0.0 716 85 0 396 3 trpB Tryptophan synthase beta chain Yersinia pestis bv. Antiqua (strain Antiqua)
A7FI33 0.0 716 85 0 396 3 trpB Tryptophan synthase beta chain Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A9MPY7 0.0 715 85 0 393 3 trpB Tryptophan synthase beta chain Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
A4WB02 0.0 714 85 0 393 3 trpB Tryptophan synthase beta chain Enterobacter sp. (strain 638)
Q31ZV4 0.0 714 85 0 393 3 trpB Tryptophan synthase beta chain Shigella boydii serotype 4 (strain Sb227)
B2U0F2 0.0 714 85 0 393 3 trpB Tryptophan synthase beta chain Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B2VKT2 0.0 705 84 0 396 3 trpB Tryptophan synthase beta chain Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
C5BDB7 0.0 701 84 0 396 3 trpB Tryptophan synthase beta chain Edwardsiella ictaluri (strain 93-146)
Q2NT52 0.0 694 82 0 396 3 trpB Tryptophan synthase beta chain Sodalis glossinidius (strain morsitans)
P22097 0.0 684 82 0 394 3 trpB1 Tryptophan synthase beta chain 1 Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q7MM56 0.0 684 82 0 394 3 trpB Tryptophan synthase beta chain Vibrio vulnificus (strain YJ016)
Q8D8B2 0.0 684 82 0 394 3 trpB Tryptophan synthase beta chain Vibrio vulnificus (strain CMCP6)
Q5E623 0.0 682 81 0 396 3 trpB Tryptophan synthase beta chain Aliivibrio fischeri (strain ATCC 700601 / ES114)
B5FDB7 0.0 679 81 0 396 3 trpB Tryptophan synthase beta chain Aliivibrio fischeri (strain MJ11)
A7MRY0 0.0 678 81 0 394 3 trpB Tryptophan synthase beta chain Vibrio campbellii (strain ATCC BAA-1116)
Q6LPA4 0.0 677 80 0 394 3 trpB Tryptophan synthase beta chain Photobacterium profundum (strain SS9)
A0Q8M6 0.0 674 80 0 396 3 trpB Tryptophan synthase beta chain Francisella tularensis subsp. novicida (strain U112)
B0TWI3 0.0 674 80 0 396 3 trpB Tryptophan synthase beta chain Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
Q5NE79 0.0 673 80 0 396 1 trpB Tryptophan synthase beta chain Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
B2SEK7 0.0 673 80 0 396 3 trpB Tryptophan synthase beta chain Francisella tularensis subsp. mediasiatica (strain FSC147)
Q14FN2 0.0 673 80 0 396 3 trpB Tryptophan synthase beta chain Francisella tularensis subsp. tularensis (strain FSC 198)
Q0BP45 0.0 672 80 0 396 3 trpB Tryptophan synthase beta chain Francisella tularensis subsp. holarctica (strain OSU18)
Q2A5V3 0.0 672 80 0 396 3 trpB Tryptophan synthase beta chain Francisella tularensis subsp. holarctica (strain LVS)
A7N9D2 0.0 672 80 0 396 3 trpB Tryptophan synthase beta chain Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
B7VGU7 0.0 671 79 0 394 3 trpB Tryptophan synthase beta chain Vibrio atlanticus (strain LGP32)
A4IVS4 0.0 670 80 0 396 3 trpB Tryptophan synthase beta chain Francisella tularensis subsp. tularensis (strain WY96-3418)
C3LLL6 0.0 667 80 0 394 3 trpB Tryptophan synthase beta chain Vibrio cholerae serotype O1 (strain M66-2)
Q9KST6 0.0 667 80 0 394 3 trpB Tryptophan synthase beta chain Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F208 0.0 667 80 0 394 3 trpB Tryptophan synthase beta chain Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
B6EJA3 0.0 665 79 0 396 3 trpB Tryptophan synthase beta chain Aliivibrio salmonicida (strain LFI1238)
Q65TF0 0.0 664 80 0 391 3 trpB Tryptophan synthase beta chain Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
A5UEU5 0.0 659 79 0 391 3 trpB Tryptophan synthase beta chain Haemophilus influenzae (strain PittGG)
A6VPD9 0.0 658 78 0 393 3 trpB Tryptophan synthase beta chain Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
B3GX46 0.0 658 79 0 388 3 trpB Tryptophan synthase beta chain Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
B0BU72 0.0 656 79 0 388 3 trpB Tryptophan synthase beta chain Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
A3MZI7 0.0 656 79 0 388 3 trpB Tryptophan synthase beta chain Actinobacillus pleuropneumoniae serotype 5b (strain L20)
P43760 0.0 656 79 0 388 3 trpB Tryptophan synthase beta chain Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A5UC40 0.0 656 79 0 388 3 trpB Tryptophan synthase beta chain Haemophilus influenzae (strain PittEE)
B0UU34 0.0 652 78 0 391 3 trpB Tryptophan synthase beta chain Histophilus somni (strain 2336)
Q4QKF5 0.0 652 78 0 388 3 trpB Tryptophan synthase beta chain Haemophilus influenzae (strain 86-028NP)
A8H2X4 0.0 650 79 1 390 3 trpB Tryptophan synthase beta chain Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
A1S7I2 0.0 645 79 1 391 3 trpB Tryptophan synthase beta chain Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
A4SKT1 0.0 645 77 0 394 3 trpB Tryptophan synthase beta chain Aeromonas salmonicida (strain A449)
Q0HWI3 0.0 643 78 1 391 3 trpB Tryptophan synthase beta chain Shewanella sp. (strain MR-7)
Q084N8 0.0 643 78 1 391 3 trpB Tryptophan synthase beta chain Shewanella frigidimarina (strain NCIMB 400)
Q0HK81 0.0 642 78 1 391 3 trpB Tryptophan synthase beta chain Shewanella sp. (strain MR-4)
A0KVD1 0.0 642 78 1 391 3 trpB Tryptophan synthase beta chain Shewanella sp. (strain ANA-3)
A3QF73 0.0 641 78 1 393 3 trpB Tryptophan synthase beta chain Shewanella loihica (strain ATCC BAA-1088 / PV-4)
B0TP63 0.0 640 78 1 391 3 trpB Tryptophan synthase beta chain Shewanella halifaxensis (strain HAW-EB4)
A3D630 0.0 640 78 1 391 3 trpB Tryptophan synthase beta chain Shewanella baltica (strain OS155 / ATCC BAA-1091)
A0KMD0 0.0 640 77 0 396 3 trpB Tryptophan synthase beta chain Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q12LE2 0.0 640 78 1 391 3 trpB Tryptophan synthase beta chain Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
B8CLM6 0.0 639 77 1 393 3 trpB Tryptophan synthase beta chain Shewanella piezotolerans (strain WP3 / JCM 13877)
A4Y845 0.0 639 78 1 391 3 trpB Tryptophan synthase beta chain Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
A6WPX1 0.0 639 78 1 391 3 trpB Tryptophan synthase beta chain Shewanella baltica (strain OS185)
A1RIE3 0.0 639 78 1 391 3 trpB Tryptophan synthase beta chain Shewanella sp. (strain W3-18-1)
Q8ECV0 0.0 639 78 1 391 3 trpB Tryptophan synthase beta chain Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
