Homologs in group_734

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_03245 FBDBKF_03245 85.5 Morganella morganii S1 lptB LPS export ABC transporter ATP-binding protein
EHELCC_07290 EHELCC_07290 85.5 Morganella morganii S2 lptB LPS export ABC transporter ATP-binding protein
NLDBIP_07615 NLDBIP_07615 85.5 Morganella morganii S4 lptB LPS export ABC transporter ATP-binding protein
LHKJJB_07150 LHKJJB_07150 85.5 Morganella morganii S3 lptB LPS export ABC transporter ATP-binding protein
HKOGLL_03780 HKOGLL_03780 85.5 Morganella morganii S5 lptB LPS export ABC transporter ATP-binding protein
F4V73_RS11675 F4V73_RS11675 86.7 Morganella psychrotolerans lptB LPS export ABC transporter ATP-binding protein

Distribution of the homologs in the orthogroup group_734

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_734

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0A9V4 2.88e-142 400 84 0 241 1 lptB Lipopolysaccharide export system ATP-binding protein LptB Shigella flexneri
P0A9V1 2.88e-142 400 84 0 241 1 lptB Lipopolysaccharide export system ATP-binding protein LptB Escherichia coli (strain K12)
P0A9V2 2.88e-142 400 84 0 241 3 lptB Lipopolysaccharide export system ATP-binding protein LptB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9V3 2.88e-142 400 84 0 241 3 lptB Lipopolysaccharide export system ATP-binding protein LptB Escherichia coli O157:H7
P45073 3.1e-137 388 76 0 241 1 lptB Lipopolysaccharide export system ATP-binding protein LptB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P33982 1.39e-97 289 61 2 241 3 AZC_3926 Probable ABC transporter ATP-binding protein AZC_3926 Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
P24693 2.88e-95 281 59 1 239 3 lptB Lipopolysaccharide export system ATP-binding protein LptB Acidithiobacillus ferridurans
P25885 1.42e-94 281 57 1 238 3 R00382 Uncharacterized ABC transporter ATP-binding protein R00382 Rhizobium meliloti (strain 1021)
P20162 6.32e-62 195 71 0 139 3 lptB Lipopolysaccharide export system ATP-binding protein LptB (Fragment) Pseudomonas putida
P94440 1.38e-42 149 35 2 224 1 lnrL Linearmycin resistance ATP-binding protein LnrL Bacillus subtilis (strain 168)
Q8UA73 9.52e-42 148 34 5 244 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Agrobacterium fabrum (strain C58 / ATCC 33970)
P21629 4.92e-41 144 32 4 252 3 braF High-affinity branched-chain amino acid transport ATP-binding protein BraF Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P0A193 1.42e-40 142 33 3 251 3 livG High-affinity branched-chain amino acid transport ATP-binding protein LivG Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A194 1.42e-40 142 33 3 251 3 livG High-affinity branched-chain amino acid transport ATP-binding protein LivG Salmonella typhi
P0A9S9 8.01e-40 140 32 3 251 3 livG High-affinity branched-chain amino acid transport ATP-binding protein LivG Shigella flexneri
P0A9S7 8.01e-40 140 32 3 251 3 livG High-affinity branched-chain amino acid transport ATP-binding protein LivG Escherichia coli (strain K12)
P0A9S8 8.01e-40 140 32 3 251 3 livG High-affinity branched-chain amino acid transport ATP-binding protein LivG Escherichia coli O157:H7
P22731 2.03e-39 139 33 3 236 1 livF High-affinity branched-chain amino acid transport ATP-binding protein LivF Escherichia coli (strain K12)
Q8D0W8 4.32e-39 141 33 7 245 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Yersinia pestis
O28881 4.84e-39 139 32 2 247 3 livG Probable branched-chain amino acid transport ATP-binding protein LivG Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q668K6 1.24e-38 140 33 7 245 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Yersinia pseudotuberculosis serotype I (strain IP32953)
Q7N6Z2 8.75e-38 138 32 8 243 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
P0A191 8.97e-38 135 32 3 236 3 livF High-affinity branched-chain amino acid transport ATP-binding protein LivF Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A192 8.97e-38 135 32 3 236 3 livF High-affinity branched-chain amino acid transport ATP-binding protein LivF Salmonella typhi
Q81GU1 1.22e-37 137 31 4 235 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q8U4K3 4.33e-37 136 35 4 238 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
O31339 4.8e-37 136 31 4 235 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bacillus cereus (strain ATCC 10987 / NRS 248)
P40860 9.51e-37 135 32 5 239 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8Z4V6 1.31e-36 135 32 5 239 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Salmonella typhi
P54537 1.51e-36 132 30 3 232 1 artM Arginine transport ATP-binding protein ArtM Bacillus subtilis (strain 168)
Q8XBJ8 1.66e-36 135 32 5 240 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Escherichia coli O157:H7
P16676 1.68e-36 135 32 5 240 1 cysA Sulfate/thiosulfate import ATP-binding protein CysA Escherichia coli (strain K12)
Q8FFB3 1.79e-36 135 32 5 240 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q9PDN2 2.08e-36 134 31 3 235 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xylella fastidiosa (strain 9a5c)
Q7UC29 2.96e-36 134 32 5 240 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Shigella flexneri
Q9JZW0 4.47e-36 133 33 5 237 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q7NX01 5.57e-36 133 31 4 241 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q9JUX4 6.01e-36 133 33 5 237 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q88AS5 6.86e-36 132 31 6 244 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q5JEB0 1.31e-35 132 37 8 242 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
Q87DT9 1.44e-35 132 31 3 235 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q9KHT9 1.48e-35 133 31 5 228 1 opuCA Carnitine transport ATP-binding protein OpuCA Listeria monocytogenes
G2JZ44 1.48e-35 133 31 5 228 1 opuCA Carnitine transport ATP-binding protein OpuCA Listeria monocytogenes serotype 1/2a (strain 10403S)
Q9I6L0 2.57e-35 131 32 5 240 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8Z0H0 2.86e-35 131 35 3 222 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q92VJ2 3.47e-35 131 32 3 235 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Rhizobium meliloti (strain 1021)
O34992 4.67e-35 131 33 5 228 1 opuCA Glycine betaine/carnitine/choline transport ATP-binding protein OpuCA Bacillus subtilis (strain 168)
Q9KUI0 6.02e-35 131 30 4 235 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9K876 7.71e-35 130 31 4 232 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q45460 9.18e-35 130 33 5 228 2 opuBA Choline transport ATP-binding protein OpuBA Bacillus subtilis (strain 168)
Q93DX8 1.04e-34 127 32 5 240 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA (Fragment) Burkholderia cepacia
Q98K23 1.17e-34 129 33 3 235 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q88CL2 1.61e-34 129 31 7 245 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q609Q1 1.88e-34 129 34 5 227 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q8XXY9 2.06e-34 128 35 3 228 3 nodI Nod factor export ATP-binding protein I Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q92XW1 2.66e-34 129 33 4 236 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Rhizobium meliloti (strain 1021)
Q58664 2.78e-34 125 31 5 239 3 livF Probable branched-chain amino acid transport ATP-binding protein LivF Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q8PC11 2.85e-34 128 31 4 235 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q9G4F5 3.03e-34 129 29 3 235 3 CYSA Sulfate/thiosulfate import ATP-binding protein cysA Cucumis sativus
Q9TKX3 3.3e-34 128 33 3 219 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nephroselmis olivacea
Q81TH8 3.4e-34 128 31 3 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus anthracis
Q6HLQ9 3.44e-34 128 31 3 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q8F6Z1 3.46e-34 128 30 4 236 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72PE5 3.46e-34 128 30 4 236 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
