Homologs in group_970

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_04755 FBDBKF_04755 100.0 Morganella morganii S1 agaV PTS N-acetylgalactosamine transporter subunit IIB
EHELCC_06045 EHELCC_06045 100.0 Morganella morganii S2 agaV PTS N-acetylgalactosamine transporter subunit IIB
NLDBIP_06365 NLDBIP_06365 100.0 Morganella morganii S4 agaV PTS N-acetylgalactosamine transporter subunit IIB
HKOGLL_06720 HKOGLL_06720 100.0 Morganella morganii S5 agaV PTS N-acetylgalactosamine transporter subunit IIB
F4V73_RS09225 F4V73_RS09225 95.5 Morganella psychrotolerans agaV PTS N-acetylgalactosamine transporter subunit IIB
PMI_RS10535 PMI_RS10535 51.6 Proteus mirabilis HI4320 agaV PTS N-acetylgalactosamine transporter subunit IIB

Distribution of the homologs in the orthogroup group_970

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_970

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P42904 1.03e-98 283 87 0 157 4 agaV N-acetylgalactosamine-specific phosphotransferase enzyme IIB component 2 Escherichia coli (strain K12)
P42909 6.67e-41 137 46 1 153 4 agaB N-acetylgalactosamine-specific phosphotransferase enzyme IIB component 1 Escherichia coli (strain K12)
P26380 1.65e-30 111 32 1 158 1 levE PTS system fructose-specific EIIB component Bacillus subtilis (strain 168)
Q9RGG4 3.51e-29 107 34 1 152 1 sorB PTS system sorbose-specific EIIB component Lacticaseibacillus casei
P69800 1.11e-26 105 36 2 157 3 manX PTS system mannose-specific EIIAB component Shigella flexneri
P69797 1.11e-26 105 36 2 157 1 manX PTS system mannose-specific EIIAB component Escherichia coli (strain K12)
P69798 1.11e-26 105 36 2 157 3 manX PTS system mannose-specific EIIAB component Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P69799 1.11e-26 105 36 2 157 3 manX PTS system mannose-specific EIIAB component Escherichia coli O157:H7
P37081 6.79e-26 99 33 1 152 1 sorB PTS system sorbose-specific EIIB component Klebsiella pneumoniae
Q5XAF5 5.07e-25 100 32 2 162 1 manX PTS system mannose-specific EIIAB component Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q5XCC7 3.03e-09 55 31 2 102 1 M6_Spy0801 Probable phosphotransferase enzyme IIB component M6_Spy0801 Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)

  • Number of RefSeq hits:

General

Source Morganella morganii S3
Locus tag LHKJJB_03245
Feature type CDS
Gene agaV
Product PTS N-acetylgalactosamine transporter subunit IIB
Location 231590 - 232063 (strand: 1)
Length 474 (nucleotides) / 157 (amino acids)
In genomic island -

Contig

Accession ZDB_360
Length 302856 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_970
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF03830 PTS system sorbose subfamily IIB component

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG3444 Carbohydrate transport and metabolism (G) G Phosphotransferase system, mannose/fructose/N-acetylgalactosamine-specific component IIB

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K02745 N-acetylgalactosamine PTS system EIIB component [EC:2.7.1.-] Galactose metabolism
Amino sugar and nucleotide sugar metabolism
Metabolic pathways
Phosphotransferase system (PTS)
-

Protein Sequence

MPNIVLSRIDERLIHGQVGVQWVGFAGANLVLVANDEVAEDPLQQNLMEMVLTEGIAVRFWPLQKVIDNIHKAADRQKILLVCKTPADFLTLVKGGVPVERINVGNIHYTEGKRQIAKTVSVDEADIAAFRGLNEAGVACYIQGVPTEPAQDLFKLL

Flanking regions ( +/- flanking 50bp)

TATCACGATGCCTGTAAAACCATGCCTGCCGATAAGAGCGAGAAACAGCCATGCCAAATATTGTGTTAAGTCGTATTGATGAACGGTTAATCCACGGACAGGTTGGTGTCCAGTGGGTGGGATTTGCCGGTGCCAACCTGGTGCTGGTCGCCAATGATGAGGTGGCGGAAGATCCGCTGCAGCAAAACCTGATGGAAATGGTGCTGACGGAAGGGATTGCCGTGCGTTTCTGGCCGCTCCAGAAAGTGATCGACAATATTCATAAAGCTGCTGACCGCCAGAAAATTCTGCTGGTCTGCAAAACCCCGGCAGATTTTCTGACTCTGGTGAAAGGCGGCGTTCCGGTGGAACGCATTAACGTCGGCAATATTCACTATACCGAAGGCAAGCGTCAGATTGCCAAAACCGTGTCTGTGGATGAGGCGGATATCGCCGCATTCCGCGGGCTTAACGAGGCCGGTGTCGCCTGTTATATCCAGGGCGTACCGACAGAACCGGCGCAGGATCTGTTTAAACTGCTCTGAGGATACATGTATGGAAATCAGTCTGTTACAAGCTATCGCTCTCGGGCTGG