Homologs in group_670

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_02400 FBDBKF_02400 100.0 Morganella morganii S1 fnr Fumarate and nitrate reduction regulatory protein
EHELCC_02870 EHELCC_02870 100.0 Morganella morganii S2 fnr Fumarate and nitrate reduction regulatory protein
NLDBIP_00590 NLDBIP_00590 100.0 Morganella morganii S4 fnr Fumarate and nitrate reduction regulatory protein
HKOGLL_01485 HKOGLL_01485 100.0 Morganella morganii S5 fnr Fumarate and nitrate reduction regulatory protein
F4V73_RS04780 F4V73_RS04780 99.6 Morganella psychrotolerans fnr fumarate/nitrate reduction transcriptional regulator Fnr
PMI_RS05805 PMI_RS05805 94.8 Proteus mirabilis HI4320 - FNR family transcription factor

Distribution of the homologs in the orthogroup group_670

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_670

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0A2T8 1.95e-172 478 94 0 244 3 fnr Fumarate and nitrate reduction regulatory protein Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2T9 1.95e-172 478 94 0 244 3 fnr Fumarate and nitrate reduction regulatory protein Salmonella muenster
Q8Z787 7.66e-172 476 93 0 244 3 fnr Fumarate and nitrate reduction regulatory protein Salmonella typhi
P0A9E8 2.42e-171 475 93 0 244 3 fnr Fumarate and nitrate reduction regulatory protein Shigella flexneri
P0A9E5 2.42e-171 475 93 0 244 1 fnr Fumarate and nitrate reduction regulatory protein Escherichia coli (strain K12)
P0A9E6 2.42e-171 475 93 0 244 3 fnr Fumarate and nitrate reduction regulatory protein Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9E7 2.42e-171 475 93 0 244 3 fnr Fumarate and nitrate reduction regulatory protein Escherichia coli O157:H7
Q9AQ50 2.89e-171 474 93 0 246 3 fnr Fumarate nitrate reduction regulatory protein Klebsiella oxytoca
Q9LA24 1.14e-169 471 93 0 244 3 fnr Fumarate and nitrate reduction regulatory protein Shigella dysenteriae
Q8ZE82 1.06e-168 468 92 0 245 3 fnr Fumarate and nitrate reduction regulatory protein Yersinia pestis
P0C6D0 2.69e-156 437 86 0 244 3 fnr Fumarate and nitrate reduction regulatory protein Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F890 2.69e-156 437 86 0 244 3 fnr Fumarate and nitrate reduction regulatory protein Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q9EXQ1 2.23e-149 419 82 0 241 2 fnr Anaerobic regulatory protein Aggregatibacter actinomycetemcomitans
Q9CMY2 3.2e-146 412 81 0 241 3 fnr Anaerobic regulatory protein Pasteurella multocida (strain Pm70)
P45199 1.27e-143 405 80 0 236 3 fnr Anaerobic regulatory protein Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P46148 1.12e-134 382 75 0 246 3 etrA Electron transport regulator A Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
P23619 1.2e-131 374 76 0 226 4 hlyX Regulatory protein HlyX Actinobacillus pleuropneumoniae
P23926 2.48e-91 272 53 0 226 4 anr Transcriptional activator protein anr Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
O85222 2.59e-91 272 53 0 226 2 anr Transcriptional activator protein Anr Pseudomonas protegens (strain DSM 19095 / LMG 27888 / CFBP 6595 / CHA0)
P47200 5.75e-91 271 53 0 226 4 fnrA Transcriptional activator protein FnrA Stutzerimonas stutzeri
Q08530 4.94e-61 195 39 0 237 4 btr Transcriptional regulatory protein btr Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q46158 1.6e-58 183 95 0 92 2 fnr Anaerobic regulatory protein (Fragment) Capnocytophaga ochracea (strain ATCC 27872 / DSM 7271 / CCUG 9716 / JCM 12966 / NCTC 12371 / SS31 / VPI 2845)
Q46159 9.7e-58 181 94 0 92 2 fnr Anaerobic regulatory protein (Fragment) Capnocytophaga sputigena
Q47948 1.48e-51 166 85 0 92 2 fnr Anaerobic regulatory protein (Fragment) Aggregatibacter aphrophilus
P29286 1.86e-26 105 27 2 225 2 fixK Nitrogen fixation regulation protein FixK Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