P63354 3.59e-34 129 35 4 219 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Brucella suis biovar 1 (strain 1330)
P63353 3.59e-34 129 35 4 219 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q63E84 3.7e-34 128 31 3 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ZK / E33L)
Q73BM0 3.7e-34 128 31 3 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ATCC 10987 / NRS 248)
A0RBB0 3.7e-34 128 31 3 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus thuringiensis (strain Al Hakam)
Q58663 3.71e-34 126 30 2 253 1 livG Probable branched-chain amino acid transport ATP-binding protein LivG Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q5FA19 4.05e-34 128 34 5 244 1 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q7NIW1 4.29e-34 128 35 3 219 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q81GC1 4.72e-34 127 31 3 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q5YZY9 7.47e-34 127 34 6 244 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nocardia farcinica (strain IFM 10152)
O57896 1.03e-33 127 31 5 241 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q8EBC3 1.04e-33 127 29 4 235 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
P14788 1.15e-33 127 33 3 225 2 cysA Sulfate/thiosulfate import ATP-binding protein CysA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q8UH62 1.3e-33 127 32 4 226 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
P74548 1.41e-33 127 34 3 218 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P56344 1.51e-33 124 32 4 226 3 cysA Probable sulfate/thiosulfate import ATP-binding protein CysA Chlorella vulgaris
Q82WT5 1.92e-33 127 30 4 236 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q92AF9 2.04e-33 124 30 5 237 3 mntB Manganese transport system ATP-binding protein MntB Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q7W9U5 2.25e-33 126 31 5 236 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q6D201 2.38e-33 125 29 4 240 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q8E8K8 2.47e-33 126 30 3 232 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q7VZE5 2.55e-33 126 31 5 236 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7WGW1 2.92e-33 126 31 5 236 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q1BWI2 3.21e-33 125 32 2 228 3 nodI Nod factor export ATP-binding protein I Burkholderia orbicola (strain AU 1054)
Q18C09 3.58e-33 125 33 5 241 3 metN Methionine import ATP-binding protein MetN Clostridioides difficile (strain 630)
Q2SVP3 4.41e-33 124 33 2 228 3 nodI Nod factor export ATP-binding protein I Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q73XU8 4.61e-33 125 36 4 205 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q1LKJ2 5.45e-33 124 33 3 230 3 nodI Nod factor export ATP-binding protein I Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
C0SPB4 5.68e-33 124 28 3 225 3 yhaQ Uncharacterized ABC transporter ATP-binding protein YhaQ Bacillus subtilis (strain 168)
Q3JSQ0 7.32e-33 124 33 2 228 3 nodI Nod factor export ATP-binding protein I Burkholderia pseudomallei (strain 1710b)
Q62K72 7.32e-33 124 33 2 228 3 nodI Nod factor export ATP-binding protein I Burkholderia mallei (strain ATCC 23344)
Q63TX3 7.4e-33 124 33 2 228 3 nodI Nod factor export ATP-binding protein I Burkholderia pseudomallei (strain K96243)
P21630 8.59e-33 122 32 3 236 3 braG High-affinity branched-chain amino acid transport ATP-binding protein BraG Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P37774 1.02e-32 122 31 2 240 1 tcyN L-cystine transport system ATP-binding protein TcyN Escherichia coli (strain K12)
Q8ZPK4 1.1e-32 125 33 8 239 1 osmV Osmoprotectant import ATP-binding protein OsmV Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q6HP89 1.11e-32 124 32 5 236 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q39GT7 1.22e-32 123 32 2 228 3 nodI Nod factor export ATP-binding protein I Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q6F9A8 1.25e-32 124 30 4 244 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q8PNN4 2.06e-32 124 31 4 235 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xanthomonas axonopodis pv. citri (strain 306)
O28882 2.17e-32 121 30 5 239 3 livF Probable branched-chain amino acid transport ATP-binding protein LivF Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
P44785 2.3e-32 123 30 4 236 3 metN Methionine import ATP-binding protein MetN Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8DIA0 2.69e-32 123 32 3 219 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
O07016 2.8e-32 122 32 4 238 3 yvfR Uncharacterized ABC transporter ATP-binding protein YvfR Bacillus subtilis (strain 168)
Q81ZF5 2.85e-32 123 33 5 224 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus anthracis
Q4W575 2.99e-32 123 34 5 244 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9JVH1 2.99e-32 123 34 5 244 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
P9WQM1 3.37e-32 123 34 4 219 1 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQM0 3.37e-32 123 34 4 219 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A4W3 3.37e-32 123 34 4 219 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q81IN8 4.15e-32 122 32 5 236 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q8Y651 4.26e-32 120 29 7 241 3 mntB Manganese transport system ATP-binding protein MntB Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q6D2F6 4.43e-32 122 30 7 243 3 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q1CFH7 4.52e-32 122 32 5 234 3 metN2 Methionine import ATP-binding protein MetN 2 Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZH38 4.52e-32 122 32 5 234 3 metN1 Methionine import ATP-binding protein MetN 1 Yersinia pestis
Q1CAK4 4.52e-32 122 32 5 234 3 metN1 Methionine import ATP-binding protein MetN 1 Yersinia pestis bv. Antiqua (strain Antiqua)
Q73EL7 5.34e-32 122 31 5 236 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q4QMH4 5.54e-32 122 30 4 236 3 metN Methionine import ATP-binding protein MetN Haemophilus influenzae (strain 86-028NP)
Q8D653 5.54e-32 122 29 4 238 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Vibrio vulnificus (strain CMCP6)
Q58762 5.98e-32 121 36 8 241 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q65T42 6.7e-32 122 29 3 234 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
P54592 7.37e-32 121 31 3 216 3 yhcH Uncharacterized ABC transporter ATP-binding protein YhcH Bacillus subtilis (strain 168)
Q8KLG1 7.69e-32 121 32 3 226 3 nodI Nod factor export ATP-binding protein I Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q63GR8 8.2e-32 122 31 5 236 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus cereus (strain ZK / E33L)
P33360 9.67e-32 121 30 5 237 1 yehX Glycine betaine uptake system ATP-binding protein YehX Escherichia coli (strain K12)
Q3IM24 1.2e-31 120 33 5 229 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Natronomonas pharaonis (strain ATCC 35678 / DSM 2160 / CIP 103997 / JCM 8858 / NBRC 14720 / NCIMB 2260 / Gabara)
Q97KS6 1.24e-31 122 31 4 235 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q13ZJ1 1.34e-31 120 34 2 227 3 nodI Nod factor export ATP-binding protein I Paraburkholderia xenovorans (strain LB400)
Q89UD2 1.35e-31 121 29 4 244 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
P23703 1.41e-31 121 32 4 237 3 nodI Nod factor export ATP-binding protein I Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q9V2C0 1.45e-31 121 32 6 230 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Pyrococcus abyssi (strain GE5 / Orsay)
Q0AGF4 1.47e-31 122 32 3 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q2SSS4 2.42e-31 121 32 5 231 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma capricolum subsp. capricolum (strain California kid / ATCC 27343 / NCTC 10154)
P32010 2.62e-31 120 33 3 223 1 drrA Daunorubicin/doxorubicin resistance ATP-binding protein DrrA Streptomyces peucetius
