Homologs in group_734

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_03245 FBDBKF_03245 100.0 Morganella morganii S1 lptB LPS export ABC transporter ATP-binding protein
EHELCC_07290 EHELCC_07290 100.0 Morganella morganii S2 lptB LPS export ABC transporter ATP-binding protein
NLDBIP_07615 NLDBIP_07615 100.0 Morganella morganii S4 lptB LPS export ABC transporter ATP-binding protein
HKOGLL_03780 HKOGLL_03780 100.0 Morganella morganii S5 lptB LPS export ABC transporter ATP-binding protein
F4V73_RS11675 F4V73_RS11675 96.7 Morganella psychrotolerans lptB LPS export ABC transporter ATP-binding protein
PMI_RS18155 PMI_RS18155 85.5 Proteus mirabilis HI4320 lptB LPS export ABC transporter ATP-binding protein

Distribution of the homologs in the orthogroup group_734

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_734

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0A9V4 6.41e-142 400 83 0 241 1 lptB Lipopolysaccharide export system ATP-binding protein LptB Shigella flexneri
P0A9V1 6.41e-142 400 83 0 241 1 lptB Lipopolysaccharide export system ATP-binding protein LptB Escherichia coli (strain K12)
P0A9V2 6.41e-142 400 83 0 241 3 lptB Lipopolysaccharide export system ATP-binding protein LptB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9V3 6.41e-142 400 83 0 241 3 lptB Lipopolysaccharide export system ATP-binding protein LptB Escherichia coli O157:H7
P45073 3.61e-138 390 78 0 241 1 lptB Lipopolysaccharide export system ATP-binding protein LptB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P33982 3.02e-95 283 59 1 240 3 AZC_3926 Probable ABC transporter ATP-binding protein AZC_3926 Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
P24693 3.72e-94 279 59 1 238 3 lptB Lipopolysaccharide export system ATP-binding protein LptB Acidithiobacillus ferridurans
P25885 5.38e-94 279 57 1 238 3 R00382 Uncharacterized ABC transporter ATP-binding protein R00382 Rhizobium meliloti (strain 1021)
P20162 9.97e-67 207 74 0 139 3 lptB Lipopolysaccharide export system ATP-binding protein LptB (Fragment) Pseudomonas putida
P21629 2.1e-40 142 32 3 252 3 braF High-affinity branched-chain amino acid transport ATP-binding protein BraF Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P94440 6.55e-40 142 35 2 217 1 lnrL Linearmycin resistance ATP-binding protein LnrL Bacillus subtilis (strain 168)
P0A9S9 1.99e-39 139 32 3 250 3 livG High-affinity branched-chain amino acid transport ATP-binding protein LivG Shigella flexneri
P0A9S7 1.99e-39 139 32 3 250 3 livG High-affinity branched-chain amino acid transport ATP-binding protein LivG Escherichia coli (strain K12)
P0A9S8 1.99e-39 139 32 3 250 3 livG High-affinity branched-chain amino acid transport ATP-binding protein LivG Escherichia coli O157:H7
Q8UA73 3.59e-39 141 32 6 246 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Agrobacterium fabrum (strain C58 / ATCC 33970)
P0A193 9.62e-39 138 32 3 250 3 livG High-affinity branched-chain amino acid transport ATP-binding protein LivG Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A194 9.62e-39 138 32 3 250 3 livG High-affinity branched-chain amino acid transport ATP-binding protein LivG Salmonella typhi
Q8D0W8 1.52e-38 140 32 5 241 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Yersinia pestis
Q668K6 4.27e-38 139 32 5 241 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Yersinia pseudotuberculosis serotype I (strain IP32953)
P22731 8.23e-38 135 32 3 234 1 livF High-affinity branched-chain amino acid transport ATP-binding protein LivF Escherichia coli (strain K12)
O28881 1.94e-37 134 33 1 247 3 livG Probable branched-chain amino acid transport ATP-binding protein LivG Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q7N6Z2 6.14e-37 136 31 5 237 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
P0A191 1.02e-36 132 32 3 234 3 livF High-affinity branched-chain amino acid transport ATP-binding protein LivF Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A192 1.02e-36 132 32 3 234 3 livF High-affinity branched-chain amino acid transport ATP-binding protein LivF Salmonella typhi
Q8Z0H0 1.06e-35 132 34 3 225 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q45460 1.47e-35 132 34 5 227 2 opuBA Choline transport ATP-binding protein OpuBA Bacillus subtilis (strain 168)
Q58664 1.58e-35 129 31 4 232 3 livF Probable branched-chain amino acid transport ATP-binding protein LivF Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q81GU1 3.4e-35 131 31 4 230 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q8FFB3 3.91e-35 131 31 5 241 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P16676 3.95e-35 131 31 5 241 1 cysA Sulfate/thiosulfate import ATP-binding protein CysA Escherichia coli (strain K12)
Q8XBJ8 3.99e-35 131 31 5 241 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Escherichia coli O157:H7
Q8Z4V6 5.84e-35 130 30 5 241 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Salmonella typhi
P40860 6.2e-35 130 30 5 241 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q7UC29 7.18e-35 130 31 5 241 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Shigella flexneri
O34992 7.63e-35 130 33 5 227 1 opuCA Glycine betaine/carnitine/choline transport ATP-binding protein OpuCA Bacillus subtilis (strain 168)
Q88AS5 7.78e-35 129 32 5 239 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q93DX8 8.9e-35 128 31 4 244 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA (Fragment) Burkholderia cepacia
P14788 9.15e-35 130 33 3 225 2 cysA Sulfate/thiosulfate import ATP-binding protein CysA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P21630 1.31e-34 126 33 3 234 3 braG High-affinity branched-chain amino acid transport ATP-binding protein BraG Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
O31339 1.49e-34 129 30 4 230 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bacillus cereus (strain ATCC 10987 / NRS 248)
Q9I6L0 3.36e-34 128 31 5 242 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8E8K8 4.62e-34 128 30 3 232 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q8U4K3 4.86e-34 128 35 5 222 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q9KHT9 6.3e-34 129 32 5 222 1 opuCA Carnitine transport ATP-binding protein OpuCA Listeria monocytogenes
G2JZ44 6.3e-34 129 32 5 222 1 opuCA Carnitine transport ATP-binding protein OpuCA Listeria monocytogenes serotype 1/2a (strain 10403S)
Q8UH62 6.64e-34 127 30 3 236 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
P54537 6.88e-34 125 29 3 231 1 artM Arginine transport ATP-binding protein ArtM Bacillus subtilis (strain 168)
Q6HP89 8.29e-34 127 33 5 235 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q81ZF5 8.38e-34 127 34 5 223 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus anthracis
Q2SVP3 8.4e-34 126 34 2 228 3 nodI Nod factor export ATP-binding protein I Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q9TKX3 9.85e-34 127 31 3 221 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nephroselmis olivacea
Q92XW1 2.67e-33 126 33 3 231 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Rhizobium meliloti (strain 1021)
Q92AF9 3.03e-33 123 30 3 231 3 mntB Manganese transport system ATP-binding protein MntB Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q73EL7 3.53e-33 125 32 5 235 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q92VJ2 3.96e-33 126 33 3 221 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Rhizobium meliloti (strain 1021)
Q8F6Z1 5e-33 125 29 4 236 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72PE5 5e-33 125 29 4 236 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q9JUX4 5.83e-33 125 31 5 240 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q63GR8 5.97e-33 125 32 5 235 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus cereus (strain ZK / E33L)
Q8DIA0 7.41e-33 124 31 3 225 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q9JZW0 8.96e-33 125 31 5 240 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
P56344 1.09e-32 122 31 4 224 3 cysA Probable sulfate/thiosulfate import ATP-binding protein CysA Chlorella vulgaris
Q8PC11 1.11e-32 124 31 4 232 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
P63354 1.45e-32 124 32 3 228 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Brucella suis biovar 1 (strain 1330)
P63353 1.45e-32 124 32 3 228 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
P32010 1.53e-32 124 34 2 214 1 drrA Daunorubicin/doxorubicin resistance ATP-binding protein DrrA Streptomyces peucetius
Q7NIW1 1.55e-32 124 32 4 232 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q9PDN2 1.57e-32 124 29 3 231 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xylella fastidiosa (strain 9a5c)
