Homologs in group_23

Help

18 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_20020 FBDBKF_20020 47.4 Morganella morganii S1 - Molecular chaperone
FBDBKF_20060 FBDBKF_20060 100.0 Morganella morganii S1 - Fimbria/pilus periplasmic chaperone
EHELCC_03470 EHELCC_03470 100.0 Morganella morganii S2 - Fimbria/pilus periplasmic chaperone
EHELCC_03510 EHELCC_03510 47.4 Morganella morganii S2 - Molecular chaperone
NLDBIP_03470 NLDBIP_03470 100.0 Morganella morganii S4 - Fimbria/pilus periplasmic chaperone
NLDBIP_03510 NLDBIP_03510 47.4 Morganella morganii S4 - Molecular chaperone
LHKJJB_09340 LHKJJB_09340 47.4 Morganella morganii S3 - Molecular chaperone
HKOGLL_09635 HKOGLL_09635 47.4 Morganella morganii S5 - Molecular chaperone
HKOGLL_09675 HKOGLL_09675 100.0 Morganella morganii S5 - Fimbria/pilus periplasmic chaperone
PMI_RS05730 PMI_RS05730 24.0 Proteus mirabilis HI4320 - molecular chaperone
PMI_RS05770 PMI_RS05770 31.3 Proteus mirabilis HI4320 - molecular chaperone
PMI_RS07100 PMI_RS07100 44.2 Proteus mirabilis HI4320 - fimbria/pilus periplasmic chaperone
PMI_RS10905 PMI_RS10905 35.8 Proteus mirabilis HI4320 - molecular chaperone
PMI_RS12535 PMI_RS12535 31.2 Proteus mirabilis HI4320 - molecular chaperone
PMI_RS12550 PMI_RS12550 30.2 Proteus mirabilis HI4320 - molecular chaperone
PMI_RS13450 PMI_RS13450 43.6 Proteus mirabilis HI4320 - fimbria/pilus periplasmic chaperone
PMI_RS15275 PMI_RS15275 17.7 Proteus mirabilis HI4320 - fimbria/pilus chaperone family protein
PMI_RS17125 PMI_RS17125 42.2 Proteus mirabilis HI4320 - fimbria/pilus periplasmic chaperone

Distribution of the homologs in the orthogroup group_23

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_23

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P37923 1.19e-77 236 53 2 227 3 fimC Chaperone protein FimC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P77249 3.63e-74 227 51 3 225 2 sfmC Probable fimbrial chaperone SfmC Escherichia coli (strain K12)
P31697 1.95e-60 192 46 5 219 1 fimC Chaperone protein FimC Escherichia coli (strain K12)
P59590 1.87e-59 190 47 5 218 3 fimC Chaperone protein FimC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P62609 1.99e-59 189 45 5 223 1 focC Chaperone protein FocC Escherichia coli
P62610 1.99e-59 189 45 5 223 3 focC Chaperone protein FocC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P75856 2.99e-50 166 44 4 200 2 elfD Probable fimbrial chaperone protein ElfD Escherichia coli (strain K12)
Q8X5E4 3.79e-50 166 43 3 200 2 elfD Probable fimbrial chaperone protein ElfD Escherichia coli O157:H7
Q8X5K6 2.2e-47 159 42 3 214 2 lpfB Probable fimbrial chaperone LpfB Escherichia coli O157:H7
P43661 3.22e-47 159 41 7 221 3 lpfB Chaperone protein LpfB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P42914 4e-39 138 35 4 215 2 yraI Probable fimbrial chaperone YraI Escherichia coli (strain K12)
P45991 5.44e-35 127 35 6 224 3 hifB Chaperone protein HifB Haemophilus influenzae
P35757 5.24e-34 125 36 7 224 3 hifB Chaperone protein HifB Haemophilus influenzae
P21646 5.96e-32 119 35 8 227 3 mrkB Chaperone protein MrkB Klebsiella pneumoniae
P75749 7.67e-30 114 34 7 209 3 ybgP Uncharacterized fimbrial chaperone YbgP Escherichia coli (strain K12)
P46004 5.33e-28 109 32 5 233 3 aggD Chaperone protein AggD Escherichia coli
P53520 8.41e-28 109 33 7 209 3 pmfD Chaperone protein PmfD Proteus mirabilis (strain HI4320)
P33128 1.05e-27 108 32 11 238 1 yadV Probable fimbrial chaperone YadV Escherichia coli (strain K12)
P33409 3.7e-27 107 32 7 220 3 fimB Chaperone protein FimB/FhaD Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
P15319 3.04e-26 104 29 5 208 1 papD Chaperone protein PapD Escherichia coli
P25402 3.67e-26 104 32 8 219 3 fanE Chaperone protein FanE Escherichia coli
P40876 3.09e-25 102 31 8 237 2 ycbF Uncharacterized fimbrial chaperone YcbF Escherichia coli (strain K12)
P26926 7.37e-25 101 32 9 245 1 caf1M Chaperone protein caf1M Yersinia pestis
P53516 4.85e-24 99 30 3 209 3 afaB Chaperone protein AfaB Escherichia coli
P77616 3.65e-23 97 33 11 213 3 yqiH Uncharacterized fimbrial chaperone YqiH Escherichia coli (strain K12)
Q05433 2.04e-21 92 30 9 227 3 clpE Chaperone protein ClpE Escherichia coli
P25401 5.53e-21 91 28 9 239 1 faeE Chaperone protein FaeE Escherichia coli
P46738 2.78e-20 89 29 3 209 3 nfaE Chaperone protein NfaE Escherichia coli
P33387 8.46e-20 87 28 5 239 3 sefB Chaperone protein SefB Salmonella enteritidis
P15483 9.7e-20 87 36 5 194 3 None Chaperone protein CS3-1 Escherichia coli
P33407 9.75e-20 88 27 9 240 3 myfB Chaperone protein MyfB Yersinia enterocolitica
P69966 1.1e-19 88 28 6 223 3 psaB Chaperone protein PsaB Yersinia pseudotuberculosis serotype I (strain IP32953)
P69965 1.1e-19 88 28 6 223 3 psaB Chaperone protein PsaB Yersinia pestis
P33342 3.71e-19 86 27 5 203 2 yehC Probable fimbrial chaperone YehC Escherichia coli (strain K12)
P53519 6.87e-19 85 30 8 233 3 cssC Chaperone protein CssC Escherichia coli
P77599 3.35e-18 83 31 7 202 2 yfcS Probable fimbrial chaperone YfcS Escherichia coli (strain K12)
P53518 5.02e-17 80 29 9 235 3 cssC Chaperone protein CssC Escherichia coli
P42183 1.16e-07 52 32 3 97 3 prsD Chaperone protein PrsD (Fragment) Escherichia coli

