Homologs in group_2752

Help

5 homologs were identified in 5 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_07670 FBDBKF_07670 100.0 Morganella morganii S1 guaD guanine deaminase
EHELCC_13500 EHELCC_13500 100.0 Morganella morganii S2 guaD guanine deaminase
NLDBIP_13945 NLDBIP_13945 100.0 Morganella morganii S4 guaD guanine deaminase
HKOGLL_08455 HKOGLL_08455 100.0 Morganella morganii S5 guaD guanine deaminase
F4V73_RS13430 F4V73_RS13430 96.1 Morganella psychrotolerans guaD guanine deaminase

Distribution of the homologs in the orthogroup group_2752

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2752

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P76641 0.0 729 76 0 438 1 guaD Guanine deaminase Escherichia coli (strain K12)
Q9RYX4 1.69e-99 307 40 4 419 3 guaD Probable guanine deaminase Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
Q86AW9 1.73e-83 266 34 11 458 1 guaD Guanine deaminase Dictyostelium discoideum
Q9Y2T3 5.58e-74 241 37 8 383 1 GDA Guanine deaminase Homo sapiens
Q5RAV9 6.83e-74 241 36 7 377 2 GDA Guanine deaminase Pongo abelii
Q9WTT6 2.61e-69 229 37 7 377 1 Gda Guanine deaminase Rattus norvegicus
Q9R111 5.55e-69 229 37 7 377 1 Gda Guanine deaminase Mus musculus
Q07729 1.5e-63 215 36 7 354 1 GUD1 Probable guanine deaminase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
O14057 3.13e-63 216 34 7 422 3 SPCC1672.03c Probable guanine deaminase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9VMY9 3.12e-60 206 33 10 399 1 DhpD Guanine deaminase Drosophila melanogaster
Q67NQ5 5e-42 157 29 17 420 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
A0LMI3 1.51e-41 155 31 14 407 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
Q72B14 5.27e-40 151 31 14 380 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
A1VD37 8.6e-40 151 30 14 380 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Nitratidesulfovibrio vulgaris (strain DP4)
B8DKS6 9.19e-40 150 29 16 417 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Nitratidesulfovibrio vulgaris (strain DSM 19637 / Miyazaki F)
Q2LTB7 8.83e-34 134 26 8 379 3 mtaD1 5-methylthioadenosine/S-adenosylhomocysteine deaminase 1 Syntrophus aciditrophicus (strain SB)
B1I2P4 1.27e-32 131 32 13 334 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Desulforudis audaxviator (strain MP104C)
Q9EYU0 4.79e-32 130 25 15 437 1 triA Melamine deaminase Paracidovorax citrulli
O27549 9.61e-32 129 30 14 382 3 dadD 5'-deoxyadenosine deaminase Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
B8J2Q8 1.59e-31 128 30 13 376 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Desulfovibrio desulfuricans (strain ATCC 27774 / DSM 6949 / MB)
Q0AYV2 2e-31 127 28 17 416 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
B7IS56 2.68e-31 127 28 13 373 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus cereus (strain G9842)
Q81F14 2.71e-31 127 28 13 373 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
B5YLB7 3.1e-31 127 27 12 393 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
O31352 1.18e-30 125 28 13 373 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus cereus (strain ATCC 10987 / NRS 248)
C1EPN0 1.2e-30 125 28 13 373 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus cereus (strain 03BB102)
P72156 1.68e-30 125 25 16 436 1 atzA Atrazine chlorohydrolase Pseudomonas sp. (strain ADP)