Q3JSQ0 1.72e-32 123 34 2 228 3 nodI Nod factor export ATP-binding protein I Burkholderia pseudomallei (strain 1710b)
Q62K72 1.72e-32 123 34 2 228 3 nodI Nod factor export ATP-binding protein I Burkholderia mallei (strain ATCC 23344)
Q63TX3 1.89e-32 123 34 2 228 3 nodI Nod factor export ATP-binding protein I Burkholderia pseudomallei (strain K96243)
Q81IN8 2.01e-32 123 32 5 235 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q8D653 2.03e-32 124 29 3 235 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Vibrio vulnificus (strain CMCP6)
Q1BWI2 2.26e-32 122 33 2 228 3 nodI Nod factor export ATP-binding protein I Burkholderia orbicola (strain AU 1054)
Q7NX01 2.94e-32 123 32 4 234 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
C0SPB4 3.61e-32 122 29 3 224 3 yhaQ Uncharacterized ABC transporter ATP-binding protein YhaQ Bacillus subtilis (strain 168)
Q609Q1 3.97e-32 123 32 4 224 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q81GC1 5.08e-32 122 30 4 231 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q58663 5.99e-32 120 31 4 254 1 livG Probable branched-chain amino acid transport ATP-binding protein LivG Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P33360 6.15e-32 121 31 5 233 1 yehX Glycine betaine uptake system ATP-binding protein YehX Escherichia coli (strain K12)
Q98K23 6.33e-32 122 32 3 228 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q63TY1 6.71e-32 122 30 4 244 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Burkholderia pseudomallei (strain K96243)
Q62K82 6.71e-32 122 30 4 244 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Burkholderia mallei (strain ATCC 23344)
Q5JEB0 7e-32 122 34 4 223 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
Q5YZY9 8.52e-32 122 32 6 243 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nocardia farcinica (strain IFM 10152)
Q5FA19 8.59e-32 122 33 5 244 1 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q6D201 9.28e-32 121 29 5 241 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q7W9U5 9.67e-32 122 31 5 231 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q8Y651 9.87e-32 119 29 5 232 3 mntB Manganese transport system ATP-binding protein MntB Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q87DT9 1.01e-31 122 29 3 231 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q58762 1.07e-31 120 36 8 240 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q7VZE5 1.16e-31 122 31 5 231 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7WGW1 1.17e-31 122 31 5 231 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
O28882 1.33e-31 119 29 4 236 3 livF Probable branched-chain amino acid transport ATP-binding protein LivF Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
P54954 1.42e-31 119 29 2 236 1 yxeO Probable amino-acid import ATP-binding protein YxeO Bacillus subtilis (strain 168)
Q89UD2 1.47e-31 121 30 4 239 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
P74548 1.57e-31 121 32 3 219 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P23703 1.6e-31 121 32 4 237 3 nodI Nod factor export ATP-binding protein I Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
O34977 1.75e-31 118 28 3 222 3 ythP Uncharacterized ABC transporter ATP-binding protein YthP Bacillus subtilis (strain 168)
Q39GT7 2.2e-31 120 32 2 228 3 nodI Nod factor export ATP-binding protein I Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q9K876 2.6e-31 121 30 4 230 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q8XXY9 2.61e-31 120 34 3 226 3 nodI Nod factor export ATP-binding protein I Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q88CL2 2.65e-31 120 30 5 240 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q8PNN4 2.7e-31 120 30 3 231 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xanthomonas axonopodis pv. citri (strain 306)
Q82WT5 4.04e-31 120 31 5 231 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q63E84 4.31e-31 120 29 4 231 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ZK / E33L)
Q73BM0 4.31e-31 120 29 4 231 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ATCC 10987 / NRS 248)
A0RBB0 4.31e-31 120 29 4 231 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus thuringiensis (strain Al Hakam)
Q6HLQ9 4.36e-31 120 29 4 231 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus thuringiensis subsp. konkukian (strain 97-27)
P11160 4.36e-31 112 79 0 68 3 lptB Lipopolysaccharide export system ATP-binding protein LptB (Fragment) Klebsiella oxytoca
Q9KUI0 4.44e-31 120 29 4 231 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q897I2 5.43e-31 121 31 5 229 3 CTC_00753 Putative ABC transporter ATP-binding protein CTC_00753 Clostridium tetani (strain Massachusetts / E88)
Q897I2 8.25e-12 67 28 2 121 3 CTC_00753 Putative ABC transporter ATP-binding protein CTC_00753 Clostridium tetani (strain Massachusetts / E88)
P55662 5.5e-31 118 30 3 238 3 NGR_a01510 Probable amino-acid ABC transporter ATP-binding protein y4tH Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q9MUN1 5.63e-31 120 29 3 227 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mesostigma viride
Q9G4F5 6.47e-31 120 28 3 230 3 CYSA Sulfate/thiosulfate import ATP-binding protein cysA Cucumis sativus
Q6D2F6 7.13e-31 119 29 7 239 3 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q8KLG1 7.2e-31 119 33 3 227 3 nodI Nod factor export ATP-binding protein I Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q8NQU4 7.21e-31 117 29 4 241 1 argV Arginine transport ATP-binding protein ArgV Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
P55476 7.51e-31 119 32 3 223 3 nodI Nod factor export ATP-binding protein I Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q81TH8 8.34e-31 119 29 4 231 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus anthracis
Q4QP85 1.12e-30 119 33 5 227 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Haemophilus influenzae (strain 86-028NP)
Q8XZP8 1.13e-30 119 30 4 230 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q1QE80 1.38e-30 120 31 3 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
P44513 2.1e-30 118 33 5 227 1 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
O57896 2.18e-30 118 31 5 240 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q4W575 2.85e-30 118 33 5 244 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9JVH1 2.85e-30 118 33 5 244 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
P96605 3.23e-30 117 31 4 215 3 ydbJ Uncharacterized ABC transporter ATP-binding protein YdbJ Bacillus subtilis (strain 168)
Q66D26 3.81e-30 116 29 5 253 3 phnC Phosphonates import ATP-binding protein PhnC Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CFV9 3.81e-30 116 29 5 253 3 phnC Phosphonates import ATP-binding protein PhnC Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZGU5 3.81e-30 116 29 5 253 3 phnC Phosphonates import ATP-binding protein PhnC Yersinia pestis
Q1C9L0 3.81e-30 116 29 5 253 3 phnC Phosphonates import ATP-binding protein PhnC Yersinia pestis bv. Antiqua (strain Antiqua)
Q73XU8 4.36e-30 117 32 4 225 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
P37774 4.57e-30 115 29 1 240 1 tcyN L-cystine transport system ATP-binding protein TcyN Escherichia coli (strain K12)
P72335 4.74e-30 116 33 2 215 3 nodI Nod factor export ATP-binding protein I Rhizobium sp. (strain N33)
Q18C09 5.17e-30 117 30 5 240 3 metN Methionine import ATP-binding protein MetN Clostridioides difficile (strain 630)
Q1LKJ2 5.98e-30 116 32 3 230 3 nodI Nod factor export ATP-binding protein I Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q13ZJ1 6.92e-30 116 33 2 227 3 nodI Nod factor export ATP-binding protein I Paraburkholderia xenovorans (strain LB400)
Q58429 9.76e-30 114 28 3 225 3 MJ1023 Uncharacterized ABC transporter ATP-binding protein MJ1023 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q4KC87 1.11e-29 116 30 6 239 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q8ZPK4 1.28e-29 117 32 7 237 1 osmV Osmoprotectant import ATP-binding protein OsmV Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8RQL7 1.36e-29 114 30 6 244 3 gluA Glutamate transport ATP-binding protein GluA Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q97KS6 1.49e-29 116 31 4 229 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
P9WQM1 1.49e-29 116 32 4 218 1 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQM0 1.49e-29 116 32 4 218 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A4W3 1.49e-29 116 32 4 218 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P31134 2.07e-29 116 33 4 223 1 potG Putrescine transport ATP-binding protein PotG Escherichia coli (strain K12)
Q0A9E2 2.1e-29 114 32 3 220 3 znuC Zinc import ATP-binding protein ZnuC Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
