Homologs in group_997

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_05575 FBDBKF_05575 100.0 Morganella morganii S1 tpx thiol peroxidase
EHELCC_12015 EHELCC_12015 100.0 Morganella morganii S2 tpx thiol peroxidase
NLDBIP_12355 NLDBIP_12355 100.0 Morganella morganii S4 tpx thiol peroxidase
HKOGLL_10830 HKOGLL_10830 100.0 Morganella morganii S5 tpx thiol peroxidase
F4V73_RS03730 F4V73_RS03730 85.6 Morganella psychrotolerans tpx thiol peroxidase
PMI_RS06605 PMI_RS06605 68.9 Proteus mirabilis HI4320 tpx thiol peroxidase

Distribution of the homologs in the orthogroup group_997

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_997

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q8ZP65 1.61e-83 246 71 0 167 3 tpx Thiol peroxidase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8Z7A8 1.9e-82 243 70 0 167 3 tpx Thiol peroxidase Salmonella typhi
Q8ZE42 4.75e-81 239 70 0 167 3 tpx Thiol peroxidase Yersinia pestis
P0A865 1.1e-80 239 68 0 167 3 tpx Thiol peroxidase Shigella flexneri
P0A866 1.1e-80 239 68 0 167 3 tpx Thiol peroxidase Shigella dysenteriae
P0A862 1.1e-80 239 68 0 167 1 tpx Thiol peroxidase Escherichia coli (strain K12)
P0A863 1.1e-80 239 68 0 167 3 tpx Thiol peroxidase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A864 1.1e-80 239 68 0 167 3 tpx Thiol peroxidase Escherichia coli O157:H7
P57668 2.73e-73 220 68 1 166 3 tpx Thiol peroxidase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q57549 6.6e-69 209 63 0 163 1 tpx Thiol peroxidase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8XVP0 3.75e-67 204 63 0 163 3 tpx Thiol peroxidase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
P57880 4.62e-65 199 59 0 162 3 tpx Thiol peroxidase Pasteurella multocida (strain Pm70)
Q8KED5 1.91e-58 182 55 0 163 3 tpx Thiol peroxidase Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
Q8NRG3 1.86e-56 177 56 1 161 3 tpx Thiol peroxidase Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q8FQH8 2.91e-52 167 53 1 163 3 tpx Thiol peroxidase Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
P31308 6.35e-51 163 51 1 159 1 tpx Thiol peroxidase Streptococcus sanguinis
P42366 7.01e-51 163 51 1 159 3 tpx Thiol peroxidase Streptococcus gordonii
P9WG35 2.01e-50 162 52 2 162 1 tpx Thiol peroxidase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WG34 2.01e-50 162 52 2 162 3 tpx Thiol peroxidase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P66953 2.01e-50 162 52 2 162 1 tpx Thiol peroxidase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
A5F3A2 2.27e-46 152 45 0 164 3 tpx Thiol peroxidase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
P0C6P9 8.13e-46 150 45 0 164 3 tpx Thiol peroxidase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q8F7T2 2.2e-45 149 50 2 161 3 tpx Thiol peroxidase Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72NR4 2.2e-45 149 50 2 161 3 tpx Thiol peroxidase Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q8E536 1.8e-44 147 42 1 159 3 tpx Thiol peroxidase Streptococcus agalactiae serotype III (strain NEM316)
Q8DZH0 7.57e-44 145 42 1 159 3 tpx Thiol peroxidase Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q4L754 8.26e-44 145 44 3 167 3 tpx Thiol peroxidase Staphylococcus haemolyticus (strain JCSC1435)
P0A4M6 8.37e-44 145 46 1 156 3 tpx Thiol peroxidase Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0C2J8 8.37e-44 145 46 1 156 1 tpx Thiol peroxidase Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q04JB8 8.37e-44 145 46 1 156 3 tpx Thiol peroxidase Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
P31307 1.22e-43 145 44 1 159 3 tpx Thiol peroxidase Streptococcus parasanguinis
Q49YE4 1.07e-42 142 44 2 156 3 tpx Thiol peroxidase Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q6GFZ4 2.55e-42 141 44 3 167 3 tpx Thiol peroxidase Staphylococcus aureus (strain MRSA252)
Q8DUK3 2.58e-42 141 43 1 161 3 tpx Thiol peroxidase Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q8NW51 2.85e-42 141 44 3 167 3 tpx Thiol peroxidase Staphylococcus aureus (strain MW2)
Q6G8L4 2.85e-42 141 44 3 167 3 tpx Thiol peroxidase Staphylococcus aureus (strain MSSA476)
Q5HF61 2.85e-42 141 44 3 167 3 tpx Thiol peroxidase Staphylococcus aureus (strain COL)
P99146 4.5e-42 140 44 3 167 1 tpx Thiol peroxidase Staphylococcus aureus (strain N315)
P66954 4.5e-42 140 44 3 167 3 tpx Thiol peroxidase Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q8EPB7 5.36e-42 140 41 1 162 3 tpx Thiol peroxidase Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
P80864 4.29e-41 138 44 1 163 1 tpx Thiol peroxidase Bacillus subtilis (strain 168)
Q9K813 3.07e-39 134 44 1 156 3 tpx Thiol peroxidase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q9ZKE7 1.32e-38 132 42 0 165 3 tpx Thiol peroxidase Helicobacter pylori (strain J99 / ATCC 700824)
Q92BC5 1.87e-38 132 42 2 159 3 tpx Thiol peroxidase Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q8CS58 3.06e-38 131 40 3 167 3 tpx Thiol peroxidase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HNJ2 3.06e-38 131 40 3 167 3 tpx Thiol peroxidase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q71Z84 3.22e-38 131 42 2 159 3 tpx Thiol peroxidase Listeria monocytogenes serotype 4b (strain F2365)
O25151 5.65e-38 130 41 0 165 1 tpx Thiol peroxidase Helicobacter pylori (strain ATCC 700392 / 26695)
Q8Y6U8 5.86e-38 130 42 2 159 3 tpx Thiol peroxidase Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
O66780 1.2e-36 127 41 1 167 1 tpx Thiol peroxidase Aquifex aeolicus (strain VF5)
Q9PPE0 4.89e-33 118 45 2 154 3 tpx Thiol peroxidase Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q97E14 4.42e-31 113 40 2 161 3 tpx Thiol peroxidase Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q9Z0V6 0.000172 43 27 5 140 1 Prdx3 Thioredoxin-dependent peroxide reductase, mitochondrial Rattus norvegicus
P35705 0.000172 43 27 6 139 1 PRDX3 Thioredoxin-dependent peroxide reductase, mitochondrial Bos taurus
P0AE55 0.000217 42 35 4 105 3 bcp Putative peroxiredoxin bcp Shigella flexneri
P0AE52 0.000217 42 35 4 105 1 bcp Peroxiredoxin Bcp Escherichia coli (strain K12)
P0AE53 0.000217 42 35 4 105 3 bcp Putative peroxiredoxin bcp Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AE54 0.000217 42 35 4 105 3 bcp Putative peroxiredoxin bcp Escherichia coli O157:H7