A9KTR7 0.0 639 78 1 391 3 trpB Tryptophan synthase beta chain Shewanella baltica (strain OS195)
B1KK02 0.0 635 77 1 393 3 trpB Tryptophan synthase beta chain Shewanella woodyi (strain ATCC 51908 / MS32)
C4LC89 0.0 634 76 0 394 3 trpB Tryptophan synthase beta chain Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
P54203 0.0 628 76 0 391 3 trpB Tryptophan synthase beta chain Pasteurella multocida (strain Pm70)
P42391 0.0 620 73 1 391 3 trpB Tryptophan synthase beta chain Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
O68428 0.0 618 71 0 394 3 trpB Tryptophan synthase beta chain Buchnera aphidicola subsp. Diuraphis noxia
A1STT0 0.0 613 77 1 394 3 trpB Tryptophan synthase beta chain Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q9RCE8 0.0 606 73 3 394 3 trpB Tryptophan synthase beta chain Vibrio metschnikovii
Q44685 0.0 599 72 2 390 3 trpB Tryptophan synthase beta chain Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q15RZ5 0.0 590 73 1 390 3 trpB Tryptophan synthase beta chain Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
P59458 0.0 587 70 1 393 3 trpB Tryptophan synthase beta chain Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
B4S1J4 0.0 585 71 1 390 3 trpB Tryptophan synthase beta chain Alteromonas mediterranea (strain DSM 17117 / CIP 110805 / LMG 28347 / Deep ecotype)
Q44687 0.0 584 70 0 391 3 trpB Tryptophan synthase beta chain Buchnera aphidicola subsp. Melaphis rhois
Q492N6 0.0 577 68 0 395 3 trpB Tryptophan synthase beta chain Blochmanniella pennsylvanica (strain BPEN)
Q59169 0.0 568 68 0 386 3 trpB Tryptophan synthase beta chain Buchnera aphidicola subsp. Schlechtendalia chinensis
Q7VR00 0.0 567 68 0 386 3 trpB Tryptophan synthase beta chain Blochmanniella floridana
P56142 0.0 538 66 1 385 3 trpB Tryptophan synthase beta chain Helicobacter pylori (strain ATCC 700392 / 26695)
Q9ZJU9 0.0 537 65 1 385 3 trpB Tryptophan synthase beta chain Helicobacter pylori (strain J99 / ATCC 700824)
A4QI76 0.0 515 65 2 386 3 trpB Tryptophan synthase beta chain Corynebacterium glutamicum (strain R)
P06561 0.0 514 65 2 386 3 trpB Tryptophan synthase beta chain Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q8FLJ6 8.22e-180 509 64 2 386 3 trpB1 Tryptophan synthase beta chain 1 Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q8U093 9.14e-170 483 59 2 384 1 trpB1 Tryptophan synthase beta chain 1 Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q9V1G8 4.83e-168 478 60 2 384 3 trpB1 Tryptophan synthase beta chain 1 Pyrococcus abyssi (strain GE5 / Orsay)
A6UW25 1.86e-167 477 59 2 385 3 trpB Tryptophan synthase beta chain Methanococcus aeolicus (strain ATCC BAA-1280 / DSM 17508 / OCM 812 / Nankai-3)
Q8FT12 1.04e-164 472 59 4 396 3 trpB2 Tryptophan synthase beta chain 2 Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
B0K8T6 6.13e-164 468 59 2 384 3 trpB Tryptophan synthase beta chain Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
A5FY57 8.76e-164 468 62 3 380 3 trpB Tryptophan synthase beta chain Acidiphilium cryptum (strain JF-5)
B0K2T9 3.6e-163 466 58 2 384 3 trpB Tryptophan synthase beta chain Thermoanaerobacter sp. (strain X514)
Q8R9M9 4.53e-163 466 58 2 384 3 trpB Tryptophan synthase beta chain Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q9YGB0 7.79e-163 465 60 4 390 3 trpB1 Tryptophan synthase beta chain 1 Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
A0PYH3 2.06e-162 464 57 2 380 3 trpB Tryptophan synthase beta chain Clostridium novyi (strain NT)
Q82A82 3.23e-162 465 59 2 385 3 trpB Tryptophan synthase beta chain Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
O05625 5.44e-162 464 59 2 385 3 trpB Tryptophan synthase beta chain Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
A8FEJ8 8.52e-162 462 59 3 388 3 trpB Tryptophan synthase beta chain Bacillus pumilus (strain SAFR-032)
P14638 1.66e-161 462 56 3 394 3 trpB Tryptophan synthase beta chain Methanococcus voltae
B1W0P0 2.52e-161 462 58 2 385 3 trpB Tryptophan synthase beta chain Streptomyces griseus subsp. griseus (strain JCM 4626 / CBS 651.72 / NBRC 13350 / KCC S-0626 / ISP 5235)
O28672 2.98e-161 461 58 3 386 3 trpB1 Tryptophan synthase beta chain 1 Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
O66923 6.54e-161 460 58 2 381 3 trpB1 Tryptophan synthase beta chain 1 Aquifex aeolicus (strain VF5)
B2V8W5 4.11e-159 456 56 2 385 3 trpB Tryptophan synthase beta chain Sulfurihydrogenibium sp. (strain YO3AOP1)
Q97EF5 4.6e-159 456 57 2 384 3 trpB Tryptophan synthase beta chain Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q60179 1.35e-158 455 59 3 384 3 trpB Tryptophan synthase beta chain Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
A5N7P0 1.47e-158 454 56 2 383 3 trpB Tryptophan synthase beta chain Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
B9E151 1.47e-158 454 56 2 383 3 trpB Tryptophan synthase beta chain Clostridium kluyveri (strain NBRC 12016)
A6WX28 2.1e-158 454 58 2 380 3 trpB Tryptophan synthase beta chain Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
B5EK18 1.27e-157 452 59 2 381 3 trpB Tryptophan synthase beta chain Acidithiobacillus ferrooxidans (strain ATCC 53993 / BNL-5-31)
B7J4S9 1.27e-157 452 59 2 381 3 trpB Tryptophan synthase beta chain Acidithiobacillus ferrooxidans (strain ATCC 23270 / DSM 14882 / CIP 104768 / NCIMB 8455)
A6TM76 4.1e-157 451 54 2 396 3 trpB Tryptophan synthase beta chain Alkaliphilus metalliredigens (strain QYMF)
B9JG43 9.91e-156 447 58 3 386 3 trpB Tryptophan synthase beta chain Rhizobium rhizogenes (strain K84 / ATCC BAA-868)
B4RCL0 1.08e-155 447 58 2 380 3 trpB Tryptophan synthase beta chain Phenylobacterium zucineum (strain HLK1)
Q01998 1.49e-155 447 55 2 387 3 trpB Tryptophan synthase beta chain Lactococcus lactis subsp. lactis (strain IL1403)
Q2G8S7 2.08e-155 447 58 3 381 3 trpB Tryptophan synthase beta chain Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
Q92TC9 3.45e-155 446 58 3 386 3 trpB Tryptophan synthase beta chain Rhizobium meliloti (strain 1021)