P45022 2.12e-29 114 29 4 242 3 HI_1078 Probable amino-acid ABC transporter ATP-binding protein HI_1078 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q6NBT1 2.22e-29 115 30 5 223 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q97UY8 2.31e-29 115 28 5 235 1 glcV Glucose import ATP-binding protein GlcV Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q8EBC3 2.53e-29 116 29 4 219 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
P41234 2.66e-29 119 33 6 236 1 Abca2 ATP-binding cassette sub-family A member 2 Mus musculus
P41234 4.62e-25 106 32 3 224 1 Abca2 ATP-binding cassette sub-family A member 2 Mus musculus
Q1B677 2.89e-29 115 34 5 219 3 metN Methionine import ATP-binding protein MetN Mycobacterium sp. (strain MCS)
P46903 2.93e-29 113 32 2 213 1 natA ABC transporter ATP-binding protein NatA Bacillus subtilis (strain 168)
Q6F0V4 3.3e-29 115 31 4 228 3 potA Spermidine/putrescine import ATP-binding protein PotA Mesoplasma florum (strain ATCC 33453 / NBRC 100688 / NCTC 11704 / L1)
Q9Z3I3 4.66e-29 114 31 2 216 3 nodI Nod factor export ATP-binding protein I Bradyrhizobium sp. (strain SNU001)
A0A0H2ZLL3 8.38e-29 112 31 5 222 3 egtUA Probable ergothioneine transport ATP-binding protein EgtUA Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q2SB47 8.55e-29 112 29 3 226 3 hmuV Hemin import ATP-binding protein HmuV Hahella chejuensis (strain KCTC 2396)
Q9BZC7 8.71e-29 117 33 6 236 1 ABCA2 ATP-binding cassette sub-family A member 2 Homo sapiens
Q9BZC7 1.1e-25 108 32 3 224 1 ABCA2 ATP-binding cassette sub-family A member 2 Homo sapiens
Q8GNH6 9.01e-29 114 31 4 236 3 nodI Nod factor export ATP-binding protein I Rhizobium meliloti
O52618 1.02e-28 114 31 4 241 3 nodI Nod factor export ATP-binding protein I Rhizobium meliloti (strain 1021)
O07016 1.36e-28 112 29 4 242 3 yvfR Uncharacterized ABC transporter ATP-binding protein YvfR Bacillus subtilis (strain 168)
Q9ESR9 1.45e-28 117 33 6 236 1 Abca2 ATP-binding cassette sub-family A member 2 Rattus norvegicus
Q9ESR9 1.02e-25 108 33 3 224 1 Abca2 ATP-binding cassette sub-family A member 2 Rattus norvegicus
P45171 2.06e-28 113 29 3 217 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9HT73 2.15e-28 111 32 5 219 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02DK9 2.15e-28 111 32 5 219 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas aeruginosa (strain UCBPP-PA14)
Q8L1U3 2.39e-28 111 30 3 239 1 hmuV Hemin import ATP-binding protein HmuV Bordetella avium
Q2KUC0 2.39e-28 111 30 3 239 3 hmuV Hemin import ATP-binding protein HmuV Bordetella avium (strain 197N)
Q9KN37 2.4e-28 115 29 1 220 3 rbsA Ribose import ATP-binding protein RbsA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9KN37 1.15e-15 79 25 4 205 3 rbsA Ribose import ATP-binding protein RbsA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q4QK57 2.56e-28 113 29 3 217 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus influenzae (strain 86-028NP)
Q2IYS5 2.57e-28 111 33 6 239 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Rhodopseudomonas palustris (strain HaA2)
P44662 2.58e-28 112 30 5 232 3 HI_0361 Probable iron transport system ATP-binding protein HI_0361 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q3IQI3 3.26e-28 111 32 4 234 3 pstB2 Phosphate import ATP-binding protein PstB 2 Natronomonas pharaonis (strain ATCC 35678 / DSM 2160 / CIP 103997 / JCM 8858 / NBRC 14720 / NCIMB 2260 / Gabara)
Q9KS33 3.38e-28 113 28 3 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P0A9U2 3.55e-28 115 32 5 229 3 ybhF Probable multidrug ABC transporter ATP-binding protein YbhF Shigella flexneri
P0A9U2 2.4e-25 107 28 6 238 3 ybhF Probable multidrug ABC transporter ATP-binding protein YbhF Shigella flexneri
P0A9U1 3.55e-28 115 32 5 229 1 ybhF Probable multidrug ABC transporter ATP-binding protein YbhF Escherichia coli (strain K12)
P0A9U1 2.4e-25 107 28 6 238 1 ybhF Probable multidrug ABC transporter ATP-binding protein YbhF Escherichia coli (strain K12)
Q6F9A8 3.67e-28 112 27 4 244 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q1CFH7 4.14e-28 112 30 7 240 3 metN2 Methionine import ATP-binding protein MetN 2 Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZH38 4.14e-28 112 30 7 240 3 metN1 Methionine import ATP-binding protein MetN 1 Yersinia pestis
Q1CAK4 4.14e-28 112 30 7 240 3 metN1 Methionine import ATP-binding protein MetN 1 Yersinia pestis bv. Antiqua (strain Antiqua)
Q9A7X1 4.35e-28 112 30 4 226 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q0I5E9 4.79e-28 112 29 3 217 3 metN Methionine import ATP-binding protein MetN Histophilus somni (strain 129Pt)
Q9CP06 5.38e-28 112 28 5 234 3 potA Spermidine/putrescine import ATP-binding protein PotA Pasteurella multocida (strain Pm70)
O34338 5.99e-28 109 30 6 237 2 mntB Manganese transport system ATP-binding protein MntB Bacillus subtilis (strain 168)
Q3KKA1 6.5e-28 110 32 5 218 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas fluorescens (strain Pf0-1)
Q2SJ99 6.68e-28 114 29 1 217 3 rbsA Ribose import ATP-binding protein RbsA Hahella chejuensis (strain KCTC 2396)
Q2SJ99 2.17e-14 75 26 4 216 3 rbsA Ribose import ATP-binding protein RbsA Hahella chejuensis (strain KCTC 2396)
A1TXH7 7.19e-28 112 29 4 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q664P8 7.67e-28 109 29 5 219 3 tauB Taurine import ATP-binding protein TauB Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CCR9 8.08e-28 109 29 5 219 3 tauB Taurine import ATP-binding protein TauB Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZJD0 8.08e-28 109 29 5 219 3 tauB Taurine import ATP-binding protein TauB Yersinia pestis
Q1C2S1 8.08e-28 109 29 5 219 3 tauB Taurine import ATP-binding protein TauB Yersinia pestis bv. Antiqua (strain Antiqua)
Q57TF5 8.4e-28 108 31 3 215 3 thiQ Thiamine import ATP-binding protein ThiQ Salmonella choleraesuis (strain SC-B67)
Q8NY21 9.37e-28 111 26 4 226 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain MW2)
Q6GC27 9.37e-28 111 26 4 226 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain MSSA476)
P26050 9.53e-28 110 31 3 219 3 nodI Nod factor export ATP-binding protein I Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q3MAR5 9.77e-28 112 30 5 220 3 potA Spermidine/putrescine import ATP-binding protein PotA Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q5PDF8 9.95e-28 108 31 3 215 3 thiQ Thiamine import ATP-binding protein ThiQ Salmonella paratyphi A (strain ATCC 9150 / SARB42)
P54592 1.11e-27 110 29 3 214 3 yhcH Uncharacterized ABC transporter ATP-binding protein YhcH Bacillus subtilis (strain 168)
Q8FRX8 1.11e-27 111 28 3 215 3 metN Methionine import ATP-binding protein MetN Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q3A9G5 1.14e-27 110 30 4 225 3 metN Methionine import ATP-binding protein MetN Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
A0LCH8 1.21e-27 109 30 6 232 3 znuC Zinc import ATP-binding protein ZnuC Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
Q9X196 1.21e-27 111 28 3 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q8Z9I6 1.4e-27 108 31 3 215 3 thiQ Thiamine import ATP-binding protein ThiQ Salmonella typhi
Q8YM92 1.58e-27 111 30 5 220 3 potA Spermidine/putrescine import ATP-binding protein PotA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
P94374 1.65e-27 109 29 4 219 2 yxlF Uncharacterized ABC transporter ATP-binding protein YxlF Bacillus subtilis (strain 168)
Q8NSN2 1.68e-27 110 27 3 216 3 metN Methionine import ATP-binding protein MetN Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q93KD4 1.86e-27 107 32 4 214 1 tupC Tungstate uptake system ATP-binding protein TupC Peptoclostridium acidaminophilum
Q0SRL2 1.9e-27 110 29 4 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain SM101 / Type A)
Q6GJL2 1.93e-27 110 26 4 227 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain MRSA252)
Q5E586 1.98e-27 110 28 6 238 3 potA Spermidine/putrescine import ATP-binding protein PotA Aliivibrio fischeri (strain ATCC 700601 / ES114)
O27739 2.08e-27 109 32 4 228 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
Q2SSS4 2.13e-27 110 29 4 228 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma capricolum subsp. capricolum (strain California kid / ATCC 27343 / NCTC 10154)
Q9CK97 2.14e-27 110 29 6 233 3 metN Methionine import ATP-binding protein MetN Pasteurella multocida (strain Pm70)
Q8XNY7 2.46e-27 108 28 4 227 3 CPE0195 Putative ABC transporter ATP-binding protein CPE0195 Clostridium perfringens (strain 13 / Type A)
Q9V2C0 2.74e-27 110 30 4 225 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Pyrococcus abyssi (strain GE5 / Orsay)
Q6WB63 2.82e-27 108 32 6 243 3 phnC Phosphonates import ATP-binding protein PhnC Alcaligenes faecalis
