Homologs in group_2298

Help

6 homologs were identified in 5 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_17650 FBDBKF_17650 100.0 Morganella morganii S1 potA ABC-type Fe3+/spermidine/putrescine transport systems, ATPase component
EHELCC_18135 EHELCC_18135 100.0 Morganella morganii S2 potA ABC-type Fe3+/spermidine/putrescine transport systems, ATPase component
NLDBIP_18015 NLDBIP_18015 100.0 Morganella morganii S4 potA ABC-type Fe3+/spermidine/putrescine transport systems, ATPase component
LHKJJB_18210 LHKJJB_18210 100.0 Morganella morganii S3 potA ABC-type Fe3+/spermidine/putrescine transport systems, ATPase component
F4V73_RS06470 F4V73_RS06470 30.3 Morganella psychrotolerans - ABC transporter ATP-binding protein
F4V73_RS15030 F4V73_RS15030 91.8 Morganella psychrotolerans - ABC transporter ATP-binding protein

Distribution of the homologs in the orthogroup group_2298

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2298

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q2K8C8 3.12e-87 269 42 5 349 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q0I2Z4 4.08e-87 269 40 4 336 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Histophilus somni (strain 129Pt)
Q9KS33 1.63e-86 268 49 1 255 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P37009 3.27e-86 266 44 1 284 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Escherichia coli (strain K12)
O85818 6.46e-86 266 45 4 306 3 potA Spermidine/putrescine import ATP-binding protein PotA Aggregatibacter actinomycetemcomitans
Q7AH43 1.52e-85 265 44 2 284 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Escherichia coli O157:H7
P45171 2.15e-85 265 42 5 332 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q0I3Y9 2.64e-85 265 51 0 235 3 potA Spermidine/putrescine import ATP-binding protein PotA Histophilus somni (strain 129Pt)
Q4QK57 2.69e-85 265 42 5 332 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus influenzae (strain 86-028NP)
Q7MKU3 3.03e-85 265 52 0 234 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio vulnificus (strain YJ016)
Q8D9J4 3.03e-85 265 52 0 234 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio vulnificus (strain CMCP6)
Q7N8B9 3.65e-85 264 46 1 283 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q578K3 5.92e-85 263 42 5 326 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella abortus biovar 1 (strain 9-941)
Q2YKX3 5.92e-85 263 42 5 326 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella abortus (strain 2308)
Q5E586 9.46e-85 263 52 0 234 3 potA Spermidine/putrescine import ATP-binding protein PotA Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q8U6M1 9.74e-85 263 42 2 323 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Agrobacterium fabrum (strain C58 / ATCC 33970)
P44531 2.36e-84 261 43 1 285 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q65S66 3.79e-84 261 43 1 285 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q87PH3 4.58e-84 262 52 0 234 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q6HLQ9 6.34e-84 259 45 4 300 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q63E84 6.48e-84 259 45 4 300 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ZK / E33L)
Q73BM0 6.48e-84 259 45 4 300 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ATCC 10987 / NRS 248)
A0RBB0 6.48e-84 259 45 4 300 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus thuringiensis (strain Al Hakam)
Q8FVV5 7.07e-84 260 42 5 326 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella suis biovar 1 (strain 1330)
Q81TH8 1.04e-83 259 45 4 298 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus anthracis
Q9CM80 1.07e-83 260 44 1 285 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Pasteurella multocida (strain Pm70)
Q32EY4 1.18e-83 261 50 0 258 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella dysenteriae serotype 1 (strain Sd197)
Q6D4E2 1.27e-83 261 52 0 235 3 potA Spermidine/putrescine import ATP-binding protein PotA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A1TXH7 1.29e-83 260 45 2 281 3 potA Spermidine/putrescine import ATP-binding protein PotA Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q6D734 2.65e-83 259 45 3 286 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q6LR20 3.36e-83 259 52 0 234 3 potA Spermidine/putrescine import ATP-binding protein PotA Photobacterium profundum (strain SS9)
Q7VNG4 3.37e-83 259 50 0 235 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q8Z7H7 4.02e-83 259 50 0 263 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella typhi
Q81GC1 4.18e-83 258 45 4 300 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q9KLQ5 4.47e-83 258 42 1 287 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9CP06 5.26e-83 259 51 0 235 3 potA Spermidine/putrescine import ATP-binding protein PotA Pasteurella multocida (strain Pm70)
P40790 5.87e-83 259 50 0 263 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q57QC8 5.87e-83 259 50 0 263 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella choleraesuis (strain SC-B67)
Q5PMK1 6.33e-83 259 50 0 263 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q3Z2Z3 7.69e-83 259 50 0 258 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella sonnei (strain Ss046)
Q31ZK0 7.69e-83 259 50 0 258 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella boydii serotype 4 (strain Sb227)
Q8YCG3 8.25e-83 258 42 5 326 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q1RD28 9.24e-83 258 50 0 258 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli (strain UTI89 / UPEC)