Q58429 3.1e-31 119 29 3 224 3 MJ1023 Uncharacterized ABC transporter ATP-binding protein MJ1023 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q6MU19 3.52e-31 120 31 5 231 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma mycoides subsp. mycoides SC (strain CCUG 32753 / NCTC 10114 / PG1)
P11160 4.22e-31 112 79 0 68 3 lptB Lipopolysaccharide export system ATP-binding protein LptB (Fragment) Klebsiella oxytoca
Q8U6M1 4.45e-31 120 33 3 219 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Agrobacterium fabrum (strain C58 / ATCC 33970)
Q6F0V4 4.89e-31 120 33 6 229 3 potA Spermidine/putrescine import ATP-binding protein PotA Mesoplasma florum (strain ATCC 33453 / NBRC 100688 / NCTC 11704 / L1)
Q82TL6 5.04e-31 120 31 3 228 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q0I5E9 5.23e-31 120 31 5 235 3 metN Methionine import ATP-binding protein MetN Histophilus somni (strain 129Pt)
Q63TY1 5.52e-31 120 31 5 240 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Burkholderia pseudomallei (strain K96243)
Q62K82 5.69e-31 120 31 5 240 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Burkholderia mallei (strain ATCC 23344)
Q7MKU3 7.41e-31 120 29 3 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio vulnificus (strain YJ016)
Q8D9J4 7.41e-31 120 29 3 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio vulnificus (strain CMCP6)
P45022 7.48e-31 117 28 1 240 3 HI_1078 Probable amino-acid ABC transporter ATP-binding protein HI_1078 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q667L9 7.51e-31 119 31 5 234 3 metN2 Methionine import ATP-binding protein MetN 2 Yersinia pseudotuberculosis serotype I (strain IP32953)
Q9MUN1 7.7e-31 119 29 3 219 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mesostigma viride
Q9KS33 8.14e-31 120 28 3 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q87PH3 8.22e-31 120 30 3 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q65VG9 8.91e-31 119 29 4 236 3 metN Methionine import ATP-binding protein MetN Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
P54954 9.11e-31 117 30 4 240 1 yxeO Probable amino-acid import ATP-binding protein YxeO Bacillus subtilis (strain 168)
Q2IYS5 9.57e-31 117 33 5 243 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Rhodopseudomonas palustris (strain HaA2)
Q8L1U3 1e-30 117 32 5 240 1 hmuV Hemin import ATP-binding protein HmuV Bordetella avium
Q2KUC0 1e-30 117 32 5 240 3 hmuV Hemin import ATP-binding protein HmuV Bordetella avium (strain 197N)
Q5E586 1.06e-30 119 29 5 237 3 potA Spermidine/putrescine import ATP-binding protein PotA Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q8XNY7 1.18e-30 117 29 6 241 3 CPE0195 Putative ABC transporter ATP-binding protein CPE0195 Clostridium perfringens (strain 13 / Type A)
A0A0H2ZLL3 1.31e-30 116 32 5 227 3 egtUA Probable ergothioneine transport ATP-binding protein EgtUA Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
P45171 1.36e-30 119 30 5 239 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q7W025 1.36e-30 117 32 6 243 3 hmuV Hemin import ATP-binding protein HmuV Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7W359 1.39e-30 117 32 6 243 3 hmuV Hemin import ATP-binding protein HmuV Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q1B677 1.48e-30 118 33 3 226 3 metN Methionine import ATP-binding protein MetN Mycobacterium sp. (strain MCS)
Q7VM95 1.82e-30 118 29 6 248 3 metN Methionine import ATP-binding protein MetN Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q5HV18 1.96e-30 118 28 4 256 3 metN Methionine import ATP-binding protein MetN Campylobacter jejuni (strain RM1221)
Q0PAB6 1.96e-30 118 28 4 256 3 metN Methionine import ATP-binding protein MetN Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q831K6 2.01e-30 118 31 4 238 1 metN2 Methionine import ATP-binding protein MetN 2 Enterococcus faecalis (strain ATCC 700802 / V583)
Q9CK97 2.24e-30 118 30 5 238 3 metN Methionine import ATP-binding protein MetN Pasteurella multocida (strain Pm70)
Q7WEH6 2.24e-30 116 32 6 243 3 hmuV Hemin import ATP-binding protein HmuV Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
P72335 2.5e-30 117 33 3 218 3 nodI Nod factor export ATP-binding protein I Rhizobium sp. (strain N33)
Q4QK57 2.66e-30 118 30 5 239 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus influenzae (strain 86-028NP)
Q4KC87 2.89e-30 118 31 6 249 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q81CT8 3.47e-30 120 32 5 239 3 BC_2655 Putative ABC transporter ATP-binding protein BC_2655 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q81CT8 8.28e-16 79 23 4 232 3 BC_2655 Putative ABC transporter ATP-binding protein BC_2655 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q3KKA1 3.76e-30 115 32 5 224 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas fluorescens (strain Pf0-1)
Q0SWH9 3.94e-30 116 29 6 241 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Clostridium perfringens (strain SM101 / Type A)
Q6LX68 4.06e-30 116 30 3 236 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Methanococcus maripaludis (strain DSM 14266 / JCM 13030 / NBRC 101832 / S2 / LL)
Q3YUN6 4.14e-30 115 31 7 251 3 phnC Phosphonates import ATP-binding protein PhnC Shigella sonnei (strain Ss046)
Q3A9G5 4.15e-30 117 32 4 227 3 metN Methionine import ATP-binding protein MetN Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q9CP06 4.15e-30 118 28 5 240 3 potA Spermidine/putrescine import ATP-binding protein PotA Pasteurella multocida (strain Pm70)
Q9Z3I3 4.31e-30 116 32 2 215 3 nodI Nod factor export ATP-binding protein I Bradyrhizobium sp. (strain SNU001)
Q60350 4.98e-30 115 32 5 230 3 MJ0035 Uncharacterized ABC transporter ATP-binding protein MJ0035 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q6NBT1 5.07e-30 117 30 4 226 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q3MAR5 5.07e-30 118 31 5 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q8XZP8 5.16e-30 117 29 4 235 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q897I2 5.68e-30 119 29 5 240 3 CTC_00753 Putative ABC transporter ATP-binding protein CTC_00753 Clostridium tetani (strain Massachusetts / E88)
Q897I2 2.91e-11 65 28 1 114 3 CTC_00753 Putative ABC transporter ATP-binding protein CTC_00753 Clostridium tetani (strain Massachusetts / E88)
O34977 5.72e-30 114 27 3 223 3 ythP Uncharacterized ABC transporter ATP-binding protein YthP Bacillus subtilis (strain 168)
Q3KCC5 6.46e-30 117 29 7 239 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Pseudomonas fluorescens (strain Pf0-1)
Q2SJ99 6.48e-30 119 30 1 230 3 rbsA Ribose import ATP-binding protein RbsA Hahella chejuensis (strain KCTC 2396)
Q2SJ99 1.05e-12 70 25 5 205 3 rbsA Ribose import ATP-binding protein RbsA Hahella chejuensis (strain KCTC 2396)
Q1QE80 7e-30 118 31 3 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q0T9T7 7.49e-30 115 31 7 252 3 phnC Phosphonates import ATP-binding protein PhnC Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q8YM92 8.59e-30 117 31 5 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
P44662 8.69e-30 115 31 6 229 3 HI_0361 Probable iron transport system ATP-binding protein HI_0361 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q31I51 9.12e-30 114 30 7 243 3 znuC Zinc import ATP-binding protein ZnuC Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q2YAD6 9.54e-30 117 31 3 227 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q57TF5 1.08e-29 114 32 3 215 3 thiQ Thiamine import ATP-binding protein ThiQ Salmonella choleraesuis (strain SC-B67)
Q5PDF8 1.23e-29 114 32 3 215 3 thiQ Thiamine import ATP-binding protein ThiQ Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q0A9E2 1.24e-29 114 30 3 233 3 znuC Zinc import ATP-binding protein ZnuC Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q92WJ0 1.35e-29 116 32 3 218 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Rhizobium meliloti (strain 1021)
Q8NQU4 1.37e-29 114 28 4 242 1 argV Arginine transport ATP-binding protein ArgV Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q2K8C8 1.38e-29 116 31 3 219 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