  • Number of RefSeq hits:

General

Source Morganella morganii S3
Locus tag LHKJJB_12215
Feature type CDS
Gene tpx
Product thiol peroxidase
Location 57741 - 58244 (strand: -1)
Length 504 (nucleotides) / 167 (amino acids)

Contig

Accession ZDB_369
Length 181491 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_997
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF08534 Redoxin

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG2077 Posttranslational modification, protein turnover, chaperones (O) O Peroxiredoxin

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K11065 thioredoxin-dependent peroxiredoxin [EC:1.11.1.24] - -

Protein Sequence

MTQTVKLQGNDVLVYGALLRAGEKAVPFKLVANDLSDVQLTKFAGKRKILNIFPSVDTGVCAASVRKFNETAAKLSNTVVLCISADLPFAQSRFCGAEGIENVVMLSTLRDPEFRENYGVGIGSGPLAGLCARAVIVLDENDTVIYSQLVGEITEEPDYDSALNALK

Flanking regions ( +/- flanking 50bp)

CAGGTATTATTTATACCAACAATTATGAGCCCGTTCAGAGGATGATAAAAATGACACAAACTGTAAAACTTCAGGGTAATGATGTTCTGGTTTACGGCGCACTGCTGCGTGCCGGTGAAAAAGCCGTACCATTCAAATTAGTCGCTAATGATTTGTCAGATGTCCAGCTCACCAAATTCGCCGGGAAGCGTAAGATTCTGAATATTTTCCCGAGTGTGGACACCGGTGTCTGCGCCGCCTCCGTGCGCAAATTCAATGAAACTGCCGCAAAACTGTCCAATACCGTGGTGTTATGTATTTCCGCTGATCTGCCGTTCGCGCAGTCCCGTTTCTGCGGCGCGGAAGGCATTGAGAATGTGGTGATGCTCTCCACCCTGCGTGATCCGGAATTCCGTGAAAATTACGGTGTCGGTATCGGCAGCGGCCCGCTGGCCGGTCTGTGCGCCCGTGCGGTGATCGTACTGGATGAGAACGATACTGTGATTTACAGCCAGCTGGTCGGTGAAATCACCGAAGAGCCGGATTATGACAGCGCGCTGAATGCACTGAAATAAGTTACCCGTATCTGTAAAAAAACCCCGCGGCCGGTGACGGTCGCGGGGTT