Homologs in group_2675

Help

5 homologs were identified in 5 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_04390 FBDBKF_04390 100.0 Morganella morganii S1 ilvN acetolactate synthase small subunit
EHELCC_05680 EHELCC_05680 100.0 Morganella morganii S2 ilvN acetolactate synthase small subunit
NLDBIP_06000 NLDBIP_06000 100.0 Morganella morganii S4 ilvN acetolactate synthase small subunit
HKOGLL_06355 HKOGLL_06355 100.0 Morganella morganii S5 ilvN acetolactate synthase small subunit
F4V73_RS08835 F4V73_RS08835 97.5 Morganella psychrotolerans ilvN acetolactate synthase small subunit

Distribution of the homologs in the orthogroup group_2675

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2675

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P21622 5.11e-91 265 77 0 163 3 ilvH Acetolactate synthase isozyme 3 small subunit Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P00894 5.9e-91 264 77 0 163 1 ilvH Acetolactate synthase isozyme 3 small subunit Escherichia coli (strain K12)
P57320 7.61e-74 221 62 0 158 3 ilvH Acetolactate synthase small subunit Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
O85294 2.13e-72 217 62 0 158 3 ilvH Acetolactate synthase small subunit Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
P45260 2.43e-72 217 63 0 160 3 ilvH Acetolactate synthase small subunit Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q89AP8 7.08e-55 173 51 0 157 3 ilvH Acetolactate synthase small subunit Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
O27492 7.06e-49 158 50 2 161 3 ilvH Probable acetolactate synthase small subunit Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
Q57625 1.57e-43 144 42 2 163 3 ilvH Probable acetolactate synthase small subunit Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
O28555 3.11e-42 141 43 2 160 3 ilvH Probable acetolactate synthase small subunit Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
O67703 1.09e-38 133 41 2 157 3 ilvH Acetolactate synthase small subunit Aquifex aeolicus (strain VF5)
Q9TLY1 3.18e-38 131 39 1 161 3 ilvH Acetolactate synthase small subunit Cyanidium caldarium
Q9MS98 8.51e-37 128 36 1 161 3 ilvH Acetolactate synthase small subunit Galdieria sulphuraria
P51230 6.9e-36 125 39 1 161 3 ilvH Acetolactate synthase small subunit Porphyra purpurea
O78451 4.76e-35 123 37 1 161 3 ilvH Acetolactate synthase small subunit Guillardia theta
A0QUX7 5.22e-35 123 39 1 156 1 ilvH Acetolactate synthase small subunit Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q1XDQ7 5.72e-35 123 39 1 161 3 ilvH Acetolactate synthase small subunit Neopyropia yezoensis
P9WKJ3 6.2e-35 122 41 1 156 1 ilvH Putative acetolactate synthase small subunit Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WKJ2 6.2e-35 122 41 1 156 3 ilvH Putative acetolactate synthase small subunit Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P65162 6.2e-35 122 41 1 156 3 ilvH Acetolactate synthase small subunit Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q55141 1.52e-34 122 39 1 157 3 ilvH Acetolactate synthase small subunit Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
O33113 5e-33 118 38 1 156 3 ilvH Acetolactate synthase small subunit Mycobacterium leprae (strain TN)
P37252 4.3e-32 115 37 3 162 3 ilvH Acetolactate synthase small subunit Bacillus subtilis (strain 168)
Q9FFF4 1.21e-31 120 41 2 156 1 AHASS2 Acetolactate synthase small subunit 2, chloroplastic Arabidopsis thaliana
Q9FFF4 1.48e-20 90 32 1 153 1 AHASS2 Acetolactate synthase small subunit 2, chloroplastic Arabidopsis thaliana
Q59499 8.89e-30 109 39 0 131 3 ilvH Acetolactate synthase small subunit Mycobacterium avium
Q02140 6.14e-28 104 39 2 159 3 ilvH Acetolactate synthase small subunit Lactococcus lactis subsp. lactis (strain IL1403)
Q93YZ7 1.07e-27 110 37 2 156 1 AHASS1 Acetolactate synthase small subunit 1, chloroplastic Arabidopsis thaliana
Q93YZ7 1.75e-20 90 35 1 153 1 AHASS1 Acetolactate synthase small subunit 1, chloroplastic Arabidopsis thaliana
Q9SMC2 5.42e-26 105 39 2 153 2 None Acetolactate synthase small subunit 1, chloroplastic Nicotiana plumbaginifolia
Q9SMC2 7.19e-18 82 33 1 148 2 None Acetolactate synthase small subunit 1, chloroplastic Nicotiana plumbaginifolia
O60086 2.34e-20 88 26 3 199 1 SPBC14C8.04 Probable acetolactate synthase small subunit Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P25605 3.03e-17 80 26 3 205 1 ILV6 Acetolactate synthase small subunit, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P0ADF8 1.1e-07 50 35 1 70 1 ilvN Acetolactate synthase isozyme 1 small subunit Escherichia coli (strain K12)
P0ADF9 1.1e-07 50 35 1 70 3 ilvN Acetolactate synthase isozyme 1 small subunit Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0ADG0 1.1e-07 50 35 1 70 3 ilvN Acetolactate synthase isozyme 1 small subunit Escherichia coli O157:H7

  • Number of RefSeq hits:

General

Source Morganella morganii S3
Locus tag LHKJJB_02880
Feature type CDS
Gene ilvN
Product acetolactate synthase small subunit
Location 146369 - 146860 (strand: -1)
Length 492 (nucleotides) / 163 (amino acids)
In genomic island -

Contig

Accession ZDB_360
Length 302856 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2675
Orthogroup size 6
N. genomes 6

Actions

Genomic region

Domains

PF10369 Small subunit of acetolactate synthase
PF22629 AHAS-like ACT domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0440 Amino acid transport and metabolism (E) E Acetolactate synthase, small subunit

Kegg Ortholog Annotation(s)

Protein Sequence

MRRILSILLENETGALSRVAGLFSQRGYNIESITAAPTDDPSLFRLTIQTKGDARVLEQIEKQLNKLVDVFRVTELTSATHIEREVMLVKLQASGYGRDEVKRSTDIFRGQIVDVTATLYTVQLTGTSEKLDAFLDAVRGFAEIVEIARSGIVGMSRGDKIMR

Flanking regions ( +/- flanking 50bp)

AATGGCGGAATGGATGAAATGTGGTTAAGCAAAACGGAGAGGACCTGATCATGCGCCGGATTCTGTCAATTTTATTAGAAAACGAAACAGGGGCGCTGTCCCGTGTGGCAGGGCTTTTTTCCCAGCGCGGGTATAATATCGAAAGTATCACCGCCGCCCCGACCGATGACCCGTCACTGTTCCGTCTGACCATCCAGACCAAAGGCGATGCGCGGGTGCTGGAGCAGATTGAAAAGCAGCTCAATAAGCTGGTGGATGTGTTCCGTGTCACAGAACTGACCTCTGCCACTCACATTGAGCGCGAGGTGATGCTGGTGAAATTACAGGCCAGCGGCTACGGGCGGGATGAGGTCAAACGCAGTACGGATATCTTCCGCGGACAGATTGTCGATGTGACCGCGACGCTTTATACCGTGCAACTGACCGGCACCAGTGAAAAGCTGGATGCCTTCCTGGATGCGGTGCGCGGCTTCGCGGAAATTGTGGAAATTGCCCGCTCCGGCATCGTCGGGATGTCGCGCGGCGATAAAATAATGCGGTGAAATATTCGCGGTGAAAGGGTAAACTGATCACTCTTCTTATTTGGCCCGTT