P31134 1.6e-29 116 33 4 229 1 potG Putrescine transport ATP-binding protein PotG Escherichia coli (strain K12)
Q8Z9I6 2.04e-29 113 32 3 215 3 thiQ Thiamine import ATP-binding protein ThiQ Salmonella typhi
Q0TUN8 2.08e-29 114 29 6 241 1 ecfA3 Energy-coupling factor transporter ATP-binding protein EcfA3 Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
P0C0E2 2.12e-29 113 28 3 214 3 srtF Lantibiotic transport ATP-binding protein SrtF Streptococcus pyogenes
P0C0E3 2.12e-29 113 28 3 214 3 srtF Lantibiotic transport ATP-binding protein SrtF Streptococcus pyogenes serotype M1
A1TXH7 2.12e-29 116 31 3 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
P94374 2.15e-29 114 29 3 217 2 yxlF Uncharacterized ABC transporter ATP-binding protein YxlF Bacillus subtilis (strain 168)
Q9KLQ5 2.28e-29 115 30 3 219 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q4QP85 2.46e-29 115 33 4 224 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Haemophilus influenzae (strain 86-028NP)
Q4JTG9 2.46e-29 116 30 3 214 3 metN Methionine import ATP-binding protein MetN Corynebacterium jeikeium (strain K411)
Q0SRL2 2.53e-29 115 30 6 242 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain SM101 / Type A)
P55662 2.57e-29 113 28 3 239 3 NGR_a01510 Probable amino-acid ABC transporter ATP-binding protein y4tH Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q6LKD4 2.59e-29 115 30 3 219 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Photobacterium profundum (strain SS9)
Q97UY8 2.65e-29 115 28 5 235 1 glcV Glucose import ATP-binding protein GlcV Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q2JLH7 2.82e-29 114 33 5 233 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Synechococcus sp. (strain JA-2-3B'a(2-13))
Q7NQN5 3.24e-29 115 31 5 242 3 potA Spermidine/putrescine import ATP-binding protein PotA Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q9HT73 3.37e-29 113 31 5 224 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02DK9 3.37e-29 113 31 5 224 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas aeruginosa (strain UCBPP-PA14)
P96605 3.49e-29 114 31 5 221 3 ydbJ Uncharacterized ABC transporter ATP-binding protein YdbJ Bacillus subtilis (strain 168)
P44513 3.95e-29 115 33 4 224 1 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
O27739 4.75e-29 114 31 3 234 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
Q8ZRV2 4.97e-29 112 32 3 215 1 thiQ Thiamine import ATP-binding protein ThiQ Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8NY21 5.81e-29 114 30 3 209 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain MW2)
Q6GC27 5.81e-29 114 30 3 209 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain MSSA476)
Q8XDV7 5.81e-29 112 31 7 251 3 phnC Phosphonates import ATP-binding protein PhnC Escherichia coli O157:H7
Q8XIZ5 5.86e-29 114 29 6 242 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain 13 / Type A)
Q0TNZ3 5.86e-29 114 29 6 242 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
O85818 5.92e-29 115 29 6 243 3 potA Spermidine/putrescine import ATP-binding protein PotA Aggregatibacter actinomycetemcomitans
P16677 5.94e-29 112 33 9 253 3 phnC Phosphonates import ATP-binding protein PhnC Escherichia coli (strain K12)
Q6D1C4 5.95e-29 114 31 5 235 3 metN3 Methionine import ATP-binding protein MetN 3 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q83P97 7.41e-29 112 33 9 253 3 phnC Phosphonates import ATP-binding protein PhnC Shigella flexneri
Q0SXV5 7.41e-29 112 33 9 253 3 phnC Phosphonates import ATP-binding protein PhnC Shigella flexneri serotype 5b (strain 8401)
P26050 8.09e-29 113 32 3 218 3 nodI Nod factor export ATP-binding protein I Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q31TP8 8.87e-29 112 31 7 252 3 phnC Phosphonates import ATP-binding protein PhnC Shigella boydii serotype 4 (strain Sb227)
P55476 9.3e-29 114 32 4 224 3 nodI Nod factor export ATP-binding protein I Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q6GJL2 9.47e-29 114 28 5 232 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain MRSA252)
Q66D26 9.67e-29 112 29 5 254 3 phnC Phosphonates import ATP-binding protein PhnC Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CFV9 9.67e-29 112 29 5 254 3 phnC Phosphonates import ATP-binding protein PhnC Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZGU5 9.67e-29 112 29 5 254 3 phnC Phosphonates import ATP-binding protein PhnC Yersinia pestis
Q1C9L0 9.67e-29 112 29 5 254 3 phnC Phosphonates import ATP-binding protein PhnC Yersinia pestis bv. Antiqua (strain Antiqua)
P41234 1.12e-28 117 33 6 237 1 Abca2 ATP-binding cassette sub-family A member 2 Mus musculus
P41234 3.34e-25 107 32 5 228 1 Abca2 ATP-binding cassette sub-family A member 2 Mus musculus
Q97KD5 1.14e-28 113 31 4 229 3 metN Methionine import ATP-binding protein MetN Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q8RQL7 1.25e-28 111 28 5 242 3 gluA Glutamate transport ATP-binding protein GluA Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q2YVT7 1.29e-28 113 28 5 232 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q8REG7 1.3e-28 111 27 4 243 3 phnC Phosphonates import ATP-binding protein PhnC Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q5E882 1.34e-28 111 32 4 219 3 thiQ Thiamine import ATP-binding protein ThiQ Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q97KZ3 1.38e-28 111 30 5 223 3 CA_C0773 Putative ABC transporter ATP-binding protein CA_C0773 Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q14Q07 1.48e-28 113 30 4 226 3 potA Spermidine/putrescine import ATP-binding protein PotA Spiroplasma citri
Q4KKK4 1.55e-28 111 31 5 224 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
P15031 1.75e-28 111 28 3 235 1 fecE Fe(3+) dicitrate transport ATP-binding protein FecE Escherichia coli (strain K12)
Q5HIL5 1.8e-28 113 30 3 209 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain COL)
Q2G0V2 1.8e-28 113 30 3 209 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FJI0 1.8e-28 113 30 3 209 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain USA300)
Q5PID0 1.86e-28 113 30 5 235 3 metN1 Methionine import ATP-binding protein MetN 1 Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q65UE1 1.89e-28 114 28 4 227 3 potA Spermidine/putrescine import ATP-binding protein PotA Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q326G9 1.98e-28 110 31 3 215 3 thiQ Thiamine import ATP-binding protein ThiQ Shigella boydii serotype 4 (strain Sb227)
Q0TLS2 2e-28 110 31 3 215 3 thiQ Thiamine import ATP-binding protein ThiQ Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q8FL82 2.04e-28 110 31 3 215 3 thiQ Thiamine import ATP-binding protein ThiQ Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q1RGD0 2.06e-28 110 31 3 215 3 thiQ Thiamine import ATP-binding protein ThiQ Escherichia coli (strain UTI89 / UPEC)
Q0T8D1 2.11e-28 110 31 3 215 3 thiQ Thiamine import ATP-binding protein ThiQ Shigella flexneri serotype 5b (strain 8401)
Q9X196 2.29e-28 113 29 3 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q57T09 2.29e-28 113 30 5 235 3 metN1 Methionine import ATP-binding protein MetN 1 Salmonella choleraesuis (strain SC-B67)
Q7M8M4 2.32e-28 111 32 4 233 3 phnC Phosphonates import ATP-binding protein PhnC Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
Q8Z8W8 2.32e-28 113 34 4 217 3 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella typhi
Q5PFQ7 2.32e-28 113 34 4 217 3 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q329I3 2.41e-28 111 30 6 252 3 phnC Phosphonates import ATP-binding protein PhnC Shigella dysenteriae serotype 1 (strain Sd197)