Q5LV94 4.05e-155 446 59 3 381 3 trpB Tryptophan synthase beta chain Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q1H0M1 9.63e-155 445 58 3 382 3 trpB Tryptophan synthase beta chain Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q8FXY4 1.07e-154 445 57 2 380 3 trpB Tryptophan synthase beta chain Brucella suis biovar 1 (strain 1330)
A9M9U2 1.07e-154 445 57 2 380 3 trpB Tryptophan synthase beta chain Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q65I35 1.34e-154 445 56 3 385 3 trpB Tryptophan synthase beta chain Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q28LA6 3.05e-154 444 58 3 381 3 trpB Tryptophan synthase beta chain Jannaschia sp. (strain CCS1)
Q02YB7 3.17e-154 444 55 2 387 3 trpB Tryptophan synthase beta chain Lactococcus lactis subsp. cremoris (strain SK11)
A2RK24 4.08e-154 443 55 2 387 3 trpB Tryptophan synthase beta chain Lactococcus lactis subsp. cremoris (strain MG1363)
Q8YE60 4.3e-154 443 57 2 380 3 trpB Tryptophan synthase beta chain Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
C0RFZ4 4.3e-154 443 57 2 380 3 trpB Tryptophan synthase beta chain Brucella melitensis biotype 2 (strain ATCC 23457)
Q57AF0 5.9e-154 443 57 2 380 3 trpB Tryptophan synthase beta chain Brucella abortus biovar 1 (strain 9-941)
Q2YQW5 5.9e-154 443 57 2 380 3 trpB Tryptophan synthase beta chain Brucella abortus (strain 2308)
B2S9A5 5.9e-154 443 57 2 380 3 trpB Tryptophan synthase beta chain Brucella abortus (strain S19)
Q6AF67 1.47e-153 442 56 3 391 3 trpB Tryptophan synthase beta chain Leifsonia xyli subsp. xyli (strain CTCB07)
B0CJK8 1.49e-153 442 57 2 380 3 trpB Tryptophan synthase beta chain Brucella suis (strain ATCC 23445 / NCTC 10510)
Q9KCB0 1.54e-153 442 56 3 388 3 trpB Tryptophan synthase beta chain Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q604P3 1.93e-153 442 58 2 381 3 trpB Tryptophan synthase beta chain Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q98CN7 3.44e-153 441 56 2 390 3 trpB Tryptophan synthase beta chain Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q8YQM6 4.4e-153 441 56 2 385 3 trpB2 Tryptophan synthase beta chain 2 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
C3MB99 6.44e-153 441 57 3 386 3 trpB Tryptophan synthase beta chain Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q3MBV3 7.03e-153 441 56 2 385 3 trpB Tryptophan synthase beta chain Trichormus variabilis (strain ATCC 29413 / PCC 7937)
P50909 7.6e-153 439 57 3 382 1 trpB1 Tryptophan synthase beta chain 1 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q2KE82 7.75e-153 440 56 3 386 1 trpB Tryptophan synthase beta chain Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
B5ZV70 8.27e-153 440 57 3 386 3 trpB Tryptophan synthase beta chain Rhizobium leguminosarum bv. trifolii (strain WSM2304)
Q1MND6 8.36e-153 440 57 3 386 3 trpB Tryptophan synthase beta chain Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
A5IBF7 1.2e-152 439 56 2 381 3 trpB Tryptophan synthase beta chain Legionella pneumophila (strain Corby)
P34817 1.53e-152 439 56 2 380 3 trpB Tryptophan synthase beta chain Pseudomonas syringae pv. syringae
A6LU96 1.55e-152 439 58 3 381 3 trpB Tryptophan synthase beta chain Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
Q5WX32 1.56e-152 439 56 2 381 3 trpB Tryptophan synthase beta chain Legionella pneumophila (strain Lens)
Q5X5Q2 1.56e-152 439 56 2 381 3 trpB Tryptophan synthase beta chain Legionella pneumophila (strain Paris)
Q11KK9 2.02e-152 439 57 3 387 3 trpB Tryptophan synthase beta chain Chelativorans sp. (strain BNC1)
B3PVV2 2.33e-152 439 57 2 384 3 trpB Tryptophan synthase beta chain Rhizobium etli (strain CIAT 652)
A6UEI1 4.16e-152 438 57 3 386 3 trpB Tryptophan synthase beta chain Sinorhizobium medicae (strain WSM419)
Q89WE5 4.44e-152 438 55 3 388 3 trpB Tryptophan synthase beta chain Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q7NGX9 5.42e-152 438 56 2 380 3 trpB Tryptophan synthase beta chain Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q4KKP4 8.55e-152 437 56 2 383 3 trpB Tryptophan synthase beta chain Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
P07345 8.97e-152 437 56 2 380 3 trpB Tryptophan synthase beta chain Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q3KK59 9.19e-152 437 56 2 383 3 trpB Tryptophan synthase beta chain Pseudomonas fluorescens (strain Pf0-1)
B0UIA8 9.64e-152 437 55 2 384 3 trpB Tryptophan synthase beta chain Methylobacterium sp. (strain 4-46)
Q1GK77 1.34e-151 437 58 4 386 3 trpB Tryptophan synthase beta chain Ruegeria sp. (strain TM1040)
P43283 1.71e-151 436 55 2 383 2 TSB1 Tryptophan synthase beta chain 1 (Fragment) Zea mays
Q3SHL9 1.88e-151 436 57 2 381 3 trpB Tryptophan synthase beta chain Thiobacillus denitrificans (strain ATCC 25259)
Q5ZVY4 1.96e-151 436 55 2 381 3 trpB Tryptophan synthase beta chain Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
B1J4B1 2.23e-151 436 54 2 390 3 trpB Tryptophan synthase beta chain Pseudomonas putida (strain W619)
B9JXV6 2.49e-151 436 56 3 386 3 trpB Tryptophan synthase beta chain Allorhizobium ampelinum (strain ATCC BAA-846 / DSM 112012 / S4)
A7HPD3 4.69e-151 436 57 2 382 3 trpB Tryptophan synthase beta chain Parvibaculum lavamentivorans (strain DS-1 / DSM 13023 / NCIMB 13966)
Q8Y6Q6 4.8e-151 436 54 2 380 3 trpB Tryptophan synthase beta chain Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q161H9 5.68e-151 436 57 3 384 3 trpB Tryptophan synthase beta chain Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
B6JCP2 5.96e-151 435 54 3 388 3 trpB Tryptophan synthase beta chain Afipia carboxidovorans (strain ATCC 49405 / DSM 1227 / KCTC 32145 / OM5)
A8LSF9 8.8e-151 435 57 3 384 3 trpB Tryptophan synthase beta chain Dinoroseobacter shibae (strain DSM 16493 / NCIMB 14021 / DFL 12)
B1ZG57 1.25e-150 435 54 2 391 3 trpB Tryptophan synthase beta chain Methylorubrum populi (strain ATCC BAA-705 / NCIMB 13946 / BJ001)
Q82WI2 1.32e-150 434 56 2 381 3 trpB Tryptophan synthase beta chain Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
B2IF48 1.35e-150 435 55 3 399 3 trpB Tryptophan synthase beta chain Beijerinckia indica subsp. indica (strain ATCC 9039 / DSM 1715 / NCIMB 8712)