A1AA20 9.24e-83 258 50 0 258 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O1:K1 / APEC
P69877 1.05e-82 258 50 0 258 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella flexneri
P69874 1.05e-82 258 50 0 258 1 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli (strain K12)
P69875 1.05e-82 258 50 0 258 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TIU8 1.05e-82 258 50 0 258 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O6:K15:H31 (strain 536 / UPEC)
P69876 1.05e-82 258 50 0 258 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O157:H7
Q47T99 1.46e-82 258 42 4 319 3 potA Spermidine/putrescine import ATP-binding protein PotA Thermobifida fusca (strain YX)
Q92WJ0 3.09e-82 256 40 5 349 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Rhizobium meliloti (strain 1021)
Q6LKD4 3.57e-82 256 39 2 327 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Photobacterium profundum (strain SS9)
Q830W6 7.61e-82 256 45 3 281 3 potA Spermidine/putrescine import ATP-binding protein PotA Enterococcus faecalis (strain ATCC 700802 / V583)
Q0AGF4 8.53e-82 256 40 4 344 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q0SRL2 2.23e-81 254 50 0 234 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain SM101 / Type A)
Q65UE1 2.25e-81 255 49 0 238 3 potA Spermidine/putrescine import ATP-binding protein PotA Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q0T5R2 5.55e-81 254 49 0 258 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella flexneri serotype 5b (strain 8401)
Q8XIZ5 1.11e-80 252 50 0 234 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain 13 / Type A)
Q0TNZ3 1.11e-80 252 50 0 234 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
A0PY57 1.14e-80 252 48 0 236 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium novyi (strain NT)
Q2SJY7 6.01e-80 251 50 0 241 3 potA Spermidine/putrescine import ATP-binding protein PotA Hahella chejuensis (strain KCTC 2396)
Q609Q1 8.04e-80 250 39 8 353 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q5L222 8.21e-80 250 47 0 243 3 potA Spermidine/putrescine import ATP-binding protein PotA Geobacillus kaustophilus (strain HTA426)
Q92UV5 1.07e-79 251 56 0 217 3 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Rhizobium meliloti (strain 1021)
Q5YZY9 1.27e-79 249 48 0 240 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nocardia farcinica (strain IFM 10152)
Q82TL6 1.37e-79 250 39 5 346 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q88ZJ6 1.64e-79 249 49 0 233 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q8DIA0 1.78e-79 249 47 0 263 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q8RGC8 2.31e-79 249 43 2 278 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q6F0V4 2.66e-79 249 48 0 233 3 potA Spermidine/putrescine import ATP-binding protein PotA Mesoplasma florum (strain ATCC 33453 / NBRC 100688 / NCTC 11704 / L1)
A0LUE6 6.2e-79 249 52 0 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Acidothermus cellulolyticus (strain ATCC 43068 / DSM 8971 / 11B)
Q97KS6 7.08e-79 248 43 3 295 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q8Z0H0 7.08e-79 247 49 0 239 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q92DL6 1.15e-78 248 49 1 237 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q14Q07 1.75e-78 246 38 7 354 3 potA Spermidine/putrescine import ATP-binding protein PotA Spiroplasma citri
A0AGP9 2.81e-78 246 49 1 237 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q722B1 4.1e-78 246 48 1 237 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria monocytogenes serotype 4b (strain F2365)
Q72FW5 5.22e-78 246 41 3 293 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q9K876 6.83e-78 245 45 2 256 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q7NWX3 1.16e-77 245 50 1 235 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q1J6Q6 1.41e-77 245 49 1 237 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q1JGY7 1.41e-77 245 49 1 237 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q1JLT7 1.41e-77 245 49 1 237 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1JBV6 1.41e-77 245 49 1 237 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M12 (strain MGAS2096)
Q5XCA4 1.56e-77 245 49 1 237 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q5ZWE4 1.57e-77 244 49 0 231 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q18AM3 1.67e-77 244 46 0 235 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridioides difficile (strain 630)
Q1MQ44 1.77e-77 244 47 1 250 3 potA Spermidine/putrescine import ATP-binding protein PotA Lawsonia intracellularis (strain PHE/MN1-00)
Q8Y8T6 1.96e-77 244 48 1 237 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q7CN92 2.27e-77 245 49 1 237 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q99ZS8 2.27e-77 245 49 1 237 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M1
P0CZ35 2.61e-77 244 49 1 237 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M3 (strain SSI-1)
Q48TP4 2.61e-77 244 49 1 237 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M28 (strain MGAS6180)
P0CZ34 2.61e-77 244 49 1 237 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
P56344 2.93e-77 239 48 0 232 3 cysA Probable sulfate/thiosulfate import ATP-binding protein CysA Chlorella vulgaris
P74548 3.44e-77 243 43 6 331 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q5WXF0 3.73e-77 244 49 0 231 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila (strain Lens)
Q82WT5 5.19e-77 243 44 4 279 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q0SML1 7.32e-77 242 39 6 336 3 potA Spermidine/putrescine import ATP-binding protein PotA Borreliella afzelii (strain PKo)