Q0TUN8 2.91e-27 108 28 4 227 1 ecfA3 Energy-coupling factor transporter ATP-binding protein EcfA3 Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q5HIL5 2.99e-27 110 26 4 226 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain COL)
Q2G0V2 2.99e-27 110 26 4 226 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FJI0 2.99e-27 110 26 4 226 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain USA300)
Q3IM24 3.02e-27 108 30 5 233 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Natronomonas pharaonis (strain ATCC 35678 / DSM 2160 / CIP 103997 / JCM 8858 / NBRC 14720 / NCIMB 2260 / Gabara)
Q2YVT7 3.11e-27 110 26 4 227 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q6MU19 3.21e-27 110 29 4 228 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma mycoides subsp. mycoides SC (strain CCUG 32753 / NCTC 10114 / PG1)
Q3YUN6 3.32e-27 108 30 6 249 3 phnC Phosphonates import ATP-binding protein PhnC Shigella sonnei (strain Ss046)
Q65UE1 3.35e-27 110 28 4 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q8XIZ5 3.39e-27 110 28 4 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain 13 / Type A)
Q0TNZ3 3.39e-27 110 28 4 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
P44785 3.42e-27 110 28 3 221 3 metN Methionine import ATP-binding protein MetN Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q7VM95 3.47e-27 109 28 5 234 3 metN Methionine import ATP-binding protein MetN Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q8ZRV2 3.54e-27 107 31 3 215 1 thiQ Thiamine import ATP-binding protein ThiQ Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q831K6 4.76e-27 109 30 4 238 1 metN2 Methionine import ATP-binding protein MetN 2 Enterococcus faecalis (strain ATCC 700802 / V583)
P50332 4.76e-27 109 33 3 218 3 nodI Nod factor export ATP-binding protein I Neorhizobium galegae
Q7A7E3 4.96e-27 109 27 5 229 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain N315)
Q99WE1 4.96e-27 109 27 5 229 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q0T9T7 5.22e-27 107 30 6 249 3 phnC Phosphonates import ATP-binding protein PhnC Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q2JLH7 5.32e-27 107 32 5 238 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Synechococcus sp. (strain JA-2-3B'a(2-13))
Q50801 5.45e-27 108 29 3 225 3 MTBMA_c05830 Putative ABC transporter ATP-binding protein MTBMA_c05830 Methanothermobacter marburgensis (strain ATCC BAA-927 / DSM 2133 / JCM 14651 / NBRC 100331 / OCM 82 / Marburg)
A1TAI4 5.78e-27 109 29 4 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
Q667L9 5.79e-27 109 30 7 240 3 metN2 Methionine import ATP-binding protein MetN 2 Yersinia pseudotuberculosis serotype I (strain IP32953)
Q4JTG9 5.79e-27 109 29 5 230 3 metN Methionine import ATP-binding protein MetN Corynebacterium jeikeium (strain K411)
Q16BC5 6.11e-27 107 31 6 242 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q0AGF4 6.23e-27 109 29 3 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q65T42 6.42e-27 109 27 4 229 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q7W359 6.86e-27 107 28 4 242 3 hmuV Hemin import ATP-binding protein HmuV Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
P45092 7.25e-27 107 30 3 232 3 artP Arginine transport ATP-binding protein ArtP Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P39456 8.43e-27 106 27 3 236 1 tcyC L-cystine import ATP-binding protein TcyC Bacillus subtilis (strain 168)
Q5KVK2 8.44e-27 108 30 4 227 3 metN Methionine import ATP-binding protein MetN Geobacillus kaustophilus (strain HTA426)
Q8RGC8 8.82e-27 109 29 3 215 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q7NQN5 9.22e-27 108 30 5 242 3 potA Spermidine/putrescine import ATP-binding protein PotA Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
P15031 9.3e-27 107 28 3 241 1 fecE Fe(3+) dicitrate transport ATP-binding protein FecE Escherichia coli (strain K12)
Q7W025 9.4e-27 107 28 4 242 3 hmuV Hemin import ATP-binding protein HmuV Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q4QMH4 9.8e-27 108 28 3 217 3 metN Methionine import ATP-binding protein MetN Haemophilus influenzae (strain 86-028NP)
Q4KKK4 1.14e-26 106 31 5 218 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q5SSE9 1.15e-26 111 32 5 226 1 Abca13 ATP-binding cassette sub-family A member 13 Mus musculus
Q5SSE9 4.74e-23 100 28 6 235 1 Abca13 ATP-binding cassette sub-family A member 13 Mus musculus
Q5UW69 1.17e-26 107 30 7 247 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
Q0SWH9 1.17e-26 107 28 4 227 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Clostridium perfringens (strain SM101 / Type A)
P48243 1.23e-26 106 29 6 244 1 gluA Glutamate transport ATP-binding protein GluA Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
A1WXT0 1.29e-26 106 31 4 229 3 znuC Zinc import ATP-binding protein ZnuC Halorhodospira halophila (strain DSM 244 / SL1)
Q7WEH6 1.32e-26 106 28 4 242 3 hmuV Hemin import ATP-binding protein HmuV Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q891M1 1.36e-26 110 27 1 214 3 rbsA Ribose import ATP-binding protein RbsA Clostridium tetani (strain Massachusetts / E88)
Q891M1 8.11e-17 82 24 5 221 3 rbsA Ribose import ATP-binding protein RbsA Clostridium tetani (strain Massachusetts / E88)
Q7MFC4 1.37e-26 108 28 3 222 3 malK Maltose/maltodextrin import ATP-binding protein MalK Vibrio vulnificus (strain YJ016)
Q8D3V0 1.37e-26 108 28 3 222 3 malK Maltose/maltodextrin import ATP-binding protein MalK Vibrio vulnificus (strain CMCP6)
Q2K8C8 1.54e-26 108 30 3 222 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q81CT8 1.61e-26 110 31 5 238 3 BC_2655 Putative ABC transporter ATP-binding protein BC_2655 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q81CT8 1.06e-16 82 23 4 233 3 BC_2655 Putative ABC transporter ATP-binding protein BC_2655 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q0I3Y9 1.74e-26 108 28 3 217 3 potA Spermidine/putrescine import ATP-binding protein PotA Histophilus somni (strain 129Pt)
Q8D7T7 1.75e-26 110 29 1 220 3 rbsA Ribose import ATP-binding protein RbsA Vibrio vulnificus (strain CMCP6)
Q8D7T7 1.7e-17 84 26 4 205 3 rbsA Ribose import ATP-binding protein RbsA Vibrio vulnificus (strain CMCP6)
Q8FUU5 1.77e-26 107 34 6 222 3 znuC Zinc import ATP-binding protein ZnuC Brucella suis biovar 1 (strain 1330)
Q31I51 1.77e-26 106 27 7 242 3 znuC Zinc import ATP-binding protein ZnuC Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q4ZZS2 1.78e-26 106 32 6 219 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas syringae pv. syringae (strain B728a)
D4GSY7 1.81e-26 107 29 4 245 3 HVO_1886 Probable anion import ATP-binding protein HVO_1886 Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
Q65VG9 1.82e-26 107 27 3 223 3 metN Methionine import ATP-binding protein MetN Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q326G9 1.95e-26 105 30 3 215 3 thiQ Thiamine import ATP-binding protein ThiQ Shigella boydii serotype 4 (strain Sb227)
Q83P97 2e-26 106 30 6 249 3 phnC Phosphonates import ATP-binding protein PhnC Shigella flexneri
Q0SXV5 2e-26 106 30 6 249 3 phnC Phosphonates import ATP-binding protein PhnC Shigella flexneri serotype 5b (strain 8401)
Q7CS28 2.03e-26 108 29 5 240 1 smoE Sulfoquinovosyl glycerol transport ATP-binding protein SmoE Agrobacterium fabrum (strain C58 / ATCC 33970)
Q881U6 2.05e-26 105 31 4 213 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q8U6M1 2.09e-26 107 30 3 215 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Agrobacterium fabrum (strain C58 / ATCC 33970)
Q0T8D1 2.21e-26 105 30 3 215 3 thiQ Thiamine import ATP-binding protein ThiQ Shigella flexneri serotype 5b (strain 8401)
Q6LX68 2.31e-26 106 29 5 238 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Methanococcus maripaludis (strain DSM 14266 / JCM 13030 / NBRC 101832 / S2 / LL)
A3DDF6 2.48e-26 107 29 4 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
P22040 2.56e-26 107 27 3 222 3 sll0415 Uncharacterized ABC transporter ATP-binding protein sll0415 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q5WJP0 2.64e-26 107 31 6 240 3 metN2 Methionine import ATP-binding protein MetN 2 Shouchella clausii (strain KSM-K16)
Q8XDV7 2.66e-26 105 29 6 253 3 phnC Phosphonates import ATP-binding protein PhnC Escherichia coli O157:H7
P10346 2.67e-26 105 28 3 227 1 glnQ Glutamine transport ATP-binding protein GlnQ Escherichia coli (strain K12)
Q7MEV1 2.73e-26 109 29 1 220 3 rbsA Ribose import ATP-binding protein RbsA Vibrio vulnificus (strain YJ016)
Q7MEV1 2.12e-17 84 26 4 205 3 rbsA Ribose import ATP-binding protein RbsA Vibrio vulnificus (strain YJ016)
Q5WKL3 2.73e-26 107 29 3 214 3 metN1 Methionine import ATP-binding protein MetN 1 Shouchella clausii (strain KSM-K16)