Q9V0Y5 1.69e-30 125 29 15 359 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Pyrococcus abyssi (strain GE5 / Orsay)
A0RCM7 1.81e-30 125 28 13 373 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus thuringiensis (strain Al Hakam)
B7HIQ2 2.25e-30 125 29 12 345 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus cereus (strain B4264)
B7JJI0 3.06e-30 124 28 13 373 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus cereus (strain AH820)
Q81S14 3.06e-30 124 28 13 373 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus anthracis
C3L6N3 3.06e-30 124 28 13 373 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3P768 3.06e-30 124 28 13 373 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus anthracis (strain A0248)
A7GNR9 5.25e-30 124 28 11 339 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q92342 8.44e-30 124 29 18 434 3 SPAC1F8.04c Uncharacterized protein C1F8.04c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
B7HMN9 1.18e-29 123 28 13 373 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus cereus (strain AH187)
Q2RJW1 1.74e-29 122 29 12 339 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q2LUH4 1.8e-29 122 26 10 413 3 mtaD2 5-methylthioadenosine/S-adenosylhomocysteine deaminase 2 Syntrophus aciditrophicus (strain SB)
Q6HK87 2.28e-29 122 28 13 373 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q63CU1 2.28e-29 122 28 13 373 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus cereus (strain ZK / E33L)
Q58936 4.55e-28 118 28 14 367 1 dadD 5'-deoxyadenosine deaminase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
A6UQD4 1.06e-27 117 28 15 352 3 dadD 5'-deoxyadenosine deaminase Methanococcus vannielii (strain ATCC 35089 / DSM 1224 / JCM 13029 / OCM 148 / SB)
B8CX03 1.3e-27 117 26 13 387 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Halothermothrix orenii (strain H 168 / OCM 544 / DSM 9562)
A4J675 2.7e-27 116 27 17 418 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
A6VH76 2.77e-27 116 28 15 353 3 dadD 5'-deoxyadenosine deaminase Methanococcus maripaludis (strain C7 / ATCC BAA-1331)
Q1MR44 4.25e-27 115 24 11 408 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Lawsonia intracellularis (strain PHE/MN1-00)
A5UMN6 4.68e-27 115 28 15 412 3 dadD 5'-deoxyadenosine deaminase Methanobrevibacter smithii (strain ATCC 35061 / DSM 861 / OCM 144 / PS)
B8FRL9 1.46e-26 114 27 17 391 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
Q24UA2 2.05e-26 114 27 17 391 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Desulfitobacterium hafniense (strain Y51)
Q8PUQ3 2.69e-26 113 28 16 426 3 dadD 5'-deoxyadenosine deaminase Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
B0K2W0 4.37e-26 112 27 13 338 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Thermoanaerobacter sp. (strain X514)
B0K8R8 4.37e-26 112 27 13 338 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
A6UUG9 5.38e-26 112 26 14 344 3 dadD 5'-deoxyadenosine deaminase Methanococcus aeolicus (strain ATCC BAA-1280 / DSM 17508 / OCM 812 / Nankai-3)
A9A9H3 6.59e-26 112 28 15 353 3 dadD 5'-deoxyadenosine deaminase Methanococcus maripaludis (strain C6 / ATCC BAA-1332)
Q5JER0 6.67e-26 112 29 12 345 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
A5D1G6 6.83e-26 112 27 13 338 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
Q8TRA4 6.89e-26 112 28 13 386 3 dadD 5'-deoxyadenosine deaminase Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