Q737I0 2.44e-28 115 33 6 244 3 BCE_2668 Putative ABC transporter ATP-binding protein BCE_2668 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q737I0 3.06e-19 89 25 4 237 3 BCE_2668 Putative ABC transporter ATP-binding protein BCE_2668 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q74I62 2.45e-28 115 31 5 231 3 LJ_1704 Putative ABC transporter ATP-binding protein LJ_1704 Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q74I62 2.64e-15 78 27 7 239 3 LJ_1704 Putative ABC transporter ATP-binding protein LJ_1704 Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q32JQ8 2.49e-28 112 30 5 235 3 metN Methionine import ATP-binding protein MetN Shigella dysenteriae serotype 1 (strain Sd197)
Q24QI5 2.52e-28 112 29 4 234 3 metN Methionine import ATP-binding protein MetN Desulfitobacterium hafniense (strain Y51)
P10346 2.54e-28 110 28 3 233 1 glnQ Glutamine transport ATP-binding protein GlnQ Escherichia coli (strain K12)
Q58488 2.57e-28 111 30 5 240 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P72297 2.74e-28 110 30 3 227 3 occP Octopine permease ATP-binding protein P Rhizobium meliloti
P30750 2.82e-28 112 30 5 235 1 metN Methionine import ATP-binding protein MetN Escherichia coli (strain K12)
Q3Z2Z3 2.94e-28 113 29 6 242 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella sonnei (strain Ss046)
Q31ZK0 2.94e-28 113 29 6 242 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella boydii serotype 4 (strain Sb227)
Q50966 3e-28 112 33 5 232 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria gonorrhoeae
Q7A7E3 3.03e-28 112 28 6 234 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain N315)
Q99WE1 3.03e-28 112 28 6 234 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain Mu50 / ATCC 700699)
O69063 3.12e-28 112 32 8 244 3 htxD Hypophosphite import ATP-binding protein HtxD Stutzerimonas stutzeri
Q9RYZ3 3.4e-28 110 29 6 245 3 pstB Phosphate import ATP-binding protein PstB Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
Q3Z5F8 3.44e-28 112 30 5 235 3 metN Methionine import ATP-binding protein MetN Shigella sonnei (strain Ss046)
Q1RFY9 3.44e-28 112 30 5 235 3 metN Methionine import ATP-binding protein MetN Escherichia coli (strain UTI89 / UPEC)
P63355 3.44e-28 112 30 5 235 3 metN Methionine import ATP-binding protein MetN Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P63356 3.44e-28 112 30 5 235 3 metN Methionine import ATP-binding protein MetN Escherichia coli O157:H7
Q0TLD2 3.62e-28 112 30 5 235 3 metN Methionine import ATP-binding protein MetN Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q1R3F6 3.76e-28 110 30 7 252 3 phnC Phosphonates import ATP-binding protein PhnC Escherichia coli (strain UTI89 / UPEC)
Q9BZC7 3.81e-28 115 32 6 237 1 ABCA2 ATP-binding cassette sub-family A member 2 Homo sapiens
Q9BZC7 1.92e-25 107 32 5 228 1 ABCA2 ATP-binding cassette sub-family A member 2 Homo sapiens
Q32EY4 4e-28 113 29 6 242 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella dysenteriae serotype 1 (strain Sd197)
Q3Z5U5 4.07e-28 109 31 3 215 3 thiQ Thiamine import ATP-binding protein ThiQ Shigella sonnei (strain Ss046)
P96063 4.1e-28 112 34 4 217 2 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q325U1 4.1e-28 112 30 4 235 3 metN Methionine import ATP-binding protein MetN Shigella boydii serotype 4 (strain Sb227)
Q8ZRM9 4.23e-28 112 30 5 235 3 metN1 Methionine import ATP-binding protein MetN 1 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q6MCV4 4.57e-28 112 31 4 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Protochlamydia amoebophila (strain UWE25)
Q8FAV1 4.64e-28 110 30 7 252 3 phnC Phosphonates import ATP-binding protein PhnC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8CUY0 4.97e-28 110 31 8 248 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q9ESR9 4.98e-28 115 33 6 237 1 Abca2 ATP-binding cassette sub-family A member 2 Rattus norvegicus
Q9ESR9 3.73e-26 110 33 5 228 1 Abca2 ATP-binding cassette sub-family A member 2 Rattus norvegicus
Q2FNX9 5.84e-28 110 31 6 234 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Methanospirillum hungatei JF-1 (strain ATCC 27890 / DSM 864 / NBRC 100397 / JF-1)
P42246 6.2e-28 111 29 3 223 3 ycbN Uncharacterized ABC transporter ATP-binding protein YcbN Bacillus subtilis (strain 168)
Q32K28 6.34e-28 109 31 3 215 3 thiQ Thiamine import ATP-binding protein ThiQ Shigella dysenteriae serotype 1 (strain Sd197)
P69877 6.34e-28 112 29 6 242 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella flexneri
P69874 6.34e-28 112 29 6 242 1 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli (strain K12)
P69875 6.34e-28 112 29 6 242 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TIU8 6.34e-28 112 29 6 242 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O6:K15:H31 (strain 536 / UPEC)
P69876 6.34e-28 112 29 6 242 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O157:H7
Q92N13 6.37e-28 110 29 4 241 3 hmuV Hemin import ATP-binding protein HmuV Rhizobium meliloti (strain 1021)
A3DDF6 6.39e-28 112 30 5 234 3 potA Spermidine/putrescine import ATP-binding protein PotA Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q8D7T7 6.55e-28 114 30 1 220 3 rbsA Ribose import ATP-binding protein RbsA Vibrio vulnificus (strain CMCP6)
Q8D7T7 8.78e-17 82 26 5 228 3 rbsA Ribose import ATP-binding protein RbsA Vibrio vulnificus (strain CMCP6)
Q8FRX8 6.82e-28 112 29 3 213 3 metN Methionine import ATP-binding protein MetN Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q8Z7H7 6.89e-28 112 29 6 236 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella typhi
Q1RD28 6.89e-28 112 29 6 242 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli (strain UTI89 / UPEC)
A1AA20 6.89e-28 112 29 6 242 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O1:K1 / APEC
O52618 6.97e-28 111 30 4 240 3 nodI Nod factor export ATP-binding protein I Rhizobium meliloti (strain 1021)
Q6WB63 7.06e-28 110 31 6 248 3 phnC Phosphonates import ATP-binding protein PhnC Alcaligenes faecalis
Q664P8 7.12e-28 109 30 4 212 3 tauB Taurine import ATP-binding protein TauB Yersinia pseudotuberculosis serotype I (strain IP32953)
Q83MG3 7.2e-28 109 31 3 207 3 thiQ Thiamine import ATP-binding protein ThiQ Shigella flexneri
Q50801 7.59e-28 110 29 3 231 3 MTBMA_c05830 Putative ABC transporter ATP-binding protein MTBMA_c05830 Methanothermobacter marburgensis (strain ATCC BAA-927 / DSM 2133 / JCM 14651 / NBRC 100331 / OCM 82 / Marburg)
Q5PMK1 7.63e-28 112 29 6 236 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q7MEV1 7.91e-28 113 30 1 220 3 rbsA Ribose import ATP-binding protein RbsA Vibrio vulnificus (strain YJ016)
Q7MEV1 9.3e-17 82 26 5 228 3 rbsA Ribose import ATP-binding protein RbsA Vibrio vulnificus (strain YJ016)
Q9KN37 8.1e-28 113 29 1 220 3 rbsA Ribose import ATP-binding protein RbsA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9KN37 3.93e-14 74 25 5 211 3 rbsA Ribose import ATP-binding protein RbsA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q1CCR9 8.43e-28 109 30 4 212 3 tauB Taurine import ATP-binding protein TauB Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZJD0 8.43e-28 109 30 4 212 3 tauB Taurine import ATP-binding protein TauB Yersinia pestis
Q1C2S1 8.43e-28 109 30 4 212 3 tauB Taurine import ATP-binding protein TauB Yersinia pestis bv. Antiqua (strain Antiqua)
P45769 8.5e-28 109 28 4 236 3 yhdZ Uncharacterized amino-acid ABC transporter ATP-binding protein YhdZ Escherichia coli (strain K12)
Q2SB47 8.53e-28 109 30 3 226 3 hmuV Hemin import ATP-binding protein HmuV Hahella chejuensis (strain KCTC 2396)
Q7NWX3 8.66e-28 112 31 3 222 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q5WJP0 8.99e-28 111 32 6 234 3 metN2 Methionine import ATP-binding protein MetN 2 Shouchella clausii (strain KSM-K16)
P40790 9.09e-28 112 29 6 236 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q57QC8 9.09e-28 112 29 6 236 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella choleraesuis (strain SC-B67)
Q87UN0 9.2e-28 109 30 5 224 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
O35600 9.25e-28 114 32 5 218 1 Abca4 Retinal-specific phospholipid-transporting ATPase ABCA4 Mus musculus
O35600 4.46e-20 92 29 3 224 1 Abca4 Retinal-specific phospholipid-transporting ATPase ABCA4 Mus musculus
