Homologs in group_706

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_03060 FBDBKF_03060 100.0 Morganella morganii S1 rsmI 16S rRNA (cytidine(1402)-2'-O)-methyltransferase
EHELCC_07475 EHELCC_07475 100.0 Morganella morganii S2 rsmI 16S rRNA (cytidine(1402)-2'-O)-methyltransferase
NLDBIP_07800 NLDBIP_07800 100.0 Morganella morganii S4 rsmI 16S rRNA (cytidine(1402)-2'-O)-methyltransferase
HKOGLL_03595 HKOGLL_03595 100.0 Morganella morganii S5 rsmI 16S rRNA (cytidine(1402)-2'-O)-methyltransferase
F4V73_RS11860 F4V73_RS11860 91.7 Morganella psychrotolerans rsmI 16S rRNA (cytidine(1402)-2'-O)-methyltransferase
PMI_RS18375 PMI_RS18375 78.3 Proteus mirabilis HI4320 rsmI 16S rRNA (cytidine(1402)-2'-O)-methyltransferase

Distribution of the homologs in the orthogroup group_706

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_706

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P67087 1.35e-147 418 73 1 284 1 rsmI Ribosomal RNA small subunit methyltransferase I Escherichia coli (strain K12)
P67088 1.35e-147 418 73 1 284 3 rsmI Ribosomal RNA small subunit methyltransferase I Escherichia coli O157:H7
P45298 3.79e-133 381 66 2 272 3 rsmI Ribosomal RNA small subunit methyltransferase I Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9CN04 8.54e-132 378 66 0 271 3 rsmI Ribosomal RNA small subunit methyltransferase I Pasteurella multocida (strain Pm70)
Q9KUD9 4.4e-126 363 63 0 275 3 rsmI Ribosomal RNA small subunit methyltransferase I Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P57192 3.23e-102 303 50 0 273 3 rsmI Ribosomal RNA small subunit methyltransferase I Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q8KA29 1.24e-101 301 48 2 284 3 rsmI Ribosomal RNA small subunit methyltransferase I Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q9HVZ3 1.35e-96 288 54 1 277 3 rsmI Ribosomal RNA small subunit methyltransferase I Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q87B70 1.83e-93 280 53 1 267 3 rsmI Ribosomal RNA small subunit methyltransferase I Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q9PFV5 2.35e-93 280 52 1 267 3 rsmI Ribosomal RNA small subunit methyltransferase I Xylella fastidiosa (strain 9a5c)
Q89AY5 2.78e-90 273 43 1 285 3 rsmI Ribosomal RNA small subunit methyltransferase I Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
P74038 1.24e-75 235 46 2 273 3 rsmI Ribosomal RNA small subunit methyltransferase I Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q9JXE3 3.76e-70 221 43 1 276 3 rsmI Ribosomal RNA small subunit methyltransferase I Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
P0DF47 2.37e-69 219 44 4 274 3 rsmI Ribosomal RNA small subunit methyltransferase I Streptococcus pyogenes serotype M3 (strain SSI-1)
P0DF46 2.37e-69 219 44 4 274 3 rsmI Ribosomal RNA small subunit methyltransferase I Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q9JWJ7 3.7e-69 219 43 1 276 3 rsmI Ribosomal RNA small subunit methyltransferase I Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q9A186 2.23e-68 217 44 4 274 3 rsmI Ribosomal RNA small subunit methyltransferase I Streptococcus pyogenes serotype M1
Q8P2A6 2.52e-67 214 43 4 274 3 rsmI Ribosomal RNA small subunit methyltransferase I Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q9KGL2 1.28e-66 212 46 4 273 3 rsmI Ribosomal RNA small subunit methyltransferase I Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q5XDL7 1.29e-65 209 43 4 274 3 rsmI Ribosomal RNA small subunit methyltransferase I Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q98DM9 2.66e-65 209 45 3 273 3 rsmI Ribosomal RNA small subunit methyltransferase I Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q2NAK3 5.53e-62 200 42 4 284 3 rsmI Ribosomal RNA small subunit methyltransferase I Erythrobacter litoralis (strain HTCC2594)
Q08329 1.12e-61 200 44 3 276 3 rsmI Ribosomal RNA small subunit methyltransferase I (Fragment) Micromonospora olivasterospora
P37544 7.05e-55 182 40 3 273 3 rsmI Ribosomal RNA small subunit methyltransferase I Bacillus subtilis (strain 168)
Q9ZCJ3 7.83e-53 177 37 2 239 3 rsmI Ribosomal RNA small subunit methyltransferase I Rickettsia prowazekii (strain Madrid E)
Q9WZG8 1.77e-50 169 39 3 223 3 rsmI Ribosomal RNA small subunit methyltransferase I Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q98RF5 7.51e-47 159 40 3 220 3 rsmI Ribosomal RNA small subunit methyltransferase I Mycoplasmopsis pulmonis (strain UAB CTIP)
O83940 1.72e-46 160 39 4 275 3 rsmI Ribosomal RNA small subunit methyltransferase I Treponema pallidum (strain Nichols)
P9WGW7 6.41e-45 156 36 4 268 1 rsmI Ribosomal RNA small subunit methyltransferase I Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P0A641 6.41e-45 156 36 4 268 3 rsmI Ribosomal RNA small subunit methyltransferase I Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WGW6 7.61e-45 156 36 4 268 3 rsmI Ribosomal RNA small subunit methyltransferase I Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
B4U6H0 1.31e-43 151 39 5 221 3 rsmI Ribosomal RNA small subunit methyltransferase I Hydrogenobaculum sp. (strain Y04AAS1)
Q661J3 3.72e-41 145 39 3 220 3 rsmI Ribosomal RNA small subunit methyltransferase I Borrelia garinii subsp. bavariensis (strain ATCC BAA-2496 / DSM 23469 / PBi)
B0SPB4 1.11e-38 139 39 3 193 3 rsmI Ribosomal RNA small subunit methyltransferase I Leptospira biflexa serovar Patoc (strain Patoc 1 / ATCC 23582 / Paris)
Q9ZLS8 4.63e-36 133 34 8 284 3 rsmI Ribosomal RNA small subunit methyltransferase I Helicobacter pylori (strain J99 / ATCC 700824)
P56204 9.96e-36 132 34 8 284 3 rsmI Ribosomal RNA small subunit methyltransferase I Helicobacter pylori (strain ATCC 700392 / 26695)
C5J6H5 1.53e-33 125 37 5 198 3 rsmI Ribosomal RNA small subunit methyltransferase I Mesomycoplasma conjunctivae (strain ATCC 25834 / NCTC 10147 / HRC/581)
B5Y7N9 2.1e-29 114 34 4 219 3 rsmI Ribosomal RNA small subunit methyltransferase I Coprothermobacter proteolyticus (strain ATCC 35245 / DSM 5265 / OCM 4 / BT)
P75046 1.57e-25 105 29 8 286 3 rsmI Ribosomal RNA small subunit methyltransferase I Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
A0RMQ7 4.72e-25 103 32 7 275 3 rsmI Ribosomal RNA small subunit methyltransferase I Campylobacter fetus subsp. fetus (strain 82-40)
Q053G0 2.15e-23 99 34 6 210 3 rsmI Ribosomal RNA small subunit methyltransferase I Leptospira borgpetersenii serovar Hardjo-bovis (strain L550)
P47302 2.12e-22 97 28 7 234 3 rsmI Ribosomal RNA small subunit methyltransferase I Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)

