Homologs in group_394

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
EHELCC_03470 EHELCC_03470 100.0 Morganella morganii S2 - Fimbria/pilus periplasmic chaperone
NLDBIP_03470 NLDBIP_03470 100.0 Morganella morganii S4 - Fimbria/pilus periplasmic chaperone
LHKJJB_09300 LHKJJB_09300 100.0 Morganella morganii S3 - Fimbria/pilus periplasmic chaperone
HKOGLL_09675 HKOGLL_09675 100.0 Morganella morganii S5 - Fimbria/pilus periplasmic chaperone
F4V73_RS01680 F4V73_RS01680 83.1 Morganella psychrotolerans - fimbria/pilus periplasmic chaperone
PMI_RS17125 PMI_RS17125 46.4 Proteus mirabilis HI4320 - fimbria/pilus periplasmic chaperone

Distribution of the homologs in the orthogroup group_394

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_394

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P37923 1.19e-77 236 53 2 227 3 fimC Chaperone protein FimC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P77249 3.63e-74 227 51 3 225 2 sfmC Probable fimbrial chaperone SfmC Escherichia coli (strain K12)
P31697 1.95e-60 192 46 5 219 1 fimC Chaperone protein FimC Escherichia coli (strain K12)
P59590 1.87e-59 190 47 5 218 3 fimC Chaperone protein FimC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P62609 1.99e-59 189 45 5 223 1 focC Chaperone protein FocC Escherichia coli
P62610 1.99e-59 189 45 5 223 3 focC Chaperone protein FocC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P75856 2.99e-50 166 44 4 200 2 elfD Probable fimbrial chaperone protein ElfD Escherichia coli (strain K12)
Q8X5E4 3.79e-50 166 43 3 200 2 elfD Probable fimbrial chaperone protein ElfD Escherichia coli O157:H7
Q8X5K6 2.2e-47 159 42 3 214 2 lpfB Probable fimbrial chaperone LpfB Escherichia coli O157:H7
P43661 3.22e-47 159 41 7 221 3 lpfB Chaperone protein LpfB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P42914 4e-39 138 35 4 215 2 yraI Probable fimbrial chaperone YraI Escherichia coli (strain K12)
P45991 5.44e-35 127 35 6 224 3 hifB Chaperone protein HifB Haemophilus influenzae
P35757 5.24e-34 125 36 7 224 3 hifB Chaperone protein HifB Haemophilus influenzae
P21646 5.96e-32 119 35 8 227 3 mrkB Chaperone protein MrkB Klebsiella pneumoniae
P75749 7.67e-30 114 34 7 209 3 ybgP Uncharacterized fimbrial chaperone YbgP Escherichia coli (strain K12)
P46004 5.33e-28 109 32 5 233 3 aggD Chaperone protein AggD Escherichia coli
P53520 8.41e-28 109 33 7 209 3 pmfD Chaperone protein PmfD Proteus mirabilis (strain HI4320)
P33128 1.05e-27 108 32 11 238 1 yadV Probable fimbrial chaperone YadV Escherichia coli (strain K12)
P33409 3.7e-27 107 32 7 220 3 fimB Chaperone protein FimB/FhaD Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
P15319 3.04e-26 104 29 5 208 1 papD Chaperone protein PapD Escherichia coli
P25402 3.67e-26 104 32 8 219 3 fanE Chaperone protein FanE Escherichia coli
P40876 3.09e-25 102 31 8 237 2 ycbF Uncharacterized fimbrial chaperone YcbF Escherichia coli (strain K12)
P26926 7.37e-25 101 32 9 245 1 caf1M Chaperone protein caf1M Yersinia pestis
P53516 4.85e-24 99 30 3 209 3 afaB Chaperone protein AfaB Escherichia coli
P77616 3.65e-23 97 33 11 213 3 yqiH Uncharacterized fimbrial chaperone YqiH Escherichia coli (strain K12)
Q05433 2.04e-21 92 30 9 227 3 clpE Chaperone protein ClpE Escherichia coli
P25401 5.53e-21 91 28 9 239 1 faeE Chaperone protein FaeE Escherichia coli
P46738 2.78e-20 89 29 3 209 3 nfaE Chaperone protein NfaE Escherichia coli
P33387 8.46e-20 87 28 5 239 3 sefB Chaperone protein SefB Salmonella enteritidis
P15483 9.7e-20 87 36 5 194 3 None Chaperone protein CS3-1 Escherichia coli
P33407 9.75e-20 88 27 9 240 3 myfB Chaperone protein MyfB Yersinia enterocolitica
P69966 1.1e-19 88 28 6 223 3 psaB Chaperone protein PsaB Yersinia pseudotuberculosis serotype I (strain IP32953)
P69965 1.1e-19 88 28 6 223 3 psaB Chaperone protein PsaB Yersinia pestis
P33342 3.71e-19 86 27 5 203 2 yehC Probable fimbrial chaperone YehC Escherichia coli (strain K12)
P53519 6.87e-19 85 30 8 233 3 cssC Chaperone protein CssC Escherichia coli
P77599 3.35e-18 83 31 7 202 2 yfcS Probable fimbrial chaperone YfcS Escherichia coli (strain K12)
P53518 5.02e-17 80 29 9 235 3 cssC Chaperone protein CssC Escherichia coli
P42183 1.16e-07 52 32 3 97 3 prsD Chaperone protein PrsD (Fragment) Escherichia coli