Q97KD5 2.73e-26 107 30 4 223 3 metN Methionine import ATP-binding protein MetN Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q5LX21 2.74e-26 107 30 3 222 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q21UI2 2.91e-26 107 32 4 213 3 modC Molybdenum import ATP-binding protein ModC Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q0TLS2 3.2e-26 104 29 3 215 3 thiQ Thiamine import ATP-binding protein ThiQ Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q8FL82 3.3e-26 104 29 3 215 3 thiQ Thiamine import ATP-binding protein ThiQ Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
O85818 3.32e-26 107 28 4 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Aggregatibacter actinomycetemcomitans
Q1RGD0 3.37e-26 104 29 3 215 3 thiQ Thiamine import ATP-binding protein ThiQ Escherichia coli (strain UTI89 / UPEC)
Q5HV18 3.65e-26 107 28 4 250 3 metN Methionine import ATP-binding protein MetN Campylobacter jejuni (strain RM1221)
Q0PAB6 3.65e-26 107 28 4 250 3 metN Methionine import ATP-binding protein MetN Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q1B8V9 3.68e-26 107 29 5 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycobacterium sp. (strain MCS)
A1UG51 3.68e-26 107 29 5 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycobacterium sp. (strain KMS)
Q1M7W6 3.7e-26 106 30 3 224 3 nodI Nod factor export ATP-binding protein I Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
O35600 3.9e-26 110 30 4 228 1 Abca4 Retinal-specific phospholipid-transporting ATPase ABCA4 Mus musculus
O35600 2.21e-20 93 31 3 219 1 Abca4 Retinal-specific phospholipid-transporting ATPase ABCA4 Mus musculus
Q3Z5U5 3.99e-26 104 29 3 215 3 thiQ Thiamine import ATP-binding protein ThiQ Shigella sonnei (strain Ss046)
Q60350 4.01e-26 105 30 4 218 3 MJ0035 Uncharacterized ABC transporter ATP-binding protein MJ0035 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P16677 4.26e-26 105 30 6 249 3 phnC Phosphonates import ATP-binding protein PhnC Escherichia coli (strain K12)
Q07PZ0 4.41e-26 105 32 6 244 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Rhodopseudomonas palustris (strain BisA53)
Q11B53 4.43e-26 105 34 5 223 3 znuC Zinc import ATP-binding protein ZnuC Chelativorans sp. (strain BNC1)
Q7MKU3 4.44e-26 107 28 3 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio vulnificus (strain YJ016)
Q8D9J4 4.44e-26 107 28 3 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio vulnificus (strain CMCP6)
Q0SSJ0 4.44e-26 108 26 1 226 3 rbsA Ribose import ATP-binding protein RbsA Clostridium perfringens (strain SM101 / Type A)
Q0SSJ0 8.15e-14 73 24 5 208 3 rbsA Ribose import ATP-binding protein RbsA Clostridium perfringens (strain SM101 / Type A)
Q576K0 4.51e-26 105 34 6 222 3 znuC Zinc import ATP-binding protein ZnuC Brucella abortus biovar 1 (strain 9-941)
Q2YJH4 4.51e-26 105 34 6 222 3 znuC Zinc import ATP-binding protein ZnuC Brucella abortus (strain 2308)
A0LUE6 4.84e-26 107 31 5 233 3 potA Spermidine/putrescine import ATP-binding protein PotA Acidothermus cellulolyticus (strain ATCC 43068 / DSM 8971 / 11B)
Q32K28 5.03e-26 104 29 3 215 3 thiQ Thiamine import ATP-binding protein ThiQ Shigella dysenteriae serotype 1 (strain Sd197)
F1MWM0 5.19e-26 109 29 5 234 1 ABCA4 Retinal-specific phospholipid-transporting ATPase ABCA4 Bos taurus
F1MWM0 1.37e-19 90 30 3 219 1 ABCA4 Retinal-specific phospholipid-transporting ATPase ABCA4 Bos taurus
Q3KCC5 5.21e-26 107 27 8 247 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Pseudomonas fluorescens (strain Pf0-1)
O86311 5.33e-26 106 28 5 233 1 Rv1218c Multidrug efflux system ATP-binding protein Rv1218c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q325U1 5.54e-26 106 29 6 234 3 metN Methionine import ATP-binding protein MetN Shigella boydii serotype 4 (strain Sb227)
Q0TPX5 5.62e-26 108 26 1 226 3 rbsA Ribose import ATP-binding protein RbsA Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q0TPX5 3.87e-14 74 23 4 207 3 rbsA Ribose import ATP-binding protein RbsA Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q14Q07 5.78e-26 106 28 5 228 3 potA Spermidine/putrescine import ATP-binding protein PotA Spiroplasma citri
Q92WJ0 5.91e-26 106 30 3 218 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Rhizobium meliloti (strain 1021)
Q31TP8 6.28e-26 104 30 6 249 3 phnC Phosphonates import ATP-binding protein PhnC Shigella boydii serotype 4 (strain Sb227)
O68106 6.49e-26 105 30 7 243 1 cbiO Cobalt import ATP-binding protein CbiO Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
Q82TL6 6.62e-26 106 29 3 228 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
P27675 6.69e-26 104 27 5 240 2 glnQ Glutamine transport ATP-binding protein GlnQ Geobacillus stearothermophilus
Q88ZJ6 6.92e-26 106 28 5 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
P78363 7.76e-26 108 30 4 209 1 ABCA4 Retinal-specific phospholipid-transporting ATPase ABCA4 Homo sapiens
P78363 3.75e-20 92 30 3 215 1 ABCA4 Retinal-specific phospholipid-transporting ATPase ABCA4 Homo sapiens
Q8CUY0 8.02e-26 104 29 8 248 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q24QI5 8.42e-26 106 29 4 228 3 metN Methionine import ATP-binding protein MetN Desulfitobacterium hafniense (strain Y51)
Q9KIF7 8.43e-26 107 29 3 213 3 opuAA Glycine betaine transport ATP-binding protein OpuAA Lactococcus lactis subsp. lactis (strain IL1403)
Q9KL04 8.43e-26 106 27 3 234 3 malK Maltose/maltodextrin import ATP-binding protein MalK Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q8FAV1 8.88e-26 104 30 6 249 3 phnC Phosphonates import ATP-binding protein PhnC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8XJX3 9.03e-26 107 26 1 226 3 rbsA Ribose import ATP-binding protein RbsA Clostridium perfringens (strain 13 / Type A)
Q8XJX3 1.61e-14 75 24 5 208 3 rbsA Ribose import ATP-binding protein RbsA Clostridium perfringens (strain 13 / Type A)
Q32JQ8 9.27e-26 105 29 6 234 3 metN Methionine import ATP-binding protein MetN Shigella dysenteriae serotype 1 (strain Sd197)
Q50966 9.35e-26 106 31 6 248 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria gonorrhoeae
Q8XA06 9.68e-26 103 30 3 215 3 thiQ Thiamine import ATP-binding protein ThiQ Escherichia coli O157:H7
P21410 9.75e-26 105 29 5 230 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Serratia marcescens
Q83MG3 9.88e-26 103 30 3 207 3 thiQ Thiamine import ATP-binding protein ThiQ Shigella flexneri
Q1PEH6 9.95e-26 108 30 5 229 2 ABCA3 ABC transporter A family member 3 Arabidopsis thaliana
P30750 9.96e-26 105 29 6 234 1 metN Methionine import ATP-binding protein MetN Escherichia coli (strain K12)
Q87PH3 1.03e-25 106 28 3 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
P9WQL3 1.04e-25 106 30 5 221 1 modC Molybdenum import ATP-binding protein ModC Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQL2 1.04e-25 106 30 5 221 3 modC Molybdenum import ATP-binding protein ModC Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q9KLQ5 1.07e-25 105 28 3 217 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q1WVI7 1.15e-25 106 27 3 211 3 potA Spermidine/putrescine import ATP-binding protein PotA Ligilactobacillus salivarius (strain UCC118)
Q8X5I6 1.22e-25 103 32 4 211 3 tauB Taurine import ATP-binding protein TauB Escherichia coli O157:H7
Q6LKD4 1.28e-25 105 27 3 218 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Photobacterium profundum (strain SS9)
Q110U3 1.28e-25 106 28 4 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Trichodesmium erythraeum (strain IMS101)
Q8TI15 1.28e-25 104 32 6 217 3 MA_4342 Putative ABC transporter ATP-binding protein MA_4342 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
A1JRI2 1.31e-25 103 30 5 222 3 znuC Zinc import ATP-binding protein ZnuC Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
P45769 1.31e-25 103 28 4 236 3 yhdZ Uncharacterized amino-acid ABC transporter ATP-binding protein YhdZ Escherichia coli (strain K12)
Q7CN92 1.33e-25 106 26 4 226 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q99ZS8 1.33e-25 106 26 4 226 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M1
Q3Z5F8 1.34e-25 105 29 6 234 3 metN Methionine import ATP-binding protein MetN Shigella sonnei (strain Ss046)
Q1RFY9 1.34e-25 105 29 6 234 3 metN Methionine import ATP-binding protein MetN Escherichia coli (strain UTI89 / UPEC)
P63355 1.34e-25 105 29 6 234 3 metN Methionine import ATP-binding protein MetN Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P63356 1.34e-25 105 29 6 234 3 metN Methionine import ATP-binding protein MetN Escherichia coli O157:H7
O86751 1.36e-25 105 31 4 213 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q0TLD2 1.38e-25 105 29 6 234 3 metN Methionine import ATP-binding protein MetN Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q8Z8W8 1.57e-25 105 31 4 220 3 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella typhi