B1XY48 1.46e-150 435 55 3 391 3 trpB Tryptophan synthase beta chain Leptothrix cholodnii (strain ATCC 51168 / LMG 8142 / SP-6)
Q8TX91 1.7e-150 434 57 1 380 3 trpB Tryptophan synthase beta chain Methanopyrus kandleri (strain AV19 / DSM 6324 / JCM 9639 / NBRC 100938)
Q71Z40 1.84e-150 434 53 2 380 3 trpB Tryptophan synthase beta chain Listeria monocytogenes serotype 4b (strain F2365)
C1KVS5 1.84e-150 434 53 2 380 3 trpB Tryptophan synthase beta chain Listeria monocytogenes serotype 4b (strain CLIP80459)
B8DHB4 1.86e-150 434 53 2 380 3 trpB Tryptophan synthase beta chain Listeria monocytogenes serotype 4a (strain HCC23)
B1YLS4 2.81e-150 433 53 2 385 3 trpB Tryptophan synthase beta chain Exiguobacterium sibiricum (strain DSM 17290 / CCUG 55495 / CIP 109462 / JCM 13490 / 255-15)
Q8UJB0 3.57e-150 433 57 3 382 3 trpB Tryptophan synthase beta chain Agrobacterium fabrum (strain C58 / ATCC 33970)
B1LSI6 4.21e-150 434 54 2 394 3 trpB Tryptophan synthase beta chain Methylobacterium radiotolerans (strain ATCC 27329 / DSM 1819 / JCM 2831 / NBRC 15690 / NCIMB 10815 / 0-1)
Q7VE26 5.31e-150 433 54 2 391 3 trpB Tryptophan synthase beta chain Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
Q21CB9 5.63e-150 433 54 3 388 3 trpB Tryptophan synthase beta chain Rhodopseudomonas palustris (strain BisB18)
P12290 5.71e-150 433 58 2 373 3 trpB Tryptophan synthase beta chain Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q8XXY0 6.14e-150 433 56 2 384 3 trpB Tryptophan synthase beta chain Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
A5CVH4 7.52e-150 432 56 3 388 3 trpB Tryptophan synthase beta chain Vesicomyosocius okutanii subsp. Calyptogena okutanii (strain HA)
Q7TUH0 9.86e-150 432 55 2 384 3 trpB Tryptophan synthase beta chain Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
P25269 1.14e-149 435 54 2 384 1 TSB2 Tryptophan synthase beta chain 2, chloroplastic Arabidopsis thaliana
Q92B81 1.2e-149 432 53 2 380 3 trpB Tryptophan synthase beta chain Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q1ISI9 1.43e-149 432 58 3 380 3 trpB Tryptophan synthase beta chain Koribacter versatilis (strain Ellin345)
B8I9V8 1.49e-149 432 55 2 384 3 trpB Tryptophan synthase beta chain Methylobacterium nodulans (strain LMG 21967 / CNCM I-2342 / ORS 2060)
B7L1H4 1.52e-149 432 54 2 391 3 trpB Tryptophan synthase beta chain Methylorubrum extorquens (strain CM4 / NCIMB 13688)
A1B8L3 1.67e-149 432 58 4 383 3 trpB Tryptophan synthase beta chain Paracoccus denitrificans (strain Pd 1222)
A1TLG8 1.78e-149 432 55 4 390 3 trpB Tryptophan synthase beta chain Paracidovorax citrulli (strain AAC00-1)
A2STA4 1.83e-149 431 53 2 390 3 trpB Tryptophan synthase beta chain Methanocorpusculum labreanum (strain ATCC 43576 / DSM 4855 / Z)
P43284 1.9e-149 433 55 2 384 2 TSB2 Tryptophan synthase beta chain 2, chloroplastic (Fragment) Zea mays
Q1IH20 2.28e-149 431 53 2 390 3 trpB Tryptophan synthase beta chain Pseudomonas entomophila (strain L48)
P07600 2.34e-149 431 54 3 385 3 trpB Tryptophan synthase beta chain Bacillus subtilis (strain 168)
Q126M1 3.44e-149 432 55 4 392 3 trpB Tryptophan synthase beta chain Polaromonas sp. (strain JS666 / ATCC BAA-500)
A2BNV9 3.57e-149 431 55 2 384 3 trpB Tryptophan synthase beta chain Prochlorococcus marinus (strain AS9601)
A2SHS4 3.81e-149 431 55 2 384 3 trpB Tryptophan synthase beta chain Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
P16706 4.62e-149 431 55 2 384 3 trpB Tryptophan synthase beta chain Acinetobacter calcoaceticus
Q6FEF1 4.62e-149 431 55 2 384 3 trpB Tryptophan synthase beta chain Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q118P8 5.09e-149 431 55 2 385 3 trpB Tryptophan synthase beta chain Trichodesmium erythraeum (strain IMS101)
A1VRR7 6.25e-149 431 54 4 395 3 trpB Tryptophan synthase beta chain Polaromonas naphthalenivorans (strain CJ2)
A3PAN2 7.03e-149 431 55 2 384 3 trpB Tryptophan synthase beta chain Prochlorococcus marinus (strain MIT 9301)
P11080 7.74e-149 430 53 2 390 3 trpB Tryptophan synthase beta chain Pseudomonas putida
A1WSF1 8.73e-149 431 56 5 397 3 trpB Tryptophan synthase beta chain Verminephrobacter eiseniae (strain EF01-2)
Q8YZP7 8.97e-149 430 54 2 390 3 trpB1 Tryptophan synthase beta chain 1 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
A1AXS9 1.24e-148 429 55 3 386 3 trpB Tryptophan synthase beta chain Ruthia magnifica subsp. Calyptogena magnifica
A2BUE1 1.41e-148 430 55 2 384 3 trpB Tryptophan synthase beta chain Prochlorococcus marinus (strain MIT 9515)
Q8RGH8 1.42e-148 429 55 3 390 3 trpB Tryptophan synthase beta chain Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
A8G2H0 2.14e-148 429 55 2 384 3 trpB Tryptophan synthase beta chain Prochlorococcus marinus (strain MIT 9215)
Q88RP6 2.16e-148 429 53 2 390 3 trpB Tryptophan synthase beta chain Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A5VWL3 2.35e-148 429 53 2 390 3 trpB Tryptophan synthase beta chain Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q31D17 2.44e-148 429 55 2 384 3 trpB Tryptophan synthase beta chain Prochlorococcus marinus (strain MIT 9312)
A0AJ80 2.49e-148 429 52 2 380 3 trpB Tryptophan synthase beta chain Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q9X4E5 2.56e-148 429 57 4 382 3 trpB Tryptophan synthase beta chain Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q500R4 4.09e-148 428 54 2 385 3 trpB Tryptophan synthase beta chain Pseudomonas syringae pv. syringae (strain B728a)
Q8DG49 4.42e-148 428 53 2 391 3 trpB Tryptophan synthase beta chain Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
C1DH66 4.44e-148 428 55 2 380 3 trpB Tryptophan synthase beta chain Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
Q2JLD7 4.81e-148 429 54 2 395 3 trpB Tryptophan synthase beta chain Synechococcus sp. (strain JA-2-3B'a(2-13))
Q8TLP3 4.98e-148 428 54 2 391 3 trpB1 Tryptophan synthase beta chain 1 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
B9IU38 6.08e-148 427 54 2 381 3 trpB Tryptophan synthase beta chain Bacillus cereus (strain Q1)
B2FNZ1 6.22e-148 428 54 2 381 3 trpB Tryptophan synthase beta chain Stenotrophomonas maltophilia (strain K279a)