O66851 9.63e-26 112 25 10 376 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Aquifex aeolicus (strain VF5)
Q8TYD4 3.58e-25 110 25 14 408 3 dadD 5'-deoxyadenosine deaminase Methanopyrus kandleri (strain AV19 / DSM 6324 / JCM 9639 / NBRC 100938)
A4FW32 4.34e-25 109 27 16 379 3 dadD 5'-deoxyadenosine deaminase Methanococcus maripaludis (strain C5 / ATCC BAA-1333)
Q891Y7 4.96e-25 109 25 17 397 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Clostridium tetani (strain Massachusetts / E88)
Q8U0P7 5.29e-25 109 28 15 395 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
O29265 6.96e-25 109 31 12 333 3 mtaD2 5-methylthioadenosine/S-adenosylhomocysteine deaminase 2 Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q9KC82 9.58e-25 108 28 13 349 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q2NHL6 2.43e-24 107 25 15 394 3 dadD 5'-deoxyadenosine deaminase Methanosphaera stadtmanae (strain ATCC 43021 / DSM 3091 / JCM 11832 / MCB-3)
Q3ITF7 3.98e-24 107 29 11 347 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Natronomonas pharaonis (strain ATCC 35678 / DSM 2160 / CIP 103997 / JCM 8858 / NBRC 14720 / NCIMB 2260 / Gabara)
B5YDN9 6.23e-24 106 25 14 385 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Dictyoglomus thermophilum (strain ATCC 35947 / DSM 3960 / H-6-12)
Q8R9L4 6.43e-24 106 27 12 335 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q6LX61 6.65e-24 106 27 15 353 3 dadD 5'-deoxyadenosine deaminase Methanococcus maripaludis (strain DSM 14266 / JCM 13030 / NBRC 101832 / S2 / LL)
Q3AC64 8.64e-24 106 28 13 348 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q5WGA8 1.01e-23 106 28 20 385 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Shouchella clausii (strain KSM-K16)
Q5UYR3 4.45e-23 104 27 13 346 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
Q466Q9 4.45e-23 104 27 13 379 3 dadD 5'-deoxyadenosine deaminase Methanosarcina barkeri (strain Fusaro / DSM 804)
C6A048 4.5e-23 103 27 14 390 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Thermococcus sibiricus (strain DSM 12597 / MM 739)
B8E183 1.05e-22 103 26 12 330 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Dictyoglomus turgidum (strain DSM 6724 / Z-1310)
A4XJI3 1.92e-22 102 27 18 412 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
B6YUF8 4.04e-22 101 28 12 345 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Thermococcus onnurineus (strain NA1)
C5BSJ0 2.04e-21 99 27 18 406 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Teredinibacter turnerae (strain ATCC 39867 / T7901)
A3DEQ2 2.35e-21 99 25 13 378 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q9I6Z0 5.75e-20 95 25 14 380 1 PA0142 8-oxoguanine deaminase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A0B7V2 9.25e-20 94 25 11 357 3 dadD 5'-deoxyadenosine deaminase Methanothrix thermoacetophila (strain DSM 6194 / JCM 14653 / NBRC 101360 / PT)
Q9HN51 9.32e-20 94 27 14 327 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
O59184 1.11e-19 94 26 14 357 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q12WS1 1.69e-19 93 25 16 391 3 dadD 5'-deoxyadenosine deaminase Methanococcoides burtonii (strain DSM 6242 / NBRC 107633 / OCM 468 / ACE-M)
O29701 4.37e-19 92 29 16 347 3 mtaD1 5-methylthioadenosine/S-adenosylhomocysteine deaminase 1 Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q18EV7 5.57e-19 92 26 14 353 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Haloquadratum walsbyi (strain DSM 16790 / HBSQ001)