  • Number of RefSeq hits:

General

Source Morganella morganii S3
Locus tag LHKJJB_09300
Feature type CDS
Gene -
Product Fimbria/pilus periplasmic chaperone
Location 1746 - 2444 (strand: 1)
Length 699 (nucleotides) / 232 (amino acids)

Contig

Accession ZDB_366
Length 191897 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_23
Orthogroup size 19
N. genomes 6

Actions

Genomic region

Domains

PF00345 Pili and flagellar-assembly chaperone, PapD N-terminal domain
PF02753 Pili assembly chaperone PapD, C-terminal domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG3121 Extracellular structures (W) W P pilus assembly protein, chaperone PapD

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K07346 fimbrial chaperone protein Two-component system -

Protein Sequence

MISDYFKNSALILFFTLMSGFAYSASNQNSGIALGATRVIYPQDAKQTSLSVINHSPKERFLINSWVDNDNGKEKDFVITPPLFVMEPASENILRIVNLAQDLPKDRESVFWLNVKAIPSVDKESLEGKNVLQLAILSRIKLFVRPVNLPIQTEDAAEKITITQKSGAITIDNPTPYYTTFVNIILDGRPLENVMVAPFSTHQIAGKNGRKLTYQTINDYGGLRKQREVNLN

Flanking regions ( +/- flanking 50bp)

TACCATACTCTATGCGTTATTTCTGACAGAGAATATTAAGAGGTACTTTTGTGATTTCTGATTATTTTAAAAATAGTGCATTGATATTGTTTTTCACACTGATGTCAGGGTTTGCTTATTCAGCGTCAAATCAGAACTCAGGAATTGCACTGGGTGCAACCCGGGTCATTTATCCTCAGGATGCAAAACAAACATCACTGTCTGTGATTAACCACAGCCCGAAAGAACGTTTTCTGATCAACTCGTGGGTTGATAACGACAATGGCAAAGAGAAAGACTTTGTTATCACACCGCCATTATTTGTGATGGAGCCTGCCAGCGAAAATATTCTGCGGATTGTTAACCTGGCTCAGGATTTACCGAAAGACCGCGAATCTGTTTTCTGGCTGAACGTAAAAGCAATTCCGTCCGTGGATAAAGAGTCACTGGAAGGAAAAAACGTGCTCCAGCTGGCTATTTTGTCACGGATTAAATTGTTCGTCAGACCGGTAAATTTACCGATCCAGACAGAAGATGCGGCAGAAAAAATCACCATCACGCAGAAAAGCGGCGCGATTACGATTGATAACCCGACGCCGTATTACACCACTTTCGTCAATATTATTTTAGACGGGCGTCCGCTTGAGAATGTCATGGTCGCGCCATTCAGTACCCATCAGATTGCCGGTAAAAACGGCCGTAAACTGACTTATCAGACAATTAATGATTACGGCGGACTGCGCAAACAGCGCGAAGTGAATCTGAATTAAGACATTCATTATTTTATTGTTGTCATGCAGGGAACAGGGTGAAATGAGTA