B7I0F2 6.93e-148 427 54 2 381 3 trpB Tryptophan synthase beta chain Bacillus cereus (strain AH187)
B4SQU8 7.32e-148 427 54 2 381 3 trpB Tryptophan synthase beta chain Stenotrophomonas maltophilia (strain R551-3)
B0KFW3 7.32e-148 427 53 2 390 3 trpB Tryptophan synthase beta chain Pseudomonas putida (strain GB-1)
P19868 9.2e-148 427 55 3 380 3 trpB Tryptophan synthase beta chain Geobacillus stearothermophilus
Q7NUD8 1.06e-147 427 55 3 382 3 trpB Tryptophan synthase beta chain Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q48QG6 1.18e-147 427 53 2 386 3 trpB Tryptophan synthase beta chain Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
A5CRV6 1.21e-147 427 54 3 391 3 trpB Tryptophan synthase beta chain Clavibacter michiganensis subsp. michiganensis (strain NCPPB 382)
O50046 1.29e-147 429 55 2 384 2 TSB Tryptophan synthase beta chain 2, chloroplastic Camptotheca acuminata
Q6HLU4 1.32e-147 427 54 2 381 3 trpB Tryptophan synthase beta chain Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q81TL8 1.32e-147 427 54 2 381 1 trpB Tryptophan synthase beta chain Bacillus anthracis
C3LAV8 1.32e-147 427 54 2 381 3 trpB Tryptophan synthase beta chain Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3P3U0 1.32e-147 427 54 2 381 3 trpB Tryptophan synthase beta chain Bacillus anthracis (strain A0248)
Q822W3 1.57e-147 426 56 4 389 3 trpB2 Tryptophan synthase beta chain 2 Chlamydia caviae (strain ATCC VR-813 / DSM 19441 / 03DC25 / GPIC)
B0REU1 1.69e-147 427 54 3 391 3 trpB Tryptophan synthase beta chain Clavibacter sepedonicus
Q03CY3 1.76e-147 427 53 2 381 3 trpB Tryptophan synthase beta chain Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
B3W6W6 1.83e-147 427 53 2 381 3 trpB Tryptophan synthase beta chain Lacticaseibacillus casei (strain BL23)
Q8PT95 2.08e-147 426 55 2 386 3 trpB1 Tryptophan synthase beta chain 1 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q97P32 2.12e-147 426 56 4 389 1 trpB Tryptophan synthase beta chain Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
C1C966 2.12e-147 426 56 4 389 3 trpB Tryptophan synthase beta chain Streptococcus pneumoniae (strain 70585)
B7GHQ9 2.13e-147 426 56 3 385 3 trpB Tryptophan synthase beta chain Anoxybacillus flavithermus (strain DSM 21510 / WK1)
A4IQ82 2.2e-147 426 56 3 377 3 trpB Tryptophan synthase beta chain Geobacillus thermodenitrificans (strain NG80-2)
Q849P2 3.21e-147 426 53 2 386 3 trpB Tryptophan synthase beta chain Pseudomonas savastanoi pv. phaseolicola
Q88B61 3.51e-147 426 53 2 385 3 trpB Tryptophan synthase beta chain Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q46HK9 3.66e-147 426 54 3 388 3 trpB Tryptophan synthase beta chain Prochlorococcus marinus (strain NATL2A)
Q63EC7 4.01e-147 425 54 2 381 3 trpB Tryptophan synthase beta chain Bacillus cereus (strain ZK / E33L)
P14671 5.43e-147 428 54 2 385 2 TSB1 Tryptophan synthase beta chain 1, chloroplastic Arabidopsis thaliana
A2BZZ2 5.85e-147 426 53 3 388 3 trpB Tryptophan synthase beta chain Prochlorococcus marinus (strain NATL1A)
Q73BQ7 5.88e-147 425 54 2 381 3 trpB Tryptophan synthase beta chain Bacillus cereus (strain ATCC 10987 / NRS 248)
A1KSW2 6.73e-147 425 55 4 384 3 trpB Tryptophan synthase beta chain Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
Q9JVC0 6.73e-147 425 55 4 384 3 trpB Tryptophan synthase beta chain Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
A9M354 6.81e-147 425 55 4 384 3 trpB Tryptophan synthase beta chain Neisseria meningitidis serogroup C (strain 053442)
C1CT51 7.18e-147 425 55 4 389 3 trpB Tryptophan synthase beta chain Streptococcus pneumoniae (strain Taiwan19F-14)
C1CMD3 7.34e-147 425 55 4 389 3 trpB Tryptophan synthase beta chain Streptococcus pneumoniae (strain P1031)
Q0AGX5 7.5e-147 425 55 2 381 3 trpB Tryptophan synthase beta chain Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
B2ISS1 7.84e-147 425 55 4 389 3 trpB Tryptophan synthase beta chain Streptococcus pneumoniae (strain CGSP14)
B8ZN59 7.84e-147 425 55 4 389 3 trpB Tryptophan synthase beta chain Streptococcus pneumoniae (strain ATCC 700669 / Spain 23F-1)
B1I7S7 7.84e-147 425 55 4 389 3 trpB Tryptophan synthase beta chain Streptococcus pneumoniae (strain Hungary19A-6)
A8NEP3 7.91e-147 436 54 4 391 3 TRP-1 Tryptophan synthase Coprinopsis cinerea (strain Okayama-7 / 130 / ATCC MYA-4618 / FGSC 9003)
O27696 1.02e-146 424 59 3 380 3 trpB1 Tryptophan synthase beta chain 1 Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
C1ELF0 1.18e-146 424 54 2 381 3 trpB Tryptophan synthase beta chain Bacillus cereus (strain 03BB102)
A0RB64 1.18e-146 424 54 2 381 3 trpB Tryptophan synthase beta chain Bacillus thuringiensis (strain Al Hakam)
B5E7M3 1.19e-146 424 55 4 389 3 trpB Tryptophan synthase beta chain Streptococcus pneumoniae serotype 19F (strain G54)
A7Z616 1.25e-146 424 55 3 385 3 trpB Tryptophan synthase beta chain Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
Q5F9W3 1.46e-146 424 55 4 384 3 trpB Tryptophan synthase beta chain Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q5SJB9 1.86e-146 424 54 3 386 3 trpB Tryptophan synthase beta chain Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
Q9K0B5 1.96e-146 424 55 4 384 3 trpB Tryptophan synthase beta chain Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
P16609 1.97e-146 424 54 3 386 1 trpB Tryptophan synthase beta chain Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
B7IM76 2.06e-146 424 53 2 381 3 trpB Tryptophan synthase beta chain Bacillus cereus (strain G9842)
A5E8A4 2.49e-146 424 54 3 388 3 trpB Tryptophan synthase beta chain Bradyrhizobium sp. (strain BTAi1 / ATCC BAA-1182)
Q2J2G4 3.33e-146 423 55 3 381 3 trpB Tryptophan synthase beta chain Rhodopseudomonas palustris (strain HaA2)
B4RJV8 3.57e-146 423 55 4 384 3 trpB Tryptophan synthase beta chain Neisseria gonorrhoeae (strain NCCP11945)
B7HH01 3.64e-146 423 53 2 381 3 trpB Tryptophan synthase beta chain Bacillus cereus (strain B4264)
B3Q605 4.19e-146 423 55 3 381 3 trpB Tryptophan synthase beta chain Rhodopseudomonas palustris (strain TIE-1)