Q8ENB3 1.57e-25 107 28 1 234 3 rbsA Ribose import ATP-binding protein RbsA Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q8ENB3 5.71e-12 68 21 3 203 3 rbsA Ribose import ATP-binding protein RbsA Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q5PFQ7 1.6e-25 105 31 4 220 3 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella paratyphi A (strain ATCC 9150 / SARB42)
P0DTT6 1.62e-25 103 30 5 229 1 xylG Xylose/arabinose import ATP-binding protein XylG Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770)
Q737I0 1.65e-25 107 31 6 243 3 BCE_2668 Putative ABC transporter ATP-binding protein BCE_2668 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q737I0 6.63e-21 94 26 4 220 3 BCE_2668 Putative ABC transporter ATP-binding protein BCE_2668 Bacillus cereus (strain ATCC 10987 / NRS 248)
O26236 1.66e-25 103 29 2 216 3 MTH_133 Putative ABC transporter ATP-binding protein MTH_133 Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
Q5XDS8 1.73e-25 105 31 4 217 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q5M5Z2 1.73e-25 105 30 5 222 3 metN Methionine import ATP-binding protein MetN Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q5M1F6 1.73e-25 105 30 5 222 3 metN Methionine import ATP-binding protein MetN Streptococcus thermophilus (strain CNRZ 1066)
P0CZ35 1.75e-25 105 26 4 226 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M3 (strain SSI-1)
Q48TP4 1.75e-25 105 26 4 226 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M28 (strain MGAS6180)
P0CZ34 1.75e-25 105 26 4 226 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q5XCA4 1.8e-25 105 26 4 226 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q7N8M2 1.83e-25 105 30 3 201 3 metN Methionine import ATP-binding protein MetN Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q7NWX3 1.85e-25 105 29 3 231 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q1R3F6 1.87e-25 103 30 6 249 3 phnC Phosphonates import ATP-binding protein PhnC Escherichia coli (strain UTI89 / UPEC)
Q832Y6 1.95e-25 105 29 5 217 3 metN1 Methionine import ATP-binding protein MetN 1 Enterococcus faecalis (strain ATCC 700802 / V583)
Q65E55 1.96e-25 107 28 1 209 3 rbsA Ribose import ATP-binding protein RbsA Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q65E55 1.17e-17 84 25 3 213 3 rbsA Ribose import ATP-binding protein RbsA Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
P0AAF9 1.98e-25 103 31 5 214 3 artP Arginine transport ATP-binding protein ArtP Shigella flexneri
P0AAF6 1.98e-25 103 31 5 214 1 artP Arginine transport ATP-binding protein ArtP Escherichia coli (strain K12)
P0AAF7 1.98e-25 103 31 5 214 3 artP Arginine transport ATP-binding protein ArtP Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AAF8 1.98e-25 103 31 5 214 3 artP Arginine transport ATP-binding protein ArtP Escherichia coli O157:H7
Q8WWZ4 2e-25 107 30 4 246 2 ABCA10 ATP-binding cassette sub-family A member 10 Homo sapiens
Q8WWZ4 8.42e-21 94 28 3 214 2 ABCA10 ATP-binding cassette sub-family A member 10 Homo sapiens
O32151 2.06e-25 105 30 3 225 3 yurJ Uncharacterized ABC transporter ATP-binding protein YurJ Bacillus subtilis (strain 168)
Q2K4V4 2.13e-25 105 28 3 228 3 ugpC2 sn-glycerol-3-phosphate import ATP-binding protein UgpC 2 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q7W148 2.17e-25 103 30 7 253 3 phnC Phosphonates import ATP-binding protein PhnC Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q9Z3R9 2.25e-25 105 29 5 226 3 aglK Alpha-glucoside transport ATP-binding protein AglK Rhizobium meliloti (strain 1021)
Q58488 2.32e-25 103 30 5 225 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q1J6Q6 2.37e-25 105 26 4 226 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q1JGY7 2.37e-25 105 26 4 226 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q1JLT7 2.37e-25 105 26 4 226 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1JBV6 2.37e-25 105 26 4 226 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M12 (strain MGAS2096)
Q98G42 2.39e-25 105 30 4 226 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
P0CZ31 2.4e-25 105 30 4 218 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M3 (strain SSI-1)
P0CZ30 2.4e-25 105 30 4 218 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
A0KPH6 2.41e-25 103 30 6 226 3 znuC Zinc import ATP-binding protein ZnuC Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
P96063 2.49e-25 105 31 4 220 2 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P40790 2.54e-25 105 28 6 238 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q57QC8 2.54e-25 105 28 6 238 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella choleraesuis (strain SC-B67)
Q8Z7H7 2.57e-25 105 28 6 238 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella typhi
Q5PMK1 2.6e-25 105 28 6 238 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q8FKF5 2.6e-25 103 31 5 216 3 tauB Taurine import ATP-binding protein TauB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q329I3 2.61e-25 103 29 6 249 3 phnC Phosphonates import ATP-binding protein PhnC Shigella dysenteriae serotype 1 (strain Sd197)
Q5ZUG5 2.65e-25 104 26 3 224 3 metN Methionine import ATP-binding protein MetN Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q48PV0 2.66e-25 103 31 6 219 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q47T99 2.71e-25 105 29 5 234 3 potA Spermidine/putrescine import ATP-binding protein PotA Thermobifida fusca (strain YX)
Q6MCV4 2.73e-25 105 29 4 217 3 potA Spermidine/putrescine import ATP-binding protein PotA Protochlamydia amoebophila (strain UWE25)
Q1JNE0 2.76e-25 105 31 4 217 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1JDG6 2.76e-25 105 31 4 217 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M12 (strain MGAS2096)
P36879 2.89e-25 103 30 4 226 1 yadG Uncharacterized ABC transporter ATP-binding protein YadG Escherichia coli (strain K12)
Q87H79 2.92e-25 106 28 1 220 3 rbsA Ribose import ATP-binding protein RbsA Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q87H79 1.87e-18 87 27 4 205 3 rbsA Ribose import ATP-binding protein RbsA Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q72PP0 3.03e-25 102 30 3 197 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q6D1C4 3.06e-25 104 31 5 217 3 metN3 Methionine import ATP-binding protein MetN 3 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q8F6L8 3.1e-25 102 30 3 197 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q3Z2Z3 3.15e-25 105 28 6 234 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella sonnei (strain Ss046)
Q31ZK0 3.15e-25 105 28 6 234 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella boydii serotype 4 (strain Sb227)
Q66AT7 3.2e-25 102 30 6 224 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pseudotuberculosis serotype I (strain IP32953)
Q70GD4 3.24e-25 103 30 4 237 3 hmuV Hemin import ATP-binding protein HmuV Photobacterium damsela subsp. piscicida
Q5WC31 3.35e-25 106 27 1 215 3 rbsA Ribose import ATP-binding protein RbsA Shouchella clausii (strain KSM-K16)
Q5WC31 4.4e-14 74 26 4 220 3 rbsA Ribose import ATP-binding protein RbsA Shouchella clausii (strain KSM-K16)
Q8RI39 3.4e-25 105 27 4 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q48V78 3.43e-25 104 30 4 218 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M28 (strain MGAS6180)
Q9A1E3 3.43e-25 104 30 4 218 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M1
Q84M24 3.49e-25 107 32 4 229 2 ABCA1 ABC transporter A family member 1 Arabidopsis thaliana
Q84M24 7.11e-20 91 30 5 218 2 ABCA1 ABC transporter A family member 1 Arabidopsis thaliana
Q8RFN2 3.58e-25 104 32 5 227 3 metN Methionine import ATP-binding protein MetN Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q2GFZ6 3.75e-25 102 28 5 236 3 znuC Zinc import ATP-binding protein ZnuC Ehrlichia chaffeensis (strain ATCC CRL-10679 / Arkansas)
Q0BN75 4.01e-25 102 32 3 201 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Francisella tularensis subsp. holarctica (strain OSU18)
Q659V4 4.13e-25 102 30 4 237 3 hmuV Hemin import ATP-binding protein HmuV Photobacterium damselae subsp. damselae
Q87UN0 4.26e-25 102 31 6 219 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q3Z542 4.29e-25 102 31 4 211 3 tauB Taurine import ATP-binding protein TauB Shigella sonnei (strain Ss046)
Q47538 4.29e-25 102 31 4 211 2 tauB Taurine import ATP-binding protein TauB Escherichia coli (strain K12)
Q86UQ4 4.36e-25 107 33 4 211 1 ABCA13 ATP-binding cassette sub-family A member 13 Homo sapiens
Q86UQ4 2.7e-23 101 28 6 240 1 ABCA13 ATP-binding cassette sub-family A member 13 Homo sapiens
Q2SPI3 4.48e-25 102 30 4 214 3 znuC1 Zinc import ATP-binding protein ZnuC 1 Hahella chejuensis (strain KCTC 2396)