O51587 1.61e-76 241 38 6 336 3 potA Spermidine/putrescine import ATP-binding protein PotA Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
Q660M8 1.81e-76 241 43 3 282 3 potA Spermidine/putrescine import ATP-binding protein PotA Borrelia garinii subsp. bavariensis (strain ATCC BAA-2496 / DSM 23469 / PBi)
Q57293 2.91e-76 241 41 3 286 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Actinobacillus pleuropneumoniae
Q160M2 5.27e-76 241 43 2 283 3 potA Spermidine/putrescine import ATP-binding protein PotA Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q30V33 5.33e-76 241 46 1 252 3 potA Spermidine/putrescine import ATP-binding protein PotA Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
Q2YAD6 5.33e-76 241 37 4 356 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q8DZJ0 8.32e-76 241 45 3 277 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E554 8.32e-76 241 45 3 277 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype III (strain NEM316)
Q3K0Y6 8.32e-76 241 45 3 277 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q7NX01 1.46e-75 239 45 2 257 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q7NIW1 1.81e-75 239 49 0 235 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q02Z10 2.58e-75 241 44 4 284 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactococcus lactis subsp. cremoris (strain SK11)
Q1WVI7 2.79e-75 239 48 0 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Ligilactobacillus salivarius (strain UCC118)
Q8UA73 2.81e-75 238 48 1 238 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q9CGD4 3.16e-75 241 44 4 284 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactococcus lactis subsp. lactis (strain IL1403)
Q03PF2 3.33e-75 239 48 0 232 3 potA Spermidine/putrescine import ATP-binding protein PotA Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
P55453 3.62e-75 238 45 0 259 3 NGR_a03670 Uncharacterized ABC transporter ATP-binding protein y4fO Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q9X196 3.78e-75 239 47 0 236 3 potA Spermidine/putrescine import ATP-binding protein PotA Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q60AI1 3.95e-75 239 42 2 303 3 potA Spermidine/putrescine import ATP-binding protein PotA Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q8UH62 5.07e-75 238 41 3 319 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q03AH0 7.93e-75 238 44 1 251 3 potA Spermidine/putrescine import ATP-binding protein PotA Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
Q2SSS4 8.3e-75 237 46 0 234 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma capricolum subsp. capricolum (strain California kid / ATCC 27343 / NCTC 10154)
A3DDF6 1.03e-74 237 44 1 277 3 potA Spermidine/putrescine import ATP-binding protein PotA Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q88AS5 1.05e-74 236 43 5 293 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q5X627 1.15e-74 237 48 0 231 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila (strain Paris)
Q6D201 1.25e-74 236 42 4 301 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q6MU19 1.28e-74 237 46 0 234 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma mycoides subsp. mycoides SC (strain CCUG 32753 / NCTC 10114 / PG1)
Q03JH1 1.45e-74 238 48 1 236 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q8PC11 1.49e-74 236 45 3 270 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q5M397 1.63e-74 238 48 1 236 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q5LYN4 1.66e-74 238 48 1 236 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus thermophilus (strain CNRZ 1066)
P54933 1.8e-74 236 44 3 278 3 smoK ATP-binding transport protein SmoK Cereibacter sphaeroides
Q9YGA6 1.82e-74 237 48 1 241 1 malK Trehalose/maltose import ATP-binding protein MalK Thermococcus litoralis (strain ATCC 51850 / DSM 5473 / JCM 8560 / NS-C)
P9WQM1 1.99e-74 236 47 1 236 1 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQM0 1.99e-74 236 47 1 236 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A4W3 1.99e-74 236 47 1 236 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q7NQN5 2.15e-74 236 39 3 328 3 potA Spermidine/putrescine import ATP-binding protein PotA Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
A3CMQ7 2.31e-74 237 49 1 236 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus sanguinis (strain SK36)
Q1QE80 2.76e-74 238 49 0 234 3 potA Spermidine/putrescine import ATP-binding protein PotA Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q87DT9 2.96e-74 236 46 3 260 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q24XJ2 3.37e-74 236 48 0 235 3 potA Spermidine/putrescine import ATP-binding protein PotA Desulfitobacterium hafniense (strain Y51)
A1TAI4 3.53e-74 236 48 0 236 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
Q1AS06 3.88e-74 236 43 3 287 3 potA Spermidine/putrescine import ATP-binding protein PotA Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
Q8DUF7 3.9e-74 236 49 1 238 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q9JUX4 4.16e-74 236 48 2 239 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q9I6L0 5.58e-74 234 42 4 295 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9L0Q1 5.75e-74 236 37 6 371 1 msiK Diacetylchitobiose uptake system ATP-binding protein MsiK Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q6MCV4 8.37e-74 235 38 4 332 3 potA Spermidine/putrescine import ATP-binding protein PotA Protochlamydia amoebophila (strain UWE25)