Q6NDN6 4.19e-146 423 55 3 381 3 trpB Tryptophan synthase beta chain Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q8CPB1 4.81e-146 423 54 3 381 3 trpB Tryptophan synthase beta chain Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HPH0 4.81e-146 423 54 3 381 3 trpB Tryptophan synthase beta chain Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
C1CG42 7.49e-146 422 55 4 389 3 trpB Tryptophan synthase beta chain Streptococcus pneumoniae (strain JJA)
A4YJI6 8.45e-146 422 54 3 388 3 trpB Tryptophan synthase beta chain Bradyrhizobium sp. (strain ORS 278)
P17167 8.72e-146 422 53 2 381 3 trpB Tryptophan synthase beta chain Lacticaseibacillus casei
P9WFX9 9.69e-146 423 56 3 387 1 trpB Tryptophan synthase beta chain Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WFX8 9.69e-146 423 56 3 387 3 trpB Tryptophan synthase beta chain Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P66985 9.69e-146 423 56 3 387 3 trpB Tryptophan synthase beta chain Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q8DNM8 1.11e-145 422 55 4 389 3 trpB Tryptophan synthase beta chain Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q04IY9 1.11e-145 422 55 4 389 3 trpB Tryptophan synthase beta chain Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
A9VJW2 1.42e-145 421 53 2 381 3 trpB Tryptophan synthase beta chain Bacillus mycoides (strain KBAB4)
P16578 1.51e-145 432 54 4 391 3 TRP-1 Tryptophan synthase Coprinopsis cinerea
B2SVN7 1.83e-145 421 55 2 381 3 trpB Tryptophan synthase beta chain Xanthomonas oryzae pv. oryzae (strain PXO99A)
Q81GG5 2.08e-145 421 53 2 381 3 trpB Tryptophan synthase beta chain Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q13EQ2 3.59e-145 421 55 3 381 3 trpB Tryptophan synthase beta chain Rhodopseudomonas palustris (strain BisB5)
Q8P7R8 3.8e-145 421 54 2 381 3 trpB Tryptophan synthase beta chain Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
B0RR84 3.8e-145 421 54 2 381 3 trpB Tryptophan synthase beta chain Xanthomonas campestris pv. campestris (strain B100)
Q4UWD2 3.8e-145 421 54 2 381 3 trpB Tryptophan synthase beta chain Xanthomonas campestris pv. campestris (strain 8004)
Q2P0U2 5.38e-145 420 54 2 381 3 trpB Tryptophan synthase beta chain Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q6G9I7 5.68e-145 420 52 3 389 3 trpB Tryptophan synthase beta chain Staphylococcus aureus (strain MSSA476)
Q3AW11 9.33e-145 420 54 2 384 3 trpB Tryptophan synthase beta chain Synechococcus sp. (strain CC9902)
Q49XH8 1.23e-144 419 51 4 392 3 trpB Tryptophan synthase beta chain Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q8NWU2 1.3e-144 419 52 3 389 3 trpB Tryptophan synthase beta chain Staphylococcus aureus (strain MW2)
A8Z244 1.3e-144 419 52 3 389 3 trpB Tryptophan synthase beta chain Staphylococcus aureus (strain USA300 / TCH1516)
A6QGS4 1.3e-144 419 52 3 389 3 trpB Tryptophan synthase beta chain Staphylococcus aureus (strain Newman)
Q5HG47 1.3e-144 419 52 3 389 3 trpB Tryptophan synthase beta chain Staphylococcus aureus (strain COL)
Q2FYR4 1.3e-144 419 52 3 389 3 trpB Tryptophan synthase beta chain Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FH64 1.3e-144 419 52 3 389 3 trpB Tryptophan synthase beta chain Staphylococcus aureus (strain USA300)
Q8DVF3 1.84e-144 419 55 3 389 3 trpB Tryptophan synthase beta chain Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q8ESU4 2.13e-144 419 53 3 381 3 trpB Tryptophan synthase beta chain Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q88WI0 2.62e-144 418 53 2 380 3 trpB Tryptophan synthase beta chain Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q9RVT1 3.04e-144 419 54 5 381 3 trpB Tryptophan synthase beta chain Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
Q5WGS1 3.19e-144 418 54 3 385 3 trpB Tryptophan synthase beta chain Shouchella clausii (strain KSM-K16)
Q07UH1 4.27e-144 418 55 3 381 3 trpB Tryptophan synthase beta chain Rhodopseudomonas palustris (strain BisA53)
Q2Y7R4 4.57e-144 417 55 3 381 3 trpB Tryptophan synthase beta chain Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q7M8W7 8.1e-144 417 54 3 393 3 trpB2 Tryptophan synthase beta chain 2 Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
Q8PJ28 8.5e-144 417 54 2 381 3 trpB Tryptophan synthase beta chain Xanthomonas axonopodis pv. citri (strain 306)
Q03JC1 1.14e-143 417 55 3 391 3 trpB Tryptophan synthase beta chain Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q3BRL3 1.14e-143 417 54 2 381 3 trpB Tryptophan synthase beta chain Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
A9BD24 1.6e-143 417 53 2 384 3 trpB Tryptophan synthase beta chain Prochlorococcus marinus (strain MIT 9211)
Q6GH33 1.84e-143 416 52 3 389 3 trpB Tryptophan synthase beta chain Staphylococcus aureus (strain MRSA252)
P66987 2.39e-143 416 52 3 389 3 trpB Tryptophan synthase beta chain Staphylococcus aureus (strain N315)
P66986 2.39e-143 416 52 3 389 3 trpB Tryptophan synthase beta chain Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5ISQ4 2.39e-143 416 52 3 389 3 trpB Tryptophan synthase beta chain Staphylococcus aureus (strain JH9)
A6U1J4 2.39e-143 416 52 3 389 3 trpB Tryptophan synthase beta chain Staphylococcus aureus (strain JH1)
A7X238 2.39e-143 416 52 3 389 3 trpB Tryptophan synthase beta chain Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q9PDK4 3.04e-143 416 53 2 381 3 trpB Tryptophan synthase beta chain Xylella fastidiosa (strain 9a5c)
B0U6K6 4.92e-143 415 53 2 381 3 trpB Tryptophan synthase beta chain Xylella fastidiosa (strain M12)
Q5M350 4.95e-143 415 54 3 391 3 trpB Tryptophan synthase beta chain Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q59992 8.94e-143 415 52 2 385 3 trpB Tryptophan synthase beta chain Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q84GJ9 9.72e-143 414 54 3 382 3 trpB Tryptophan synthase beta chain Neisseria gonorrhoeae
Q47HQ5 1.09e-142 414 55 2 381 3 trpB Tryptophan synthase beta chain Dechloromonas aromatica (strain RCB)
Q2YXX2 1.13e-142 414 52 3 389 3 trpB Tryptophan synthase beta chain Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q5LYI7 2.46e-142 413 54 3 391 3 trpB Tryptophan synthase beta chain Streptococcus thermophilus (strain CNRZ 1066)