Q8NSN2 9.54e-28 111 28 4 219 3 metN Methionine import ATP-binding protein MetN Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q48PV0 9.6e-28 109 31 5 224 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q0I3Y9 9.95e-28 112 28 3 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Histophilus somni (strain 129Pt)
Q70GD4 1.01e-27 109 32 4 237 3 hmuV Hemin import ATP-binding protein HmuV Photobacterium damsela subsp. piscicida
Q110U3 1.14e-27 111 30 4 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Trichodesmium erythraeum (strain IMS101)
Q57SD6 1.15e-27 111 33 4 217 3 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella choleraesuis (strain SC-B67)
A0PY57 1.19e-27 111 29 4 227 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium novyi (strain NT)
Q6LR20 1.29e-27 111 28 3 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Photobacterium profundum (strain SS9)
P46903 1.3e-27 108 31 2 211 1 natA ABC transporter ATP-binding protein NatA Bacillus subtilis (strain 168)
Q8FUU5 1.36e-27 110 32 5 233 3 znuC Zinc import ATP-binding protein ZnuC Brucella suis biovar 1 (strain 1330)
Q4ZZS2 1.45e-27 109 30 5 224 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas syringae pv. syringae (strain B728a)
O34338 1.45e-27 108 30 5 243 2 mntB Manganese transport system ATP-binding protein MntB Bacillus subtilis (strain 168)
Q7N8M2 1.51e-27 110 31 3 214 3 metN Methionine import ATP-binding protein MetN Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q8Z990 1.59e-27 110 30 5 235 3 metN1 Methionine import ATP-binding protein MetN 1 Salmonella typhi
Q6D4E2 1.76e-27 111 29 4 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
P0A9U2 1.8e-27 113 30 3 226 3 ybhF Probable multidrug ABC transporter ATP-binding protein YbhF Shigella flexneri
P0A9U2 7.33e-27 111 29 5 227 3 ybhF Probable multidrug ABC transporter ATP-binding protein YbhF Shigella flexneri
P0A9U1 1.8e-27 113 30 3 226 1 ybhF Probable multidrug ABC transporter ATP-binding protein YbhF Escherichia coli (strain K12)
P0A9U1 7.33e-27 111 29 5 227 1 ybhF Probable multidrug ABC transporter ATP-binding protein YbhF Escherichia coli (strain K12)
Q6AE21 1.81e-27 110 30 4 222 3 metN Methionine import ATP-binding protein MetN Leifsonia xyli subsp. xyli (strain CTCB07)
Q74DN5 1.87e-27 108 30 7 232 3 GSU1281 Putative ABC transporter ATP-binding protein GSU1281 Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q88DY1 1.92e-27 108 30 3 237 3 hmuV Hemin import ATP-binding protein HmuV Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q1B8V9 2.07e-27 111 28 5 228 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycobacterium sp. (strain MCS)
A1UG51 2.07e-27 111 28 5 228 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycobacterium sp. (strain KMS)
Q4ZZR8 2.14e-27 110 28 4 234 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas syringae pv. syringae (strain B728a)
O26236 2.3e-27 108 29 3 231 3 MTH_133 Putative ABC transporter ATP-binding protein MTH_133 Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
Q8GNH6 2.57e-27 110 31 4 226 3 nodI Nod factor export ATP-binding protein I Rhizobium meliloti
P31548 2.65e-27 107 31 3 215 1 thiQ Thiamine import ATP-binding protein ThiQ Escherichia coli (strain K12)
O86751 2.66e-27 110 32 4 228 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q83MC5 2.93e-27 110 30 5 235 3 metN Methionine import ATP-binding protein MetN Shigella flexneri
Q0T810 2.93e-27 110 30 5 235 3 metN Methionine import ATP-binding protein MetN Shigella flexneri serotype 5b (strain 8401)
Q07PZ0 3e-27 108 32 5 243 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Rhodopseudomonas palustris (strain BisA53)
Q5KVK2 3.03e-27 110 30 5 236 3 metN Methionine import ATP-binding protein MetN Geobacillus kaustophilus (strain HTA426)
Q576K0 3.06e-27 108 32 5 233 3 znuC Zinc import ATP-binding protein ZnuC Brucella abortus biovar 1 (strain 9-941)
Q2YJH4 3.06e-27 108 32 5 233 3 znuC Zinc import ATP-binding protein ZnuC Brucella abortus (strain 2308)
Q659V4 3.12e-27 108 32 4 237 3 hmuV Hemin import ATP-binding protein HmuV Photobacterium damselae subsp. damselae
Q1M7W6 3.43e-27 109 31 4 226 3 nodI Nod factor export ATP-binding protein I Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q84M24 3.6e-27 112 32 5 236 2 ABCA1 ABC transporter A family member 1 Arabidopsis thaliana
Q84M24 2.08e-20 93 30 5 222 2 ABCA1 ABC transporter A family member 1 Arabidopsis thaliana
Q16BC5 3.89e-27 108 30 4 231 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q881U6 4.04e-27 107 32 5 215 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
A0LCH8 4.41e-27 107 29 5 234 3 znuC Zinc import ATP-binding protein ZnuC Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
P27675 4.5e-27 107 27 5 237 2 glnQ Glutamine transport ATP-binding protein GlnQ Geobacillus stearothermophilus
Q0SFW6 4.78e-27 109 29 5 236 3 metN2 Methionine import ATP-binding protein MetN 2 Rhodococcus jostii (strain RHA1)
Q5UW69 4.99e-27 107 32 7 236 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
Q1J0N0 5.1e-27 107 31 6 245 3 pstB Phosphate import ATP-binding protein PstB Deinococcus geothermalis (strain DSM 11300 / CIP 105573 / AG-3a)
Q0T5R2 5.75e-27 109 29 4 227 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella flexneri serotype 5b (strain 8401)
Q1WVI7 6.14e-27 109 28 4 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Ligilactobacillus salivarius (strain UCC118)
Q0SSJ0 6.57e-27 111 27 1 226 3 rbsA Ribose import ATP-binding protein RbsA Clostridium perfringens (strain SM101 / Type A)
Q0SSJ0 6.92e-12 67 22 5 207 3 rbsA Ribose import ATP-binding protein RbsA Clostridium perfringens (strain SM101 / Type A)
Q81PZ8 7.24e-27 111 32 6 244 3 BA_2641 Putative ABC transporter ATP-binding protein BA_2641/GBAA_2641/BAS2461 Bacillus anthracis
Q81PZ8 1.37e-15 79 24 4 237 3 BA_2641 Putative ABC transporter ATP-binding protein BA_2641/GBAA_2641/BAS2461 Bacillus anthracis
Q87H79 7.85e-27 110 30 1 220 3 rbsA Ribose import ATP-binding protein RbsA Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q87H79 5.2e-16 80 25 4 209 3 rbsA Ribose import ATP-binding protein RbsA Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q0TPX5 8.41e-27 110 28 1 216 3 rbsA Ribose import ATP-binding protein RbsA Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q0TPX5 3.09e-12 68 22 5 207 3 rbsA Ribose import ATP-binding protein RbsA Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q830W6 8.58e-27 108 29 5 227 3 potA Spermidine/putrescine import ATP-binding protein PotA Enterococcus faecalis (strain ATCC 700802 / V583)
Q2GFZ6 8.66e-27 106 30 5 237 3 znuC Zinc import ATP-binding protein ZnuC Ehrlichia chaffeensis (strain ATCC CRL-10679 / Arkansas)
Q8XA06 9.5e-27 106 30 3 215 3 thiQ Thiamine import ATP-binding protein ThiQ Escherichia coli O157:H7
Q8RGC8 1.01e-26 108 28 3 222 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q8RFN2 1.02e-26 108 33 6 232 3 metN Methionine import ATP-binding protein MetN Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
P35116 1.09e-26 106 27 3 243 3 nocP Nopaline permease ATP-binding protein P Agrobacterium fabrum (strain C58 / ATCC 33970)
Q0BZD8 1.1e-26 106 30 5 234 3 phnC Phosphonates import ATP-binding protein PhnC Hyphomonas neptunium (strain ATCC 15444)
Q160M2 1.12e-26 108 33 5 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
P36879 1.13e-26 107 30 4 227 1 yadG Uncharacterized ABC transporter ATP-binding protein YadG Escherichia coli (strain K12)
Q93KD4 1.14e-26 105 32 4 213 1 tupC Tungstate uptake system ATP-binding protein TupC Peptoclostridium acidaminophilum
Q8A883 1.19e-26 110 29 6 241 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q8XJX3 1.28e-26 110 28 1 216 3 rbsA Ribose import ATP-binding protein RbsA Clostridium perfringens (strain 13 / Type A)
Q8XJX3 1.15e-12 70 23 5 207 3 rbsA Ribose import ATP-binding protein RbsA Clostridium perfringens (strain 13 / Type A)
Q8D3Z9 1.29e-26 110 30 5 229 3 VV2_1533 Putative ABC transporter ATP-binding protein VV2_1533 Vibrio vulnificus (strain CMCP6)