P24290 1.44e-22 95 26 3 226 4 fnrN Probable transcriptional activator Rhizobium leguminosarum bv. viciae
P51007 1.49e-22 95 26 4 230 4 fnrL Transcriptional activator protein FnrL Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
P13295 7.16e-21 90 29 6 194 4 fixK Nitrogen fixation regulation protein FixK Rhizobium meliloti (strain 1021)
Q01980 2.06e-18 84 25 3 229 1 aadR Transcriptional activatory protein AadR Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
P26488 1.17e-14 74 31 4 159 2 fixK Nitrogen fixation regulation protein FixK Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
P29284 1.45e-10 62 24 5 211 4 flp Probable transcriptional regulator flp Lacticaseibacillus casei
P0A2T6 7.33e-09 57 23 2 179 1 crp cAMP-activated global transcriptional regulator CRP Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2T7 7.33e-09 57 23 2 179 1 crp cAMP-activated global transcriptional regulator CRP Klebsiella aerogenes
P0ACK1 1.02e-08 57 23 2 179 3 crp cAMP-activated global transcriptional regulator CRP Shigella flexneri
P0ACJ8 1.02e-08 57 23 2 179 1 crp DNA-binding transcriptional dual regulator CRP Escherichia coli (strain K12)
P0ACJ9 1.02e-08 57 23 2 179 3 crp cAMP-activated global transcriptional regulator CRP Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0ACK0 1.02e-08 57 23 2 179 3 crp cAMP-activated global transcriptional regulator CRP Escherichia coli O157:H7
P29283 1.28e-08 57 23 1 184 1 ntcA Global nitrogen regulator Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P33779 6.55e-08 55 22 1 185 4 ntcA Global nitrogen regulator Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P0A4U7 1.09e-07 54 22 1 185 4 ntcA Global nitrogen regulator Trichormus variabilis (strain ATCC 29413 / PCC 7937)
P0A4U6 1.09e-07 54 22 1 185 1 ntcA Global nitrogen regulator Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
P55222 3.82e-07 52 22 3 211 1 vfr cAMP-activated global transcriptional regulator Vfr Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P46908 1.66e-06 51 26 5 194 2 fnr Anaerobic regulatory protein Bacillus subtilis (strain 168)
O05689 1.71e-06 50 20 2 179 3 crp cAMP-activated global transcriptional regulator CRP Pasteurella multocida (strain Pm70)
P29281 2.24e-06 50 20 2 178 1 crp cAMP-activated global transcriptional regulator CRP Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P27369 1.9e-05 47 24 4 180 2 cysR Regulatory protein CysR Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q79VI7 7.2e-05 46 21 2 202 1 glxR CRP-like cAMP-activated global transcriptional regulator Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q3TRM4 0.000207 45 23 2 115 1 Pnpla6 Patatin-like phospholipase domain-containing protein 6 Mus musculus
Q8IY17 0.000229 45 23 2 115 1 PNPLA6 Patatin-like phospholipase domain-containing protein 6 Homo sapiens
Q5RDS0 0.000239 45 23 2 115 2 PNPLA6 Patatin-like phospholipase domain-containing protein 6 Pongo abelii
P9WMH3 0.000428 43 21 1 188 1 crp CRP-like cAMP-activated global transcriptional regulator Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WMH2 0.000428 43 21 1 188 1 crp CRP-like cAMP-activated global transcriptional regulator Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A643 0.000474 44 26 4 116 3 BQ2027_MB2594 Uncharacterized NTE family protein Mb2594 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WIY7 0.000474 44 26 4 116 1 Rv2565 Uncharacterized NTE family protein Rv2565 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WIY6 0.000483 44 26 4 116 3 MT2641 Uncharacterized NTE family protein MT2641 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A2AJ88 0.000627 44 22 1 103 1 Pnpla7 Patatin-like phospholipase domain-containing protein 7 Mus musculus
Q5BK26 0.000799 44 22 1 103 1 Pnpla7 Patatin-like phospholipase domain-containing protein 7 Rattus norvegicus
Q6ZV29 0.000826 44 22 1 103 1 PNPLA7 Patatin-like phospholipase domain-containing protein 7 Homo sapiens