Q87DR9 2.79e-142 413 53 2 381 3 trpB Tryptophan synthase beta chain Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I9J2 2.79e-142 413 53 2 381 3 trpB Tryptophan synthase beta chain Xylella fastidiosa (strain M23)
Q8KF11 4.38e-142 413 54 4 387 3 trpB-1 Tryptophan synthase beta chain Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
P26921 7.61e-142 412 57 1 377 3 trpB2 Tryptophan synthase beta chain 2 Methanothermobacter marburgensis (strain ATCC BAA-927 / DSM 2133 / JCM 14651 / NBRC 100331 / OCM 82 / Marburg)
Q7TUL2 1.32e-141 413 54 2 384 3 trpB Tryptophan synthase beta chain Prochlorococcus marinus (strain MIT 9313)
Q9CC54 1.72e-141 412 56 5 379 3 trpB Tryptophan synthase beta chain Mycobacterium leprae (strain TN)
Q21XI6 2.65e-141 412 53 5 397 3 trpB Tryptophan synthase beta chain Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
A9IIE0 2.76e-141 410 53 2 381 3 trpB Tryptophan synthase beta chain Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
Q7TTS6 3.14e-141 411 54 2 384 3 trpB Tryptophan synthase beta chain Parasynechococcus marenigrum (strain WH8102)
O84172 3.48e-141 410 56 2 374 1 trpB Tryptophan synthase beta chain Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
Q0I6V1 4.7e-141 410 54 2 384 3 trpB Tryptophan synthase beta chain Synechococcus sp. (strain CC9311)
Q3AGY2 7.94e-141 410 54 2 384 3 trpB Tryptophan synthase beta chain Synechococcus sp. (strain CC9605)
Q7UKG9 1.03e-140 409 51 3 389 3 trpB Tryptophan synthase beta chain Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
Q7VTF1 4.35e-140 407 52 2 381 3 trpB Tryptophan synthase beta chain Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
A5GP60 6.57e-140 408 54 2 384 3 trpB Tryptophan synthase beta chain Synechococcus sp. (strain WH7803)
Q7W5G8 9.44e-140 407 52 2 381 3 trpB Tryptophan synthase beta chain Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WD04 9.44e-140 407 52 2 381 3 trpB Tryptophan synthase beta chain Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
O68905 4.2e-139 406 55 2 386 3 trpB Tryptophan synthase beta chain Mycobacterium intracellulare
O13831 7.17e-137 410 51 3 380 2 trp2 Tryptophan synthase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q8AAD2 2.21e-136 398 51 3 380 3 trpB Tryptophan synthase beta chain Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
B6YQ32 6.87e-136 397 51 3 383 3 trpB Tryptophan synthase beta chain Azobacteroides pseudotrichonymphae genomovar. CFP2
A6L9K4 1.6e-135 396 50 2 382 3 trpB Tryptophan synthase beta chain Parabacteroides distasonis (strain ATCC 8503 / DSM 20701 / CIP 104284 / JCM 5825 / NCTC 11152)
B0SM57 1.89e-134 393 50 3 395 3 trpB Tryptophan synthase beta chain Leptospira biflexa serovar Patoc (strain Patoc 1 / ATCC 23582 / Paris)
B0SDM8 1.89e-134 393 50 3 395 3 trpB Tryptophan synthase beta chain Leptospira biflexa serovar Patoc (strain Patoc 1 / Ames)
Q64SX9 4.02e-134 392 51 3 380 3 trpB Tryptophan synthase beta chain Bacteroides fragilis (strain YCH46)
Q5LBZ8 4.02e-134 392 51 3 380 3 trpB Tryptophan synthase beta chain Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
Q053M6 7.23e-134 392 50 3 391 3 trpB Tryptophan synthase beta chain Leptospira borgpetersenii serovar Hardjo-bovis (strain L550)
Q04U63 7.23e-134 392 50 3 391 3 trpB Tryptophan synthase beta chain Leptospira borgpetersenii serovar Hardjo-bovis (strain JB197)
Q8F149 1.69e-133 391 50 3 391 3 trpB Tryptophan synthase beta chain Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72U05 1.69e-133 391 50 3 391 3 trpB Tryptophan synthase beta chain Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
P00931 3.59e-133 400 51 4 389 1 TRP5 Tryptophan synthase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A6L7M5 1.88e-132 388 51 3 380 3 trpB Tryptophan synthase beta chain Phocaeicola vulgatus (strain ATCC 8482 / DSM 1447 / JCM 5826 / CCUG 4940 / NBRC 14291 / NCTC 11154)
P18285 2e-131 386 50 4 391 3 trpB Tryptophan synthase beta chain Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
P13228 1.72e-130 394 50 3 382 1 trp-3 Tryptophan synthase Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q822W9 2.84e-130 383 52 2 384 3 trpB1 Tryptophan synthase beta chain 1 Chlamydia caviae (strain ATCC VR-813 / DSM 19441 / 03DC25 / GPIC)
B2KCI5 1.22e-129 381 50 2 384 3 trpB Tryptophan synthase beta chain Elusimicrobium minutum (strain Pei191)
Q87IM1 4.38e-128 377 50 2 388 3 trpB2 Tryptophan synthase beta chain 2 Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q7VGA7 1.44e-127 377 50 3 389 3 trpB Tryptophan synthase beta chain Helicobacter hepaticus (strain ATCC 51449 / 3B1)
B2V2T4 1.15e-125 371 48 3 380 3 trpB Tryptophan synthase beta chain Clostridium botulinum (strain Alaska E43 / Type E3)
Q44688 1.63e-125 364 73 1 226 3 trpB Tryptophan synthase beta chain (Fragment) Buchnera aphidicola subsp. Rhopalosiphum padi
Q7M9S1 1.82e-125 370 46 3 390 3 trpB1 Tryptophan synthase beta chain 1 Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
B2TM49 5.46e-125 369 48 3 380 3 trpB Tryptophan synthase beta chain Clostridium botulinum (strain Eklund 17B / Type B)
Q9HSC0 2.27e-124 369 49 5 401 3 trpB Tryptophan synthase beta chain Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
B0R332 2.27e-124 369 49 5 401 3 trpB Tryptophan synthase beta chain Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
Q5HWB9 6.08e-124 366 49 2 382 3 trpB Tryptophan synthase beta chain Campylobacter jejuni (strain RM1221)
A1VY69 6.08e-124 366 49 2 382 3 trpB Tryptophan synthase beta chain Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
Q9PIF2 6.08e-124 366 49 2 382 3 trpB Tryptophan synthase beta chain Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
A8FKD7 6.08e-124 366 49 2 382 3 trpB Tryptophan synthase beta chain Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
Q44686 3.37e-123 358 71 1 226 3 trpB Tryptophan synthase beta chain (Fragment) Buchnera aphidicola subsp. Rhopalosiphum maidis
A7H523 2.12e-118 352 49 2 377 3 trpB Tryptophan synthase beta chain Campylobacter jejuni subsp. doylei (strain ATCC BAA-1458 / RM4099 / 269.97)
Q9Y8T5 4.71e-35 137 33 14 373 3 trpB1 Tryptophan synthase beta chain 1 Aeropyrum pernix (strain ATCC 700893 / DSM 11879 / JCM 9820 / NBRC 100138 / K1)