Q8D3Z9 3.15e-13 72 26 5 215 3 VV2_1533 Putative ABC transporter ATP-binding protein VV2_1533 Vibrio vulnificus (strain CMCP6)
Q2NRN5 1.3e-26 108 31 5 228 3 metN Methionine import ATP-binding protein MetN Sodalis glossinidius (strain morsitans)
O30144 1.43e-26 105 32 5 214 1 wtpC Molybdate/tungstate import ATP-binding protein WtpC Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q8TI15 1.61e-26 107 31 7 234 3 MA_4342 Putative ABC transporter ATP-binding protein MA_4342 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q8DFC3 1.7e-26 108 30 3 214 3 metN Methionine import ATP-binding protein MetN Vibrio vulnificus (strain CMCP6)
Q5M5Z2 1.72e-26 108 31 7 238 3 metN Methionine import ATP-binding protein MetN Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q7MN25 1.76e-26 108 30 3 214 3 metN Methionine import ATP-binding protein MetN Vibrio vulnificus (strain YJ016)
Q5M1F6 1.83e-26 108 31 7 238 3 metN Methionine import ATP-binding protein MetN Streptococcus thermophilus (strain CNRZ 1066)
Q7VV72 2.02e-26 108 32 5 231 3 metN Methionine import ATP-binding protein MetN Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7W4E1 2.02e-26 108 32 5 231 3 metN Methionine import ATP-binding protein MetN Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WFU9 2.02e-26 108 32 5 231 3 metN Methionine import ATP-binding protein MetN Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q5E4V6 2.05e-26 109 31 2 221 3 rbsA Ribose import ATP-binding protein RbsA Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q5E4V6 1.37e-15 79 26 4 206 3 rbsA Ribose import ATP-binding protein RbsA Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q9KD30 2.13e-26 105 28 5 239 3 mntB Manganese transport system ATP-binding protein MntB Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q6HI76 2.16e-26 110 31 4 243 3 BT9727_2424 Putative ABC transporter ATP-binding protein BT9727_2424 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q6HI76 8.76e-16 79 24 4 237 3 BT9727_2424 Putative ABC transporter ATP-binding protein BT9727_2424 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q6HNE7 2.21e-26 109 29 3 232 3 rbsA Ribose import ATP-binding protein RbsA Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q6HNE7 2.86e-13 72 25 3 203 3 rbsA Ribose import ATP-binding protein RbsA Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q81V36 2.21e-26 109 29 3 232 3 rbsA Ribose import ATP-binding protein RbsA Bacillus anthracis
Q81V36 2.86e-13 72 25 3 203 3 rbsA Ribose import ATP-binding protein RbsA Bacillus anthracis
Q63FX9 2.35e-26 109 29 3 232 3 rbsA Ribose import ATP-binding protein RbsA Bacillus cereus (strain ZK / E33L)
Q63FX9 3.49e-13 71 25 3 203 3 rbsA Ribose import ATP-binding protein RbsA Bacillus cereus (strain ZK / E33L)
Q1IGY7 2.35e-26 105 30 5 226 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas entomophila (strain L48)
Q8PY26 2.37e-26 106 30 7 236 3 MM_1038 Putative ABC transporter ATP-binding protein MM_1038 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q92CK1 2.39e-26 106 28 5 229 3 lin1170 Putative ABC transporter ATP-binding protein lin1170 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q8TIW9 2.52e-26 106 28 7 238 3 MA_4021 Putative ABC transporter ATP-binding protein MA_4021 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q6F9P2 2.59e-26 107 28 5 234 3 metN2 Methionine import ATP-binding protein MetN 2 Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q8ELA5 2.72e-26 107 29 4 236 3 metN4 Methionine import ATP-binding protein MetN 4 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q11B53 2.86e-26 106 32 4 233 3 znuC Zinc import ATP-binding protein ZnuC Chelativorans sp. (strain BNC1)
Q668Q3 2.89e-26 107 28 7 251 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Yersinia pseudotuberculosis serotype I (strain IP32953)
Q6A6X6 3.02e-26 107 28 5 234 3 metN Methionine import ATP-binding protein MetN Cutibacterium acnes (strain DSM 16379 / KPA171202)
Q1CJS9 3.07e-26 107 28 7 251 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZCM2 3.07e-26 107 28 7 251 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Yersinia pestis
Q1C607 3.07e-26 107 28 7 251 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Yersinia pestis bv. Antiqua (strain Antiqua)
Q7MFC4 3.27e-26 107 29 3 225 3 malK Maltose/maltodextrin import ATP-binding protein MalK Vibrio vulnificus (strain YJ016)
Q8D3V0 3.27e-26 107 29 3 225 3 malK Maltose/maltodextrin import ATP-binding protein MalK Vibrio vulnificus (strain CMCP6)
Q73DH7 3.39e-26 108 28 3 232 3 rbsA Ribose import ATP-binding protein RbsA Bacillus cereus (strain ATCC 10987 / NRS 248)
Q73DH7 2.61e-12 69 25 3 203 3 rbsA Ribose import ATP-binding protein RbsA Bacillus cereus (strain ATCC 10987 / NRS 248)
Q5ZWE4 3.44e-26 107 29 6 244 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q9CM80 3.44e-26 107 29 3 223 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Pasteurella multocida (strain Pm70)
Q47MA5 3.44e-26 105 30 3 234 3 hmuV Hemin import ATP-binding protein HmuV Thermobifida fusca (strain YX)
Q02R79 3.64e-26 107 30 3 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Pseudomonas aeruginosa (strain UCBPP-PA14)
Q8RI39 3.64e-26 107 29 7 229 3 potA Spermidine/putrescine import ATP-binding protein PotA Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q578K3 3.65e-26 107 31 3 219 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella abortus biovar 1 (strain 9-941)
Q2YKX3 3.65e-26 107 31 3 219 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella abortus (strain 2308)
Q4FLF6 3.69e-26 105 32 7 237 3 pstB Phosphate import ATP-binding protein PstB Pelagibacter ubique (strain HTCC1062)
P78363 3.9e-26 110 30 5 218 1 ABCA4 Retinal-specific phospholipid-transporting ATPase ABCA4 Homo sapiens
P78363 3.86e-21 95 30 3 220 1 ABCA4 Retinal-specific phospholipid-transporting ATPase ABCA4 Homo sapiens
P45031 3.91e-26 105 31 5 242 1 mlaF Intermembrane phospholipid transport system ATP-binding protein MlaF Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q5WXF0 4.13e-26 107 29 6 244 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila (strain Lens)
P50332 4.23e-26 107 32 3 212 3 nodI Nod factor export ATP-binding protein I Neorhizobium galegae
P9WQL3 4.33e-26 107 31 5 215 1 modC Molybdenum import ATP-binding protein ModC Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQL2 4.33e-26 107 31 5 215 3 modC Molybdenum import ATP-binding protein ModC Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P44531 4.34e-26 106 29 3 223 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q0BMC9 4.38e-26 107 30 4 234 3 metN Methionine import ATP-binding protein MetN Francisella tularensis subsp. holarctica (strain OSU18)
Q2A3Z2 4.38e-26 107 30 4 234 3 metN Methionine import ATP-binding protein MetN Francisella tularensis subsp. holarctica (strain LVS)
Q9HY19 4.38e-26 107 30 3 223 3 potA2 Spermidine/putrescine import ATP-binding protein PotA 2 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q5L222 4.43e-26 107 28 5 239 3 potA Spermidine/putrescine import ATP-binding protein PotA Geobacillus kaustophilus (strain HTA426)
Q1LQF6 4.58e-26 107 31 5 223 3 metN Methionine import ATP-binding protein MetN Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
F1MWM0 4.63e-26 109 31 5 218 1 ABCA4 Retinal-specific phospholipid-transporting ATPase ABCA4 Bos taurus
F1MWM0 1.28e-20 94 30 3 220 1 ABCA4 Retinal-specific phospholipid-transporting ATPase ABCA4 Bos taurus
Q8EPK1 4.83e-26 106 30 7 244 3 metN1 Methionine import ATP-binding protein MetN 1 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q88RL1 5.16e-26 105 30 5 226 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
P08720 5.27e-26 106 30 4 226 3 nodI Nod factor export ATP-binding protein I Rhizobium leguminosarum bv. viciae
P63386 5.28e-26 105 32 3 222 1 mlaF Intermembrane phospholipid transport system ATP-binding protein MlaF Escherichia coli (strain K12)