Q65T42 9.01e-74 235 40 4 312 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q9PDN2 9.81e-74 234 46 3 260 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xylella fastidiosa (strain 9a5c)
Q9TKX3 9.96e-74 234 45 0 235 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nephroselmis olivacea
Q9HY19 1.31e-73 234 48 0 235 3 potA2 Spermidine/putrescine import ATP-binding protein PotA 2 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9JZW0 1.33e-73 234 48 2 239 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q8FW07 1.36e-73 234 42 4 281 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Brucella suis biovar 1 (strain 1330)
Q578E9 1.36e-73 234 42 4 281 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Brucella abortus biovar 1 (strain 9-941)
Q8DPC2 1.38e-73 235 48 1 236 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q97Q42 1.38e-73 235 48 1 236 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q04JW0 1.38e-73 235 48 1 236 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q02R79 1.5e-73 234 48 0 235 3 potA Spermidine/putrescine import ATP-binding protein PotA Pseudomonas aeruginosa (strain UCBPP-PA14)
Q5LBT4 1.63e-73 237 41 2 280 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
Q64SQ6 1.65e-73 237 41 2 280 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides fragilis (strain YCH46)
Q8YCB1 1.8e-73 234 42 4 281 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q8A883 1.98e-73 237 41 2 280 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q1GIE5 2.54e-73 234 48 2 245 3 potA Spermidine/putrescine import ATP-binding protein PotA Ruegeria sp. (strain TM1040)
Q38VW6 2.58e-73 234 46 0 234 3 potA Spermidine/putrescine import ATP-binding protein PotA Latilactobacillus sakei subsp. sakei (strain 23K)
Q88CL2 3.01e-73 233 45 1 246 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q5LT05 3.37e-73 233 47 1 242 3 potA Spermidine/putrescine import ATP-binding protein PotA Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q9MUN1 3.43e-73 233 45 1 248 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mesostigma viride
Q4L5B3 3.43e-73 233 43 4 280 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus haemolyticus (strain JCSC1435)
P14788 5.18e-73 232 48 1 238 2 cysA Sulfate/thiosulfate import ATP-binding protein CysA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q1GB17 6.46e-73 233 46 1 243 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
Q04BG2 6.6e-73 233 46 1 243 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q2YKR8 6.85e-73 232 42 4 281 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Brucella abortus (strain 2308)
Q1M589 9.98e-73 232 43 2 267 3 ugpC3 sn-glycerol-3-phosphate import ATP-binding protein UgpC 3 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
A1URR2 1.01e-72 232 44 1 258 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bartonella bacilliformis (strain ATCC 35685 / KC583 / Herrer 020/F12,63)
Q1B8V9 1.22e-72 233 47 0 242 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycobacterium sp. (strain MCS)
A1UG51 1.22e-72 233 47 0 242 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycobacterium sp. (strain KMS)
Q8ELR4 1.42e-72 232 47 1 237 3 potA Spermidine/putrescine import ATP-binding protein PotA Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q8UBB7 1.55e-72 232 45 0 235 3 ugpC2 sn-glycerol-3-phosphate import ATP-binding protein UgpC 2 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q92XW1 1.66e-72 231 47 1 247 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Rhizobium meliloti (strain 1021)
Q92VJ2 1.71e-72 232 47 1 248 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Rhizobium meliloti (strain 1021)
P77795 1.89e-72 231 39 4 320 3 ydcT Uncharacterized ABC transporter ATP-binding protein YdcT Escherichia coli (strain K12)
Q98G42 3.35e-72 231 43 0 255 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q8PNN4 3.62e-72 230 44 3 280 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xanthomonas axonopodis pv. citri (strain 306)
Q3MAR5 5.59e-72 231 42 1 280 3 potA Spermidine/putrescine import ATP-binding protein PotA Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q98HF7 5.66e-72 230 48 1 239 3 potA Spermidine/putrescine import ATP-binding protein PotA Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q2K4V4 6.6e-72 230 45 0 235 3 ugpC2 sn-glycerol-3-phosphate import ATP-binding protein UgpC 2 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q9G4F5 7.14e-72 229 47 1 235 3 CYSA Sulfate/thiosulfate import ATP-binding protein cysA Cucumis sativus
Q89UD2 7.2e-72 229 48 1 232 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
O31339 8.11e-72 230 41 3 278 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bacillus cereus (strain ATCC 10987 / NRS 248)
Q81GU1 8.28e-72 229 40 5 307 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
P31134 9.32e-72 230 48 0 232 1 potG Putrescine transport ATP-binding protein PotG Escherichia coli (strain K12)
Q3KBH4 1.09e-71 229 41 5 316 3 potA Spermidine/putrescine import ATP-binding protein PotA Pseudomonas fluorescens (strain Pf0-1)
Q79EE4 1.19e-71 229 44 1 268 1 ggtA Osmoprotective compounds uptake ATP-binding protein GgtA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q74K65 2.74e-71 228 48 0 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q5FL41 3.16e-71 228 46 1 241 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