P95442 3.02e-17 87 24 17 433 1 atzB Hydroxydechloroatrazine ethylaminohydrolase Pseudomonas sp. (strain ADP)
Q9X034 3.31e-17 86 26 17 370 1 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q21IS0 1.33e-16 85 24 11 383 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
A7I6C5 5.1e-16 83 28 17 358 3 dadD 5'-deoxyadenosine deaminase Methanoregula boonei (strain DSM 21154 / JCM 14090 / 6A8)
Q52725 4.03e-14 77 25 6 233 1 trzA S-triazine hydrolase Gordonia rubripertincta
P0CI72 5.49e-13 74 24 13 370 1 None Isoxanthopterin deaminase Unknown prokaryotic organism
Q2FRU6 6.63e-12 70 25 15 352 3 dadD 5'-deoxyadenosine deaminase Methanospirillum hungatei JF-1 (strain ATCC 27890 / DSM 864 / NBRC 100397 / JF-1)
A6Q234 3.18e-09 62 23 14 344 1 NIS_0429 Aminodeoxyfutalosine deaminase Nitratiruptor sp. (strain SB155-2)
Q6L2W1 3.1e-07 55 21 17 382 3 hutI Imidazolonepropionase Picrophilus torridus (strain ATCC 700027 / DSM 9790 / JCM 10055 / NBRC 100828 / KAW 2/3)
Q9HLJ0 5.16e-07 55 22 14 382 3 hutI Imidazolonepropionase Thermoplasma acidophilum (strain ATCC 25905 / DSM 1728 / JCM 9062 / NBRC 15155 / AMRC-C165)
Q891P9 1.65e-06 53 22 16 387 3 hutI Imidazolonepropionase Clostridium tetani (strain Massachusetts / E88)
A6H0H4 3.81e-06 52 21 17 414 3 hutI Imidazolonepropionase Flavobacterium psychrophilum (strain ATCC 49511 / DSM 21280 / CIP 103535 / JIP02/86)
Q6A5T8 4.6e-06 52 20 11 382 3 hutI Imidazolonepropionase Cutibacterium acnes (strain DSM 16379 / KPA171202)
A6KX92 9.76e-06 51 22 14 345 3 hutI Imidazolonepropionase Phocaeicola vulgatus (strain ATCC 8482 / DSM 1447 / JCM 5826 / CCUG 4940 / NBRC 14291 / NCTC 11154)
A1SPZ7 3.62e-05 49 21 14 395 3 hutI Imidazolonepropionase Nocardioides sp. (strain ATCC BAA-499 / JS614)
A0LZE0 5.95e-05 48 21 16 429 3 hutI Imidazolonepropionase Christiangramia forsetii (strain DSM 17595 / CGMCC 1.15422 / KT0803)
B0KCB7 6.6e-05 48 22 17 418 3 hutI Imidazolonepropionase Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
Q6MJP9 0.000136 47 26 2 121 3 hutI Imidazolonepropionase Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
A8AZ63 0.000272 46 36 0 52 3 hutI Imidazolonepropionase Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
Q8A4B1 0.000295 46 21 15 382 3 hutI Imidazolonepropionase Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
C5C8I6 0.000336 46 30 3 114 3 hutI Imidazolonepropionase Micrococcus luteus (strain ATCC 4698 / DSM 20030 / JCM 1464 / CCM 169 / CCUG 5858 / IAM 1056 / NBRC 3333 / NCIMB 9278 / NCTC 2665 / VKM Ac-2230)
A8GDJ0 0.000398 46 27 4 138 3 hutI Imidazolonepropionase Serratia proteamaculans (strain 568)
B3R6A3 0.000559 45 38 3 62 3 hutI Imidazolonepropionase Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
A3CL31 0.000598 45 19 11 392 3 hutI Imidazolonepropionase Streptococcus sanguinis (strain SK36)
A1AZX8 0.000626 45 36 1 63 3 hutI Imidazolonepropionase Paracoccus denitrificans (strain Pd 1222)
Q64NP4 0.000655 45 22 13 345 3 hutI Imidazolonepropionase Bacteroides fragilis (strain YCH46)
Q9RZ05 0.000772 45 35 2 62 3 hutI Imidazolonepropionase Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
Q5L8E4 0.000837 45 22 13 345 3 hutI Imidazolonepropionase Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
Q01W05 0.000838 45 31 3 109 3 hutI Imidazolonepropionase Solibacter usitatus (strain Ellin6076)