  • Number of RefSeq hits:

General

Source Morganella morganii S3
Locus tag LHKJJB_07335
Feature type CDS
Gene rsmI
Product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase
Location 198647 - 199519 (strand: 1)
Length 873 (nucleotides) / 290 (amino acids)

Contig

Accession ZDB_363
Length 233386 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_706
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00590 Tetrapyrrole (Corrin/Porphyrin) Methylases
PF23016 RsmI C-terminal HTH domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0313 Translation, ribosomal structure and biogenesis (J) J 16S rRNA C1402 (ribose-2'-O) methylase RsmI

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K07056 16S rRNA (cytidine1402-2'-O)-methyltransferase [EC:2.1.1.198] - -

Protein Sequence

MNQPNQAVVAAATLYVVPTPIGNLNDITARALEVLTNVDLIAAEDTRHTGLLLSHFGINNRLFALHDHNEQYKADQLITKLQSGISIALVSDAGTPLINDPGYHLVRRARDAGLTVIPLPGACAAVTALSAAGLPSDRFCYEGFLPAKTKSRQDTLRTLADEPRTLIFYESTHRILDTLADMVTVWGEDRYVVLARELTKTWESIQGKPVGELLAWIKEDENRRKGEMVLIAEGAKPVQDEEFSPEILRALAIVQKELPPKKAAAVVAELYGVKKNALYRYTLDGDSAAE

Flanking regions ( +/- flanking 50bp)

GTTATAGTTTTCTGAAAGCTCAATTCTAATGTGATCATCTGGACGAAACAATGAATCAACCTAATCAAGCCGTGGTTGCGGCAGCGACACTTTATGTTGTGCCGACACCGATCGGTAATCTGAATGACATCACGGCACGTGCTCTTGAGGTGCTCACGAATGTCGATCTGATTGCAGCGGAAGATACCCGGCATACCGGCTTATTACTTTCGCACTTCGGTATTAATAACCGGTTGTTTGCGCTGCATGATCATAATGAACAGTATAAAGCAGATCAATTAATTACCAAATTACAGTCCGGGATCAGTATCGCATTAGTGTCCGATGCAGGTACACCTTTAATTAACGATCCCGGTTACCATCTGGTCCGCCGCGCCCGTGATGCGGGGCTTACTGTGATCCCGCTGCCCGGTGCCTGTGCGGCTGTCACCGCGCTGAGTGCTGCCGGTCTGCCCTCTGACCGTTTTTGTTACGAGGGATTTCTGCCGGCCAAAACCAAAAGCCGGCAGGACACACTGCGGACGCTGGCCGATGAGCCGCGCACGCTGATTTTTTATGAATCCACCCACCGCATTCTGGATACACTGGCCGATATGGTCACCGTCTGGGGGGAAGACCGTTATGTGGTGCTGGCGCGGGAGCTGACCAAAACCTGGGAATCCATTCAGGGGAAACCGGTCGGGGAACTGCTGGCCTGGATTAAGGAAGACGAAAACCGCCGCAAAGGGGAGATGGTACTGATTGCGGAAGGTGCTAAGCCGGTGCAGGATGAGGAATTCAGCCCGGAAATTCTGCGTGCACTGGCGATTGTGCAGAAAGAACTGCCGCCGAAAAAAGCGGCTGCGGTGGTGGCGGAACTGTACGGCGTGAAGAAAAATGCTCTTTACCGTTACACCCTGGACGGGGATTCTGCCGCAGAGTGATGCCTTTTCCGCCATCCGGTCTTCCGGGGCGGAGTTATTCTGTACATCAG