Q6LR20 4.53e-25 104 28 3 217 3 potA Spermidine/putrescine import ATP-binding protein PotA Photobacterium profundum (strain SS9)
Q7WID6 4.54e-25 104 29 4 227 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q5WVL8 4.62e-25 103 25 3 224 3 metN Methionine import ATP-binding protein MetN Legionella pneumophila (strain Lens)
P08720 4.64e-25 103 29 3 224 3 nodI Nod factor export ATP-binding protein I Rhizobium leguminosarum bv. viciae
P55453 4.72e-25 103 28 3 213 3 NGR_a03670 Uncharacterized ABC transporter ATP-binding protein y4fO Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q7VYN2 4.93e-25 104 29 4 227 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q92N13 5.05e-25 102 28 4 240 3 hmuV Hemin import ATP-binding protein HmuV Rhizobium meliloti (strain 1021)
Q1MQ44 5.22e-25 104 29 4 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Lawsonia intracellularis (strain PHE/MN1-00)
Q82G23 5.45e-25 102 27 9 247 3 pstB Phosphate import ATP-binding protein PstB Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q32EY4 5.51e-25 104 28 6 234 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella dysenteriae serotype 1 (strain Sd197)
Q57SD6 5.51e-25 104 30 4 220 3 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella choleraesuis (strain SC-B67)
Q1CJG3 5.53e-25 102 29 6 224 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis bv. Antiqua (strain Nepal516)
Q7CIC2 5.53e-25 102 29 6 224 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis
Q1C812 5.53e-25 102 29 6 224 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis bv. Antiqua (strain Antiqua)
Q1J8E4 5.84e-25 103 30 4 217 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q87GB5 5.9e-25 104 26 3 234 3 malK Maltose/maltodextrin import ATP-binding protein MalK Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q2YAD6 6.26e-25 103 29 4 231 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q32IZ6 6.39e-25 102 31 5 216 3 tauB Taurine import ATP-binding protein TauB Shigella dysenteriae serotype 1 (strain Sd197)
P69877 6.42e-25 104 28 6 234 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella flexneri
P69874 6.42e-25 104 28 6 234 1 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli (strain K12)
P69875 6.42e-25 104 28 6 234 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TIU8 6.42e-25 104 28 6 234 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O6:K15:H31 (strain 536 / UPEC)
P69876 6.42e-25 104 28 6 234 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O157:H7
Q325N3 6.46e-25 102 31 4 211 3 tauB Taurine import ATP-binding protein TauB Shigella boydii serotype 4 (strain Sb227)
P42246 6.57e-25 103 27 3 217 3 ycbN Uncharacterized ABC transporter ATP-binding protein YcbN Bacillus subtilis (strain 168)
Q1RD28 6.62e-25 104 28 6 234 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli (strain UTI89 / UPEC)
A1AA20 6.62e-25 104 28 6 234 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O1:K1 / APEC
Q1RFH8 6.95e-25 102 30 5 216 3 tauB Taurine import ATP-binding protein TauB Escherichia coli (strain UTI89 / UPEC)
Q0TKS1 6.95e-25 102 30 5 216 3 tauB Taurine import ATP-binding protein TauB Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q8UCD5 7.48e-25 103 32 6 211 3 modC Molybdenum import ATP-binding protein ModC Agrobacterium fabrum (strain C58 / ATCC 33970)
Q830W6 7.55e-25 103 26 5 228 3 potA Spermidine/putrescine import ATP-binding protein PotA Enterococcus faecalis (strain ATCC 700802 / V583)
P14175 7.68e-25 104 29 3 213 1 proV Glycine betaine/proline betaine transport system ATP-binding protein ProV Escherichia coli (strain K12)
Q1IGY7 8.21e-25 101 29 5 221 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas entomophila (strain L48)
A0PY57 8.23e-25 103 28 4 220 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium novyi (strain NT)
P72297 8.25e-25 102 28 3 228 3 occP Octopine permease ATP-binding protein P Rhizobium meliloti
Q98GF5 8.27e-25 102 31 8 247 3 phnC Phosphonates import ATP-binding protein PhnC Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q2L0H5 8.28e-25 103 29 4 227 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bordetella avium (strain 197N)
Q48IB9 8.32e-25 101 32 5 202 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q8P2K6 8.44e-25 103 30 4 217 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q92UV5 8.72e-25 104 31 5 224 3 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Rhizobium meliloti (strain 1021)
Q7WNT8 8.93e-25 101 29 7 253 3 phnC Phosphonates import ATP-binding protein PhnC Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q5X484 8.99e-25 103 26 4 226 3 metN Methionine import ATP-binding protein MetN Legionella pneumophila (strain Paris)
A1SWH9 9.07e-25 103 29 4 229 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
O30144 9.25e-25 101 32 4 196 1 wtpC Molybdate/tungstate import ATP-binding protein WtpC Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q18AM3 9.4e-25 103 28 4 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridioides difficile (strain 630)
Q46ZU5 9.43e-25 102 30 4 213 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q832R5 9.44e-25 105 28 3 217 3 EF_2153 Putative ABC transporter ATP-binding protein EF_2153 Enterococcus faecalis (strain ATCC 700802 / V583)
Q832R5 1.13e-12 70 24 5 228 3 EF_2153 Putative ABC transporter ATP-binding protein EF_2153 Enterococcus faecalis (strain ATCC 700802 / V583)
O69063 9.47e-25 103 31 8 244 3 htxD Hypophosphite import ATP-binding protein HtxD Stutzerimonas stutzeri
Q7NRX5 9.48e-25 103 30 4 229 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
P31548 9.5e-25 100 29 3 215 1 thiQ Thiamine import ATP-binding protein ThiQ Escherichia coli (strain K12)
Q578K3 9.6e-25 103 30 3 223 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella abortus biovar 1 (strain 9-941)
Q2YKX3 9.6e-25 103 30 3 223 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella abortus (strain 2308)
Q24XJ2 9.73e-25 103 29 5 233 3 potA Spermidine/putrescine import ATP-binding protein PotA Desulfitobacterium hafniense (strain Y51)
Q5NHP2 1e-24 100 32 3 201 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q2A4V5 1e-24 100 32 3 201 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Francisella tularensis subsp. holarctica (strain LVS)
Q14J44 1e-24 100 32 3 201 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Francisella tularensis subsp. tularensis (strain FSC 198)
Q81PZ8 1.02e-24 105 31 4 224 3 BA_2641 Putative ABC transporter ATP-binding protein BA_2641/GBAA_2641/BAS2461 Bacillus anthracis
Q81PZ8 3.27e-17 83 25 4 220 3 BA_2641 Putative ABC transporter ATP-binding protein BA_2641/GBAA_2641/BAS2461 Bacillus anthracis
Q5X627 1.03e-24 103 27 3 218 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila (strain Paris)
Q52815 1.05e-24 101 27 3 229 3 aapP General L-amino acid transport ATP-binding protein AapP Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q0SFW6 1.08e-24 103 30 4 226 3 metN2 Methionine import ATP-binding protein MetN 2 Rhodococcus jostii (strain RHA1)
Q9L0Q1 1.11e-24 103 27 4 229 1 msiK Diacetylchitobiose uptake system ATP-binding protein MsiK Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q3K3R2 1.11e-24 104 27 2 237 3 rbsA Ribose import ATP-binding protein RbsA Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q3K3R2 7.09e-19 88 28 5 206 3 rbsA Ribose import ATP-binding protein RbsA Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q55EH8 1.12e-24 105 27 7 230 3 abcG23 ABC transporter G family member 23 Dictyostelium discoideum
Q5E882 1.15e-24 100 30 6 209 3 thiQ Thiamine import ATP-binding protein ThiQ Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q20ZS6 1.16e-24 100 31 5 204 3 lolD2 Lipoprotein-releasing system ATP-binding protein LolD 2 Rhodopseudomonas palustris (strain BisB18)
Q83MC5 1.18e-24 103 28 6 237 3 metN Methionine import ATP-binding protein MetN Shigella flexneri
Q0T810 1.18e-24 103 28 6 237 3 metN Methionine import ATP-binding protein MetN Shigella flexneri serotype 5b (strain 8401)
P77795 1.23e-24 102 29 4 220 3 ydcT Uncharacterized ABC transporter ATP-binding protein YdcT Escherichia coli (strain K12)
Q13FD9 1.4e-24 104 26 1 218 3 Bxeno_C1272 Putative ribose/galactose/methyl galactoside import ATP-binding protein Paraburkholderia xenovorans (strain LB400)
Q13FD9 5.61e-11 65 25 2 207 3 Bxeno_C1272 Putative ribose/galactose/methyl galactoside import ATP-binding protein Paraburkholderia xenovorans (strain LB400)
Q03ZQ0 1.42e-24 103 29 5 220 3 potA Spermidine/putrescine import ATP-binding protein PotA Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
Q3JKX3 1.58e-24 101 28 8 254 3 tauB Taurine import ATP-binding protein TauB Burkholderia pseudomallei (strain 1710b)