P63387 5.28e-26 105 32 3 222 3 mlaF Intermembrane phospholipid transport system ATP-binding protein MlaF Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P63388 5.28e-26 105 32 3 222 3 mlaF Intermembrane phospholipid transport system ATP-binding protein MlaF Escherichia coli O157:H7
Q0K9I2 5.3e-26 105 30 5 215 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q7AH43 5.5e-26 106 28 3 223 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Escherichia coli O157:H7
Q64SQ6 5.65e-26 108 28 5 240 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides fragilis (strain YCH46)
Q14H97 5.78e-26 106 30 4 234 3 metN Methionine import ATP-binding protein MetN Francisella tularensis subsp. tularensis (strain FSC 198)
Q5XDS8 5.82e-26 106 31 6 219 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q4K5Z7 5.91e-26 104 29 4 237 3 hmuV Hemin import ATP-binding protein HmuV Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q7MFH3 6.04e-26 108 30 5 229 3 VVA0347 Putative ABC transporter ATP-binding protein VVA0347 Vibrio vulnificus (strain YJ016)
Q7MFH3 1.55e-13 72 26 5 215 3 VVA0347 Putative ABC transporter ATP-binding protein VVA0347 Vibrio vulnificus (strain YJ016)
Q98GF5 6.17e-26 105 31 8 247 3 phnC Phosphonates import ATP-binding protein PhnC Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q5LBT4 6.36e-26 108 28 5 240 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
Q5E715 6.5e-26 106 30 4 216 3 metN Methionine import ATP-binding protein MetN Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q0ASG3 6.69e-26 104 31 9 247 3 pstB Phosphate import ATP-binding protein PstB Maricaulis maris (strain MCS10)
Q81IZ6 6.69e-26 106 29 5 236 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q5ZUG5 7.1e-26 106 28 3 211 3 metN Methionine import ATP-binding protein MetN Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
P22040 7.36e-26 106 29 4 223 3 sll0415 Uncharacterized ABC transporter ATP-binding protein sll0415 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q7N8B9 7.9e-26 106 29 3 223 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q93DA2 8.08e-26 106 31 6 225 3 metN Methionine import ATP-binding protein MetN Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
A0LUE6 8.13e-26 107 32 6 227 3 potA Spermidine/putrescine import ATP-binding protein PotA Acidothermus cellulolyticus (strain ATCC 43068 / DSM 8971 / 11B)
Q6CZ34 8.17e-26 106 31 6 229 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q31DV4 8.35e-26 104 33 7 230 3 phnC Phosphonates import ATP-binding protein PhnC Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
P37009 8.55e-26 106 29 3 223 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Escherichia coli (strain K12)
P0CZ31 8.59e-26 106 31 6 219 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M3 (strain SSI-1)
P0CZ30 8.59e-26 106 31 6 219 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q832R5 9.01e-26 108 28 4 232 3 EF_2153 Putative ABC transporter ATP-binding protein EF_2153 Enterococcus faecalis (strain ATCC 700802 / V583)
Q832R5 4.52e-12 68 26 6 222 3 EF_2153 Putative ABC transporter ATP-binding protein EF_2153 Enterococcus faecalis (strain ATCC 700802 / V583)
Q1JNE0 9.14e-26 106 31 6 219 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1JDG6 9.14e-26 106 31 6 219 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M12 (strain MGAS2096)
Q8UIW7 9.24e-26 105 29 6 241 3 phnC Phosphonates import ATP-binding protein PhnC Agrobacterium fabrum (strain C58 / ATCC 33970)
Q46YX6 9.76e-26 105 33 3 230 3 nodI Nod factor export ATP-binding protein I Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q48V78 1.04e-25 106 31 6 219 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M28 (strain MGAS6180)
Q9A1E3 1.04e-25 106 31 6 219 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M1
Q5NFU5 1.06e-25 105 30 4 234 3 metN Methionine import ATP-binding protein MetN Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
P0DTT6 1.07e-25 103 29 2 224 1 xylG Xylose/arabinose import ATP-binding protein XylG Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770)
Q9KIF7 1.07e-25 107 30 4 218 3 opuAA Glycine betaine transport ATP-binding protein OpuAA Lactococcus lactis subsp. lactis (strain IL1403)
Q6D4A8 1.08e-25 103 29 5 224 3 znuC Zinc import ATP-binding protein ZnuC Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q5WKL3 1.1e-25 105 29 3 216 3 metN1 Methionine import ATP-binding protein MetN 1 Shouchella clausii (strain KSM-K16)
Q9YGA6 1.12e-25 106 30 4 231 1 malK Trehalose/maltose import ATP-binding protein MalK Thermococcus litoralis (strain ATCC 51850 / DSM 5473 / JCM 8560 / NS-C)
Q56953 1.14e-25 104 29 5 239 3 yfeB Chelated iron transport system membrane protein YfeB Yersinia pestis
Q6YRJ4 1.17e-25 108 26 5 230 3 PAM_020 Putative ABC transporter ATP-binding protein PAM_020 Onion yellows phytoplasma (strain OY-M)
Q6YRJ4 3.45e-09 60 22 7 224 3 PAM_020 Putative ABC transporter ATP-binding protein PAM_020 Onion yellows phytoplasma (strain OY-M)
Q57293 1.19e-25 105 30 3 215 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Actinobacillus pleuropneumoniae
Q5WVL8 1.2e-25 105 27 3 211 3 metN Methionine import ATP-binding protein MetN Legionella pneumophila (strain Lens)
Q03P57 1.23e-25 105 32 4 211 3 metN Methionine import ATP-binding protein MetN Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
Q81HW8 1.24e-25 107 28 3 219 3 rbsA Ribose import ATP-binding protein RbsA Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q81HW8 6.9e-14 73 25 3 203 3 rbsA Ribose import ATP-binding protein RbsA Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
O34314 1.31e-25 103 28 4 216 3 ytlC Uncharacterized ABC transporter ATP-binding protein YtlC Bacillus subtilis (strain 168)
Q87SV4 1.34e-25 103 31 3 209 3 thiQ Thiamine import ATP-binding protein ThiQ Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q9HYL7 1.37e-25 104 32 8 254 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q5X627 1.37e-25 105 29 6 244 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila (strain Paris)
Q87UI3 1.41e-25 103 29 5 219 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
A1JIE0 1.46e-25 105 30 4 226 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS18155
Feature type CDS
Gene lptB
Product LPS export ABC transporter ATP-binding protein
Location 3986821 - 3987546 (strand: -1)
Length 726 (nucleotides) / 241 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_734
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00005 ABC transporter
PF12399 Branched-chain amino acid ATP-binding cassette transporter

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1137 Cell wall/membrane/envelope biogenesis (M) M ABC-type lipopolysaccharide export system, ATPase component

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K06861 lipopolysaccharide export system ATP-binding protein [EC:7.5.2.5] ABC transporters -

Protein Sequence

MALLKAENLAKAYKGRTVVGDVSLNVNSGEIVGLLGPNGAGKTTTFYMVVGIVARDAGSITIDDEDITLLPLHERARKGIGYLPQEASIFRRLSVYDNIMGILEIRHDLTAEQRKDRAEELLEEFNVSHLRNSLGQSLSGGERRRVEIARALAANPKFILLDEPFAGVDPISVLDIKKIIQHLRDYGLGVLITDHNVRETLDVCERAYIVSQGHLIAHGSPEEILANEQVKRVYLGEGFRL

Flanking regions ( +/- flanking 50bp)

AGTTACAAGAGAAAGGTCCCGGTGTTAACAACAAAGGTAAGTAACACTTTATGGCGCTGTTAAAAGCTGAAAATTTAGCAAAAGCATACAAAGGGCGCACCGTTGTCGGTGATGTGAGCCTCAATGTTAACTCCGGTGAGATTGTTGGCTTACTTGGCCCTAACGGTGCGGGGAAAACCACCACCTTTTATATGGTGGTAGGTATTGTCGCCCGTGATGCGGGTAGCATTACTATCGACGATGAAGATATTACCTTACTCCCGTTACATGAGCGTGCGCGTAAGGGTATTGGTTATTTGCCACAAGAAGCCTCTATTTTTAGACGCTTAAGCGTTTATGACAATATCATGGGAATTTTAGAAATACGCCATGATTTAACGGCCGAACAACGAAAAGATCGTGCAGAAGAGCTACTTGAAGAGTTTAATGTCAGTCACTTACGTAATAGTTTAGGGCAATCTTTATCAGGGGGTGAACGCCGTCGTGTAGAGATAGCACGGGCGCTAGCGGCAAATCCTAAATTTATTTTATTGGATGAGCCTTTTGCCGGTGTTGACCCTATTTCCGTTTTAGATATTAAGAAAATTATCCAACATCTACGCGATTATGGCTTGGGCGTATTAATTACCGACCATAATGTACGCGAAACCTTAGATGTGTGTGAACGTGCTTATATCGTCAGTCAAGGACACCTTATTGCCCATGGTTCACCAGAAGAAATTTTGGCAAATGAGCAAGTTAAACGTGTTTACTTAGGTGAAGGCTTCCGCCTGTGATCTGAGTGACACTTTTATTTCGTCACGGATGACAACATAAGAGGATCCAT