Homologs in group_2483

Help

5 homologs were identified in 5 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_01075 FBDBKF_01075 100.0 Morganella morganii S1 uspA Nucleotide-binding universal stress protein, UspA family
EHELCC_00470 EHELCC_00470 100.0 Morganella morganii S2 uspA Nucleotide-binding universal stress protein, UspA family
NLDBIP_02990 NLDBIP_02990 100.0 Morganella morganii S4 uspA Nucleotide-binding universal stress protein, UspA family
HKOGLL_02540 HKOGLL_02540 100.0 Morganella morganii S5 uspA Nucleotide-binding universal stress protein, UspA family
F4V73_RS07895 F4V73_RS07895 82.3 Morganella psychrotolerans - universal stress protein

Distribution of the homologs in the orthogroup group_2483

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2483

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P67091 5.09e-21 85 34 4 152 1 uspF Universal stress protein F Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P67092 5.09e-21 85 34 4 152 3 uspF Universal stress protein F Salmonella typhi
P37903 1.55e-19 82 32 3 152 1 uspF Universal stress protein F Escherichia coli (strain K12)
P0A4P8 6.27e-19 80 32 3 152 3 uspF Universal stress protein F Shigella flexneri
P0A4P6 6.27e-19 80 32 3 152 3 uspF Universal stress protein F Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TI19 6.27e-19 80 32 3 152 3 uspF Universal stress protein F Escherichia coli O6:K15:H31 (strain 536 / UPEC)
P0A4P7 6.27e-19 80 32 3 152 3 uspF Universal stress protein F Escherichia coli O157:H7
P39177 8.7e-16 72 32 4 150 1 uspG Universal stress protein UP12 Escherichia coli (strain K12)
Q8XBT3 3.11e-15 70 32 4 150 3 uspG Universal stress protein G Escherichia coli O157:H7
Q83M07 4.06e-15 70 32 4 150 3 uspG Universal stress protein G Shigella flexneri
Q8FK07 8.47e-15 69 32 4 150 3 uspG Universal stress protein G Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P67093 5.81e-13 65 30 4 150 3 uspG Universal stress protein G Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P67094 5.81e-13 65 30 4 150 3 uspG Universal stress protein G Salmonella typhi
Q83AC1 5.86e-06 46 30 5 148 3 uspA1 Universal stress protein A homolog 1 Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
Q57951 6.12e-06 47 32 6 153 3 MJ0531 Universal stress protein MJ0531 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P45680 0.000266 42 24 5 147 1 uspA2 Universal stress protein A homolog 2 Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
O07552 0.000539 41 38 2 65 2 nhaX Stress response protein NhaX Bacillus subtilis (strain 168)

  • Number of RefSeq hits:

General

Source Morganella morganii S3
Locus tag LHKJJB_04505
Feature type CDS
Gene uspA
Product Nucleotide-binding universal stress protein, UspA family
Location 174712 - 175155 (strand: 1)
Length 444 (nucleotides) / 147 (amino acids)

Contig

Accession ZDB_361
Length 286024 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2483
Orthogroup size 6
N. genomes 6

Actions

Genomic region

Domains

PF00582 Universal stress protein family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0589 Signal transduction mechanisms (T) T Nucleotide-binding universal stress protein, UspA family

Protein Sequence

MHKIILVPIDLNAGALSQNVITEINDYAKDKNVKFHFVTVILPSEQLFDYGLTFPVMTENAKSEDQRIKALLEKLDAATEKFAVQKEQISTGVLIGSAAEAILDNAERIKADLIVIGSKNPTMKSRFLGSTASALIHYANISVLVVR

Flanking regions ( +/- flanking 50bp)

ATTAACACTCATCTTTTACAGGTCATTTAATCTGAAATAAAGGAGTTGTTATGCATAAAATTATACTGGTTCCGATCGATCTGAATGCCGGTGCGTTATCTCAGAACGTCATTACTGAGATTAACGACTATGCCAAAGATAAAAATGTGAAATTTCATTTCGTTACGGTAATTCTTCCGTCTGAACAGCTTTTTGACTATGGTCTGACATTCCCTGTGATGACCGAAAATGCCAAGTCAGAAGACCAGCGCATCAAAGCTCTGCTTGAAAAACTGGATGCCGCCACCGAAAAATTTGCTGTACAGAAAGAACAGATTTCCACCGGTGTACTTATCGGAAGTGCGGCAGAGGCCATTCTTGATAATGCAGAAAGAATTAAAGCCGACCTGATTGTTATCGGTTCCAAAAACCCGACCATGAAAAGCCGTTTCCTGGGCTCCACCGCGTCCGCACTGATCCACTACGCCAATATCTCAGTCCTTGTTGTCCGGTAAAAAAGCAAAAGCCCGGATTACCGGGCTTTTGAGACTGAATTCACTGATAA