Q8YM92 3.56e-71 229 46 0 236 3 potA Spermidine/putrescine import ATP-binding protein PotA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q7WGW1 3.95e-71 228 41 2 281 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q7VZE5 4.12e-71 228 41 2 281 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7W9U5 4.9e-71 228 41 2 281 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q5HQ70 5.09e-71 228 42 2 273 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q63TY1 5.34e-71 228 37 7 349 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Burkholderia pseudomallei (strain K96243)
Q110U3 6.09e-71 228 38 4 317 3 potA Spermidine/putrescine import ATP-binding protein PotA Trichodesmium erythraeum (strain IMS101)
Q8RI39 7.88e-71 228 43 1 253 3 potA Spermidine/putrescine import ATP-binding protein PotA Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
A1B9Q7 1e-70 227 45 0 235 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Paracoccus denitrificans (strain Pd 1222)
P55604 1.09e-70 227 41 3 291 3 NGR_a02170 Uncharacterized ABC transporter ATP-binding protein y4oS Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q1MCN6 1.13e-70 227 44 0 235 3 ugpC1 sn-glycerol-3-phosphate import ATP-binding protein UgpC 1 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q2K6L3 1.41e-70 226 46 0 228 3 ugpC1 sn-glycerol-3-phosphate import ATP-binding protein UgpC 1 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q62K82 1.62e-70 226 37 7 349 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Burkholderia mallei (strain ATCC 23344)
Q0RAT5 1.71e-70 229 47 0 236 3 potA Spermidine/putrescine import ATP-binding protein PotA Frankia alni (strain DSM 45986 / CECT 9034 / ACN14a)
Q3YW77 2.04e-70 226 41 3 286 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Shigella sonnei (strain Ss046)
Q8E8K8 2.26e-70 226 41 3 278 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q7MFC4 2.31e-70 226 44 0 235 3 malK Maltose/maltodextrin import ATP-binding protein MalK Vibrio vulnificus (strain YJ016)
Q8D3V0 2.31e-70 226 44 0 235 3 malK Maltose/maltodextrin import ATP-binding protein MalK Vibrio vulnificus (strain CMCP6)
Q8XZP8 2.45e-70 226 45 1 237 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q3IX40 2.86e-70 226 41 3 280 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q042G7 2.99e-70 226 47 0 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
Q31VH5 3.14e-70 226 42 2 275 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Shigella boydii serotype 4 (strain Sb227)
Q6G5J0 3.19e-70 225 42 3 280 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
P10907 3.42e-70 226 41 3 286 1 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Escherichia coli (strain K12)
Q2K1C8 3.71e-70 225 41 2 265 3 ugpC3 sn-glycerol-3-phosphate import ATP-binding protein UgpC 3 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q5LX21 3.71e-70 225 40 3 284 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q6F9A8 3.98e-70 225 46 1 236 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q93DX8 4.46e-70 222 44 1 239 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA (Fragment) Burkholderia cepacia
Q8CPN0 4.73e-70 225 42 2 273 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q8X6U5 5.26e-70 225 42 3 286 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Escherichia coli O157:H7
Q8FVT0 6.05e-70 224 46 0 235 3 BRA0745 Putative ATP-binding protein BRA0745/BS1330_II0738 Brucella suis biovar 1 (strain 1330)
Q2YKZ7 6.25e-70 224 46 0 235 3 BAB2_0493 Putative ATP-binding protein BAB2_0493 Brucella abortus (strain 2308)
Q578M5 6.25e-70 224 46 0 235 3 BruAb2_0487 Putative ATP-binding protein BruAb2_0487 Brucella abortus biovar 1 (strain 9-941)
P63354 6.96e-70 225 45 1 248 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Brucella suis biovar 1 (strain 1330)
P63353 6.96e-70 225 45 1 248 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q668K6 1.03e-69 224 46 2 241 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Yersinia pseudotuberculosis serotype I (strain IP32953)
Q49WM4 1.19e-69 224 40 2 279 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q8EBC3 1.21e-69 225 47 1 239 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
A3PRY1 1.71e-69 223 41 3 280 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
Q73XU8 1.95e-69 224 48 0 214 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q7N6Z2 2.08e-69 224 46 2 248 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q8FFB3 2.34e-69 224 47 3 244 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P16676 2.39e-69 224 47 3 244 1 cysA Sulfate/thiosulfate import ATP-binding protein CysA Escherichia coli (strain K12)
Q8XBJ8 2.81e-69 223 47 3 244 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Escherichia coli O157:H7
Q0TC10 2.91e-69 223 41 3 286 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q9KUI0 2.93e-69 224 43 3 272 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q1R5H8 2.98e-69 223 41 3 286 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Escherichia coli (strain UTI89 / UPEC)
A1AGY1 2.98e-69 223 41 3 286 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Escherichia coli O1:K1 / APEC
Q8FCQ2 3.25e-69 223 41 3 286 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q89WG0 4.17e-69 223 42 4 275 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q1QTX6 4.52e-69 223 46 1 232 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q9KL04 4.66e-69 223 44 0 235 3 malK Maltose/maltodextrin import ATP-binding protein MalK Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q8D0W8 5.07e-69 223 46 2 241 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Yersinia pestis