B6YSU5 7.68e-33 131 30 11 368 3 trpB Tryptophan synthase beta chain Thermococcus onnurineus (strain NA1)
Q8U0J5 4.49e-32 129 30 13 376 3 trpB2 Tryptophan synthase beta chain 2 Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
A4WKQ9 1.14e-31 127 31 13 366 3 trpB Tryptophan synthase beta chain Pyrobaculum arsenaticum (strain DSM 13514 / JCM 11321 / PZ6)
O59265 1.22e-31 128 31 11 361 3 trpB Tryptophan synthase beta chain Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q8ZV44 1.75e-29 121 31 15 370 3 trpB Tryptophan synthase beta chain Pyrobaculum aerophilum (strain ATCC 51768 / DSM 7523 / JCM 9630 / CIP 104966 / NBRC 100827 / IM2)
O27520 8.53e-29 119 29 13 385 3 trpB2 Tryptophan synthase beta chain 2 Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
O67409 1.98e-28 119 29 14 400 3 trpB2 Tryptophan synthase beta chain 2 Aquifex aeolicus (strain VF5)
Q5JDJ1 2.6e-28 118 31 13 366 3 trpB2 Tryptophan synthase beta chain 2 Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
A1RVT1 4.48e-28 117 30 14 375 3 trpB Tryptophan synthase beta chain Pyrobaculum islandicum (strain DSM 4184 / JCM 9189 / GEO3)
Q9V150 4.78e-28 117 32 12 367 3 trpB2 Tryptophan synthase beta chain 2 Pyrococcus abyssi (strain GE5 / Orsay)
C5A1P4 2.56e-27 115 33 14 362 3 trpB Tryptophan synthase beta chain Thermococcus gammatolerans (strain DSM 15229 / JCM 11827 / EJ3)
A7HMG8 2.73e-27 115 31 14 361 3 trpB Tryptophan synthase beta chain Fervidobacterium nodosum (strain ATCC 35602 / DSM 5306 / Rt17-B1)
A8F8F7 1.26e-26 113 29 12 384 3 trpB Tryptophan synthase beta chain Pseudothermotoga lettingae (strain ATCC BAA-301 / DSM 14385 / NBRC 107922 / TMO)
Q9WZ09 1.44e-24 107 29 12 366 3 trpB2 Tryptophan synthase beta chain 2 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q9Y9H2 5.22e-24 106 30 14 379 3 trpB2 Tryptophan synthase beta chain 2 Aeropyrum pernix (strain ATCC 700893 / DSM 11879 / JCM 9820 / NBRC 100138 / K1)
Q8Q001 5.56e-24 106 31 14 366 3 trpB2 Tryptophan synthase beta chain 2 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q6L271 7.98e-24 105 28 10 352 3 trpB Tryptophan synthase beta chain Picrophilus torridus (strain ATCC 700027 / DSM 9790 / JCM 10055 / NBRC 100828 / KAW 2/3)
B7IHA8 8.22e-24 105 30 15 391 3 trpB Tryptophan synthase beta chain Thermosipho africanus (strain TCF52B)
Q971Z5 3.24e-23 103 29 14 358 3 trpB1 Tryptophan synthase beta chain 1 Sulfurisphaera tokodaii (strain DSM 16993 / JCM 10545 / NBRC 100140 / 7)
B8D4P0 5.71e-23 103 30 13 399 3 trpB Tryptophan synthase beta chain Desulfurococcus amylolyticus (strain DSM 18924 / JCM 16383 / VKM B-2413 / 1221n)
P50383 8.56e-23 102 30 13 359 1 trpB1 Tryptophan synthase beta chain 1 Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
O29028 2.6e-22 101 29 13 381 3 trpB2 Tryptophan synthase beta chain 2 Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q8TL44 2.97e-21 98 30 14 366 3 trpB2 Tryptophan synthase beta chain 2 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q9HKD2 3.85e-21 97 28 12 359 3 trpB Tryptophan synthase beta chain Thermoplasma acidophilum (strain ATCC 25905 / DSM 1728 / JCM 9062 / NBRC 15155 / AMRC-C165)
Q97TX6 4.2e-20 94 28 14 395 1 trpB2 Tryptophan synthase beta chain 2 Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q970N1 1.46e-18 90 27 12 377 3 trpB2 Tryptophan synthase beta chain 2 Sulfurisphaera tokodaii (strain DSM 16993 / JCM 10545 / NBRC 100140 / 7)
Q97A51 1.5e-16 84 29 13 353 3 trpB Tryptophan synthase beta chain Thermoplasma volcanium (strain ATCC 51530 / DSM 4299 / JCM 9571 / NBRC 15438 / GSS1)
Q5KMX3 0.000226 46 27 9 218 3 CNB00190 Probable 1-aminocyclopropane-1-carboxylate deaminase Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565)

  • Number of RefSeq hits:

General

Source Morganella morganii S3
Locus tag LHKJJB_12615
Feature type CDS
Gene trpB
Product tryptophan synthase subunit beta
Location 137340 - 138530 (strand: -1)
Length 1191 (nucleotides) / 396 (amino acids)
In genomic island -

Contig

Accession ZDB_369
Length 181491 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1016
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00291 Pyridoxal-phosphate dependent enzyme

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0133 Amino acid transport and metabolism (E) E Tryptophan synthase beta chain

Kegg Ortholog Annotation(s)

Protein Sequence

MSKLNPYFGEFGGQFVPQILIPALEQLEDAFIAAQEDPEFQREFTDLLQNYAGRPTALTLCKNLTAGSKTKLYLKREDLLHGGAHKTNQVLGQALLAKRMGKTEIIAETGAGQHGVAAALASALLGLKCRVYMGAKDVERQSPNVFRMRLMGAEVIPVHSGSATLKDACNEALRDWSGNYDRAHYLLGTAAGPHPYPTIVREFQRMIGDEARAQILAREGRLPDAVIACIGGGSNAIGAFAGFIPDESVALIGVEPAGHGIETGEHGAPLKHGRIGIYFGMKSPMMQTEDGQIEESYSISAGLDFPSVGPQHAYLNAIGRADYVSATDDEALDAFKTLSRQEGIIPALESSHALAHALKMIRENPEKEQIIIVNISGRGDKDIFTVYDIFKARGDF

Flanking regions ( +/- flanking 50bp)

CATCAGCAAGTTGCCTGACTACGACTGAAAAGAAAAAGGATCAGAAAACAATGAGTAAATTAAATCCCTATTTTGGTGAATTCGGCGGGCAGTTTGTGCCGCAGATTTTAATCCCGGCACTCGAGCAGCTCGAAGATGCCTTTATTGCCGCTCAGGAAGACCCGGAATTTCAGCGTGAATTTACCGATCTGCTGCAAAACTATGCCGGACGCCCGACAGCCCTGACACTGTGCAAAAACCTGACTGCGGGCAGCAAAACCAAACTGTATCTGAAACGCGAAGATTTACTGCACGGCGGTGCGCATAAAACCAACCAGGTGCTCGGCCAGGCACTGCTGGCAAAACGGATGGGAAAAACGGAAATTATTGCCGAAACCGGAGCCGGTCAGCACGGCGTGGCGGCAGCACTGGCCAGTGCGCTGCTCGGCCTGAAATGCCGGGTATATATGGGGGCAAAAGACGTGGAACGTCAATCTCCGAATGTGTTCCGCATGCGGCTGATGGGCGCGGAAGTCATTCCGGTGCACAGCGGCTCCGCCACGCTGAAAGATGCCTGTAATGAGGCGCTGCGCGACTGGAGCGGCAATTATGACCGCGCCCACTATTTATTAGGCACCGCGGCAGGTCCGCATCCGTACCCGACCATTGTCCGCGAGTTCCAGCGTATGATCGGTGATGAGGCCCGCGCCCAGATCCTCGCCCGTGAAGGTCGTCTTCCGGATGCGGTGATCGCCTGTATCGGCGGCGGTTCAAACGCTATCGGCGCATTTGCCGGGTTTATTCCCGATGAATCCGTCGCCCTGATCGGCGTCGAACCGGCCGGACACGGTATTGAAACCGGTGAACACGGTGCGCCGCTCAAACATGGCCGCATCGGTATCTATTTCGGCATGAAATCACCGATGATGCAGACAGAAGACGGTCAGATCGAGGAATCTTACTCCATCTCCGCCGGTCTGGACTTCCCGTCTGTCGGGCCGCAGCACGCGTATCTGAATGCTATCGGCCGGGCGGATTATGTTTCCGCCACCGATGACGAGGCACTTGACGCCTTTAAAACCCTGAGCCGTCAGGAAGGGATTATCCCGGCACTGGAATCCTCCCATGCCCTGGCACACGCACTGAAAATGATCCGTGAAAATCCGGAGAAAGAACAAATTATTATCGTCAATATTTCCGGTCGCGGAGACAAAGATATTTTCACTGTTTATGACATTTTTAAAGCAAGAGGTGATTTCTGATGAGCCGGTATGAACAACTTTTTCAGCGTTTGCAGTCCCGTAATCAGGGT