  • Number of RefSeq hits:

General

Source Morganella morganii S3
Locus tag LHKJJB_01445
Feature type CDS
Gene fnr
Product Fumarate and nitrate reduction regulatory protein
Location 274759 - 275517 (strand: -1)
Length 759 (nucleotides) / 252 (amino acids)

Contig

Accession ZDB_359
Length 392768 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_670
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00027 Cyclic nucleotide-binding domain
PF13545 Crp-like helix-turn-helix domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0664 Signal transduction mechanisms (T) T cAMP-binding domain of CRP or a regulatory subunit of cAMP-dependent protein kinases

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K01420 CRP/FNR family transcriptional regulator, anaerobic regulatory protein - -

Protein Sequence

MIPEKRVVRRIQSGGCAIHCQDCSISQLCIPFTLNEHELDQLDNIIERKKPIQKGQALFKAGDELKSLYAIRSGTIKSYTITEEGDEQITGFHLAGDLVGFDAIINTEHPSFAQALETSMVCEIPYETLDDLSGKMPNLRQQMMRLMSGEIKGDQEMILLLSKKNAEERLAAFIYNLSRRFAQRGFSPREFRLTMTRGDIGNYLGLTVETISRLLGRFQKSGMLAVKGKYITIEDMEQLAALAGKVPALPQD

Flanking regions ( +/- flanking 50bp)

TAGTCTGTGATAAAATTGATTCAAATCAATATTATTTCAAGAGCAAGCCTATGATCCCGGAAAAACGTGTAGTACGTAGAATTCAATCAGGTGGCTGCGCGATCCACTGCCAGGATTGCAGCATCAGCCAGCTTTGCATCCCGTTCACGCTCAATGAGCATGAGCTGGATCAGCTCGATAATATCATCGAGCGCAAAAAGCCTATCCAGAAAGGCCAGGCACTGTTTAAAGCCGGAGATGAGCTGAAATCACTGTATGCAATCCGCTCCGGGACCATCAAGAGCTACACCATCACCGAAGAAGGTGATGAGCAGATCACCGGTTTCCATCTTGCCGGTGACCTCGTCGGCTTTGATGCCATTATCAATACCGAGCATCCGAGTTTCGCCCAGGCGCTGGAAACGTCCATGGTCTGTGAGATTCCGTATGAGACCCTGGATGACCTGTCCGGTAAAATGCCTAACCTGCGCCAGCAGATGATGCGCCTGATGAGCGGCGAAATCAAAGGTGATCAGGAAATGATCCTGCTGCTCTCCAAAAAGAATGCGGAAGAGCGTCTGGCTGCTTTTATTTATAACCTGTCCCGCCGTTTTGCGCAGCGCGGTTTCTCCCCTCGCGAATTCCGCCTGACCATGACCCGTGGCGACATCGGTAACTATCTGGGCCTGACGGTCGAAACCATCAGCCGTCTGCTGGGTCGTTTCCAGAAGAGCGGAATGCTTGCGGTAAAAGGTAAATATATCACCATCGAAGATATGGAACAGCTGGCGGCACTGGCCGGTAAAGTACCTGCACTGCCACAGGATTAGTAATTCCTTCCCCGGCAACATTTTTGGCTGCCGTAAAACGCATCAGACCG