Q87GB5 5.26e-69 223 44 0 235 3 malK Maltose/maltodextrin import ATP-binding protein MalK Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q21CA3 6.77e-69 223 41 3 276 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Rhodopseudomonas palustris (strain BisB18)
Q8Z245 7.52e-69 222 42 5 289 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Salmonella typhi
P96063 8.93e-69 222 43 1 242 2 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A1SWH9 9.07e-69 222 40 4 289 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q5PFQ7 9.43e-69 222 43 1 242 3 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q8Z8W8 9.95e-69 222 43 1 242 3 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella typhi
P40860 1.32e-68 222 46 3 244 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8ZLF4 1.37e-68 221 43 4 277 1 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q6G194 1.53e-68 221 42 3 276 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bartonella quintana (strain Toulouse)
Q92WD6 1.54e-68 221 40 3 274 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Rhizobium meliloti (strain 1021)
Q65QT6 1.58e-68 222 45 0 235 3 malK Maltose/maltodextrin import ATP-binding protein MalK Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q8Z4V6 1.74e-68 221 46 3 244 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Salmonella typhi
Q8UB29 1.76e-68 221 43 3 261 3 ugpC3 sn-glycerol-3-phosphate import ATP-binding protein UgpC 3 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q57IS3 2.59e-68 221 42 4 277 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Salmonella choleraesuis (strain SC-B67)
P94360 3.13e-68 221 36 7 347 1 msmX Oligosaccharides import ATP-binding protein MsmX Bacillus subtilis (strain 168)
Q7UC29 3.37e-68 221 46 3 244 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Shigella flexneri
Q2L0H5 3.82e-68 220 44 1 236 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bordetella avium (strain 197N)
Q03ZQ0 4.18e-68 221 46 0 231 3 potA Spermidine/putrescine import ATP-binding protein PotA Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
Q9KRT4 4.38e-68 221 46 0 215 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q5PJL1 5.81e-68 220 42 4 278 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q7MLB8 6.8e-68 220 46 0 215 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Vibrio vulnificus (strain YJ016)
Q6NBT1 6.89e-68 219 39 4 302 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q8D954 7.49e-68 220 46 0 215 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Vibrio vulnificus (strain CMCP6)
Q57SD6 7.59e-68 220 42 1 242 3 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella choleraesuis (strain SC-B67)
Q8D653 8.74e-68 219 40 5 303 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Vibrio vulnificus (strain CMCP6)
Q7VYN2 9.29e-68 219 44 1 236 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q98K23 9.49e-68 219 41 4 305 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q66FU4 9.8e-68 219 45 1 236 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Yersinia pseudotuberculosis serotype I (strain IP32953)
Q82JY6 1.05e-67 219 44 0 237 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q7WID6 1.1e-67 219 44 1 236 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q6NDQ0 1.36e-67 219 42 4 272 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q7CS28 1.84e-67 218 42 0 235 1 smoE Sulfoquinovosyl glycerol transport ATP-binding protein SmoE Agrobacterium fabrum (strain C58 / ATCC 33970)
Q7A169 1.85e-67 219 41 2 273 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain MW2)
Q6GAB5 1.85e-67 219 41 2 273 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain MSSA476)
Q6GHY6 1.85e-67 219 41 2 273 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain MRSA252)
Q7A679 1.85e-67 219 41 2 273 1 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain N315)
Q99V03 1.85e-67 219 41 2 273 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HGY5 1.85e-67 219 41 2 273 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain COL)
Q2YX74 1.85e-67 219 41 2 273 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q2G2A7 1.85e-67 219 41 2 273 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FHY1 1.85e-67 219 41 2 273 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain USA300)
Q8F6Z1 2.33e-67 218 38 4 320 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72PE5 2.33e-67 218 38 4 320 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
A1JIE0 3.13e-67 218 44 1 236 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
O32151 3.2e-67 218 44 0 235 3 yurJ Uncharacterized ABC transporter ATP-binding protein YurJ Bacillus subtilis (strain 168)
Q1M8R6 3.59e-67 217 42 3 261 3 ugpC2 sn-glycerol-3-phosphate import ATP-binding protein UgpC 2 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
D4GP38 3.64e-67 219 41 4 284 1 xacJ Xylose/arabinose import ATP-binding protein XacJ Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
Q4K681 4.13e-67 218 39 7 339 3 potA Spermidine/putrescine import ATP-binding protein PotA Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q1CNC6 4.23e-67 218 44 1 236 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Yersinia pestis bv. Antiqua (strain Nepal516)
Q74R28 4.23e-67 218 44 1 236 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Yersinia pestis
Q1CBH2 4.23e-67 218 44 1 236 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Yersinia pestis bv. Antiqua (strain Antiqua)
Q7W6G5 4.71e-67 218 44 1 236 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q2J2E9 6.04e-67 218 40 3 273 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Rhodopseudomonas palustris (strain HaA2)