  • Number of RefSeq hits:

General

Source Morganella morganii S3
Locus tag LHKJJB_08905
Feature type CDS
Gene guaD
Product guanine deaminase
Location 116419 - 117735 (strand: 1)
Length 1317 (nucleotides) / 438 (amino acids)

Contig

Accession ZDB_365
Length 192330 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2752
Orthogroup size 6
N. genomes 6

Actions

Genomic region

Domains

PF01979 Amidohydrolase family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0402 Nucleotide transport and metabolism (F)
General function prediction only (R)		 FR Cytosine/adenosine deaminase or related metal-dependent hydrolase

Kegg Ortholog Annotation(s)

Protein Sequence

MSSEHTVKAVRGKFLDITRVVTSMDDLPDAVRLIDDGLMLIRHGKIEWFGQWEDGKHLIPETVRVRDYTGKLVVPGFIDTHVHYPQSEMIGAHGEQLLEWLNRHVFPTEKLYQDIDYAREMSAFFIKQLLRNGTTTALVFSTVHPESVNALFDAASQLNMRLITGKVMMDRNAPDYLTDTPESSYEECKALIERWHKKGRLLYAITPRFAPTSSPEQLAVCQRLRGEYPDTWVHTHLDENKAEIEWVKELYPDSKNYLDVYHHYGLTGERSVFAHCIHLEEEEWDCLHDTGSAVAFCPTSNLYLGSGLFNLKKALAKKVKVGIGTDVGAGTTFNMLQTLSEAYKVMQLQKTCLTAFEAFYLATLGGAHSLGLDNCIGNFAAGKEADFVVLEPTATPLQQLRYDNSRTLAEKLFVMIALGDDRTIYRTYIDGRLVYERT

Flanking regions ( +/- flanking 50bp)

CTGCCCTCGCCGGTTCCGGTGAGGGCTTTTTGTAAGCAGAGGAGTCAGCTATGTCGTCTGAACATACCGTCAAAGCGGTACGCGGGAAGTTCCTGGATATCACCCGCGTAGTGACCTCGATGGACGATCTGCCCGATGCAGTCCGCCTGATTGATGACGGCCTGATGCTAATCCGGCACGGAAAAATAGAGTGGTTCGGACAGTGGGAAGACGGGAAGCATCTGATCCCGGAAACCGTCCGTGTCCGCGATTACACCGGGAAACTGGTGGTGCCGGGCTTTATTGATACCCACGTTCACTATCCGCAGAGCGAGATGATCGGTGCTCACGGCGAGCAGTTACTCGAATGGCTCAACCGCCATGTGTTCCCGACTGAAAAGCTGTATCAGGATATTGATTACGCCCGTGAAATGTCAGCGTTTTTTATCAAACAACTGCTGCGTAACGGCACCACGACCGCACTGGTCTTCAGTACTGTTCACCCGGAATCGGTCAATGCCCTGTTTGATGCGGCGAGCCAGCTCAATATGCGCCTCATCACCGGTAAAGTGATGATGGACAGAAACGCGCCGGACTACCTCACCGACACACCGGAAAGCAGCTACGAAGAGTGTAAGGCGCTGATCGAACGCTGGCATAAAAAAGGGCGTCTGCTCTATGCCATCACCCCGCGTTTTGCGCCGACCTCCAGCCCGGAACAGCTGGCGGTGTGTCAGCGGCTGCGCGGGGAGTATCCGGACACCTGGGTTCACACTCACCTTGATGAAAACAAAGCAGAAATTGAGTGGGTAAAAGAACTCTATCCGGACAGCAAAAACTACCTGGATGTCTATCACCACTACGGACTGACCGGCGAACGCAGCGTATTTGCGCACTGTATCCACCTTGAGGAAGAAGAGTGGGACTGCCTGCACGATACCGGCTCAGCGGTGGCATTTTGTCCGACATCAAACCTTTATCTCGGCAGCGGCCTGTTTAATCTGAAAAAGGCGCTGGCGAAAAAAGTGAAAGTCGGGATTGGTACGGATGTCGGTGCCGGAACGACCTTCAATATGCTGCAGACACTGAGTGAAGCTTACAAAGTGATGCAGTTGCAGAAAACCTGTTTAACCGCTTTTGAAGCGTTTTATCTCGCCACCCTCGGCGGCGCGCATTCATTAGGACTGGATAACTGTATCGGTAACTTTGCCGCCGGCAAAGAAGCGGATTTTGTGGTACTTGAACCGACCGCGACCCCGCTCCAGCAGTTGCGTTATGACAACTCACGCACGCTGGCGGAGAAACTGTTTGTGATGATTGCGCTTGGTGATGACCGCACGATTTACCGGACTTACATCGATGGACGCCTGGTCTATGAACGGACCTGACGCACACCAATGCAGTGATTAAAACACATTTTCATTTCATTCTCGGGGTC