  • Number of RefSeq hits:

General

Source Morganella morganii S1
Locus tag FBDBKF_20060
Feature type CDS
Gene -
Product Fimbria/pilus periplasmic chaperone
Location 12286 - 12984 (strand: -1)
Length 699 (nucleotides) / 232 (amino acids)
In genomic island -

Contig

Accession contig_46
Length 14364 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_394
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00345 Pili and flagellar-assembly chaperone, PapD N-terminal domain
PF02753 Pili assembly chaperone PapD, C-terminal domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG3121 Extracellular structures (W) W P pilus assembly protein, chaperone PapD

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K07346 fimbrial chaperone protein Two-component system -

Protein Sequence

MISDYFKNSALILFFTLMSGFAYSASNQNSGIALGATRVIYPQDAKQTSLSVINHSPKERFLINSWVDNDNGKEKDFVITPPLFVMEPASENILRIVNLAQDLPKDRESVFWLNVKAIPSVDKESLEGKNVLQLAILSRIKLFVRPVNLPIQTEDAAEKITITQKSGAITIDNPTPYYTTFVNIILDGRPLENVMVAPFSTHQIAGKNGRKLTYQTINDYGGLRKQREVNLN

Flanking regions ( +/- flanking 50bp)

TACCATACTCTATGCGTTATTTCTGACAGAGAATATTAAGAGGTACTTTTGTGATTTCTGATTATTTTAAAAATAGTGCATTGATATTGTTTTTCACACTGATGTCAGGGTTTGCTTATTCAGCGTCAAATCAGAACTCAGGAATTGCACTGGGTGCAACCCGGGTCATTTATCCTCAGGATGCAAAACAAACATCACTGTCTGTGATTAACCACAGCCCGAAAGAACGTTTTCTGATCAACTCGTGGGTTGATAACGACAATGGCAAAGAGAAAGACTTTGTTATCACACCGCCATTATTTGTGATGGAGCCTGCCAGCGAAAATATTCTGCGGATTGTTAACCTGGCTCAGGATTTACCGAAAGACCGCGAATCTGTTTTCTGGCTGAACGTAAAAGCAATTCCGTCCGTGGATAAAGAGTCACTGGAAGGAAAAAACGTGCTCCAGCTGGCTATTTTGTCACGGATTAAATTGTTCGTCAGACCGGTAAATTTACCGATCCAGACAGAAGATGCGGCAGAAAAAATCACCATCACGCAGAAAAGCGGCGCGATTACGATTGATAACCCGACGCCGTATTACACCACTTTCGTCAATATTATTTTAGACGGGCGTCCGCTTGAGAATGTCATGGTCGCGCCATTCAGTACCCATCAGATTGCCGGTAAAAACGGCCGTAAACTGACTTATCAGACAATTAATGATTACGGCGGACTGCGCAAACAGCGCGAAGTGAATCTGAATTAAGACATTCATTATTTTATTGTTGTCATGCAGGGAACAGGGTGAAATGAGTA