Q0TA26 6.18e-67 218 44 2 238 3 malK Maltose/maltodextrin import ATP-binding protein MalK Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q8XZX8 6.77e-67 217 42 0 235 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q0SXQ1 7.03e-67 218 44 2 238 3 malK Maltose/maltodextrin import ATP-binding protein MalK Shigella flexneri serotype 5b (strain 8401)
Q5DZC6 8.52e-67 217 42 0 235 3 malK Maltose/maltodextrin import ATP-binding protein MalK Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q46ZM0 9.79e-67 217 44 4 239 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q9I6T2 1.21e-66 217 37 3 341 3 potA1 Spermidine/putrescine import ATP-binding protein PotA 1 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q7N986 2.34e-66 216 42 0 235 3 malK Maltose/maltodextrin import ATP-binding protein MalK Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q9Z3R9 2.69e-66 216 43 1 236 3 aglK Alpha-glucoside transport ATP-binding protein AglK Rhizobium meliloti (strain 1021)
Q6LK87 2.69e-66 216 42 0 235 3 malK Maltose/maltodextrin import ATP-binding protein MalK Photobacterium profundum (strain SS9)
Q7UBD0 2.84e-66 216 43 2 238 3 malK Maltose/maltodextrin import ATP-binding protein MalK Shigella flexneri
Q8FB37 2.84e-66 216 43 2 238 3 malK Maltose/maltodextrin import ATP-binding protein MalK Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q3YUV0 2.96e-66 216 43 2 238 3 malK Maltose/maltodextrin import ATP-binding protein MalK Shigella sonnei (strain Ss046)
Q1R3Q1 2.96e-66 216 43 2 238 1 malK Maltose/maltodextrin import ATP-binding protein MalK Escherichia coli (strain UTI89 / UPEC)
P68187 2.96e-66 216 43 2 238 1 malK Maltose/maltodextrin import ATP-binding protein MalK Escherichia coli (strain K12)
P68188 2.96e-66 216 43 2 238 3 malK Maltose/maltodextrin import ATP-binding protein MalK Escherichia coli O157:H7
Q13ER6 3.37e-66 216 39 4 273 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Rhodopseudomonas palustris (strain BisB5)
Q1GID1 3.57e-66 215 43 0 235 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Ruegeria sp. (strain TM1040)
P9WQI3 5.93e-66 216 42 2 264 1 sugC Trehalose import ATP-binding protein SugC Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQI2 5.93e-66 216 42 2 264 3 sugC Trehalose import ATP-binding protein SugC Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P19566 6.48e-66 215 44 2 238 1 malK Maltose/maltodextrin import ATP-binding protein MalK Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q57GZ7 6.48e-66 215 44 2 238 3 malK Maltose/maltodextrin import ATP-binding protein MalK Salmonella choleraesuis (strain SC-B67)
Q8Z1U0 6.55e-66 215 44 2 238 3 malK Maltose/maltodextrin import ATP-binding protein MalK Salmonella typhi
Q5PKZ8 1.02e-65 214 44 2 238 3 malK Maltose/maltodextrin import ATP-binding protein MalK Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q0K998 1.03e-65 214 43 3 239 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q7NRX5 1.05e-65 214 40 6 300 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q1LLP5 1.53e-65 214 44 4 239 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q9A7X1 1.67e-65 213 44 2 238 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
O86751 1.75e-65 213 43 0 240 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q04G50 1.82e-65 214 40 3 276 3 potA Spermidine/putrescine import ATP-binding protein PotA Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
O83658 4.45e-65 213 44 0 235 3 potA Spermidine/putrescine import ATP-binding protein PotA Treponema pallidum (strain Nichols)
Q01937 5.9e-65 212 42 0 235 3 lacK Lactose transport ATP-binding protein LacK Rhizobium radiobacter
Q8U4K3 7.95e-65 211 41 1 256 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q664X5 8.9e-65 212 43 0 235 3 malK Maltose/maltodextrin import ATP-binding protein MalK Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CNR8 8.9e-65 212 43 0 235 3 malK Maltose/maltodextrin import ATP-binding protein MalK Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZAS8 8.9e-65 212 43 0 235 3 malK Maltose/maltodextrin import ATP-binding protein MalK Yersinia pestis
Q1CC21 8.9e-65 212 43 0 235 3 malK Maltose/maltodextrin import ATP-binding protein MalK Yersinia pestis bv. Antiqua (strain Antiqua)
Q8UII7 9.42e-65 212 43 2 246 3 ugpC1 sn-glycerol-3-phosphate import ATP-binding protein UgpC 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q164Y5 1.35e-64 211 42 2 237 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q8X8K4 1.62e-64 211 46 0 218 3 ycjV Uncharacterized ABC transporter ATP-binding protein YcjV Escherichia coli O157:H7
Q6CZ34 2.45e-64 210 43 1 236 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q8FHR3 2.9e-64 210 46 0 218 3 ycjV Uncharacterized ABC transporter ATP-binding protein YcjV Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TI47 2.9e-64 210 46 0 218 3 ycjV Uncharacterized ABC transporter ATP-binding protein YcjV Escherichia coli O6:K15:H31 (strain 536 / UPEC)
D4GP39 3.71e-64 211 40 3 267 1 xacK Xylose/arabinose import ATP-binding protein XacK Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
P77481 6.55e-64 209 45 0 218 5 ycjV Putative uncharacterized ABC transporter ATP-binding protein YcjV Escherichia coli (strain K12)
Q1RC47 8.75e-64 209 46 0 218 4 ycjV Uncharacterized ABC transporter ATP-binding protein YcjV Escherichia coli (strain UTI89 / UPEC)
Q07UI9 8.9e-64 209 43 1 236 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Rhodopseudomonas palustris (strain BisA53)