  • Number of RefSeq hits:

General

Source Morganella morganii S3
Locus tag LHKJJB_07150
Feature type CDS
Gene lptB
Product LPS export ABC transporter ATP-binding protein
Location 160096 - 160821 (strand: -1)
Length 726 (nucleotides) / 241 (amino acids)

Contig

Accession ZDB_363
Length 233386 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_734
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00005 ABC transporter
PF12399 Branched-chain amino acid ATP-binding cassette transporter

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1137 Cell wall/membrane/envelope biogenesis (M) M ABC-type lipopolysaccharide export system, ATPase component

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K06861 lipopolysaccharide export system ATP-binding protein [EC:7.5.2.5] ABC transporters -

Protein Sequence

MAKLTASKLAKAYKGRKVVEDVTLEVSSGEIVGLLGPNGAGKTTTFYMVVGIVPRDAGAISIDDEDISLLPLHERARKGIGYLPQEASIFRRLTVWQNLMAVLEIRKDLNNDERRERAEELMEEFHISHLRDNLGQSLSGGERRRVEIARALAANPKFILLDEPFAGVDPISVIDIKKIIQHLRDYGLGVLITDHNVRETLDVCERAYIVSQGHMIAHGSPESILNNEQVKRVYLGEGFRL

Flanking regions ( +/- flanking 50bp)

TTCAGGAAAAAGGCCCGGCGGCAACCGGCCAGAAAGGTAAGTAACGATTTATGGCAAAATTAACTGCAAGCAAATTAGCCAAAGCCTACAAAGGGCGCAAAGTCGTCGAAGATGTGACGCTTGAAGTCAGCTCCGGCGAAATCGTCGGGCTGCTCGGCCCGAACGGTGCCGGGAAAACCACGACCTTCTATATGGTCGTGGGTATTGTTCCCCGTGATGCCGGTGCGATAAGCATCGATGATGAAGATATCTCCCTGCTGCCGCTGCATGAACGTGCCCGCAAAGGGATTGGCTATCTGCCTCAGGAAGCCTCTATTTTCCGTCGTCTGACGGTATGGCAGAACCTGATGGCGGTGCTTGAAATCCGCAAAGATCTGAACAATGATGAACGCCGGGAGCGGGCGGAAGAGCTGATGGAAGAGTTCCATATCAGCCATCTGCGCGATAACCTGGGGCAATCACTGTCCGGGGGTGAACGCCGCCGTGTGGAAATTGCCCGCGCGCTGGCCGCCAACCCGAAATTCATCCTGCTGGATGAACCGTTTGCCGGTGTTGACCCGATTTCTGTTATTGATATTAAAAAGATTATTCAGCACCTCCGTGATTACGGGCTCGGCGTCCTGATCACTGACCACAACGTCCGCGAAACACTGGATGTCTGTGAACGGGCTTATATTGTCAGCCAGGGCCATATGATTGCCCACGGCAGCCCGGAATCCATTCTGAATAATGAGCAGGTTAAACGTGTTTATTTAGGCGAAGGTTTCCGCCTGTAATGCCGTAAGGAGCCCGTGTCCGTAATGAAGCAGAGTCTGCAGCTTAAACT