Q28QL7 1.48e-63 208 46 0 213 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Jannaschia sp. (strain CCS1)
Q5JEB0 2.05e-63 207 43 3 258 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
Q62GB4 2.45e-63 208 42 3 239 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Burkholderia mallei (strain ATCC 23344)
Q39KB9 2.77e-63 208 44 0 218 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q1BRZ8 6.98e-63 207 44 0 218 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Burkholderia orbicola (strain AU 1054)
A0K3S5 6.98e-63 207 44 0 218 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Burkholderia cenocepacia (strain HI2424)
Q2SU77 8.6e-63 206 42 3 239 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q3JMW7 8.69e-63 206 42 3 239 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Burkholderia pseudomallei (strain 1710b)
Q63Q62 1.1e-62 206 42 3 239 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Burkholderia pseudomallei (strain K96243)
P18813 4.27e-62 202 43 3 238 3 malK Maltose/maltodextrin import ATP-binding protein MalK (Fragment) Klebsiella aerogenes
Q00752 7.62e-62 204 43 1 224 3 msmK Multiple sugar-binding transport ATP-binding protein MsmK Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q0BIZ6 9.86e-62 204 43 0 218 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q4QP85 2.01e-61 202 36 5 325 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Haemophilus influenzae (strain 86-028NP)
O57896 3.25e-61 202 40 1 256 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
P44513 4.3e-61 202 35 5 325 1 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q13TV1 6.53e-61 202 43 0 218 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Paraburkholderia xenovorans (strain LB400)
Q9V2C0 8.95e-61 201 33 6 338 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Pyrococcus abyssi (strain GE5 / Orsay)
Q97UY8 2.53e-59 197 38 5 281 1 glcV Glucose import ATP-binding protein GlcV Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q5FA19 2.83e-59 197 42 1 232 1 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q4FL37 1.19e-58 195 42 2 232 1 tmoW Trimethylamine N-oxide transport system ATP-binding protein TmoW Pelagibacter ubique (strain HTCC1062)
Q4W575 1.57e-58 195 42 1 232 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9JVH1 1.57e-58 195 42 1 232 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q98G43 7.14e-58 194 35 6 316 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q0S0Z3 1.42e-57 192 37 10 324 3 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Rhodococcus jostii (strain RHA1)
O34992 2.64e-57 193 39 4 242 1 opuCA Glycine betaine/carnitine/choline transport ATP-binding protein OpuCA Bacillus subtilis (strain 168)
Q45460 3.85e-57 192 37 4 245 2 opuBA Choline transport ATP-binding protein OpuBA Bacillus subtilis (strain 168)
Q6D2F6 4.18e-57 191 35 6 339 3 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q85A69 6.41e-57 192 39 1 237 2 cysA Sulfate/thiosulfate import ATP-binding protein CysA Anthoceros angustus
Q0SBZ1 6.84e-57 191 37 9 311 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Rhodococcus jostii (strain RHA1)
P10091 8.09e-57 191 40 0 232 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Marchantia polymorpha
Q0RYP7 1.12e-56 190 36 10 324 3 fbpC3 Fe(3+) ions import ATP-binding protein FbpC 3 Rhodococcus jostii (strain RHA1)
Q4KC87 2.98e-56 189 36 7 307 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q9RR46 6.35e-56 190 37 2 269 1 gbuA Glycine betaine/carnitine transport ATP-binding protein GbuA Listeria monocytogenes serotype 1/2a (strain 10403S)
Q9KHT9 2.25e-55 188 39 4 243 1 opuCA Carnitine transport ATP-binding protein OpuCA Listeria monocytogenes
G2JZ44 2.25e-55 188 39 4 243 1 opuCA Carnitine transport ATP-binding protein OpuCA Listeria monocytogenes serotype 1/2a (strain 10403S)
Q5LT65 1.36e-54 185 41 1 218 1 tmoW Trimethylamine N-oxide transport system ATP-binding protein TmoW Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q50966 3.95e-54 184 40 1 232 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria gonorrhoeae
Q65M64 2.94e-53 179 49 2 193 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q3KCC5 3.2e-53 181 41 2 232 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Pseudomonas fluorescens (strain Pf0-1)
A0A0H2ZLL3 4.95e-53 177 40 3 235 3 egtUA Probable ergothioneine transport ATP-binding protein EgtUA Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
P46920 5.75e-53 182 40 1 247 1 opuAA Glycine betaine transport ATP-binding protein OpuAA Bacillus subtilis (strain 168)
P21410 1.1e-51 177 36 4 283 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Serratia marcescens
P55662 3.28e-51 173 37 3 248 3 NGR_a01510 Probable amino-acid ABC transporter ATP-binding protein y4tH Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q9KIF7 4.23e-51 177 38 3 247 3 opuAA Glycine betaine transport ATP-binding protein OpuAA Lactococcus lactis subsp. lactis (strain IL1403)
Q57855 7.06e-51 173 40 4 220 3 MJ0412 Uncharacterized ABC transporter ATP-binding protein MJ0412 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q8FV85 5.3e-50 174 38 1 224 3 metN Methionine import ATP-binding protein MetN Brucella suis biovar 1 (strain 1330)
Q8YD40 5.3e-50 174 38 1 224 3 metN Methionine import ATP-binding protein MetN Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q579H8 5.3e-50 174 38 1 224 3 metN Methionine import ATP-binding protein MetN Brucella abortus biovar 1 (strain 9-941)
Q2YIV5 5.3e-50 174 38 1 224 3 metN Methionine import ATP-binding protein MetN Brucella abortus (strain 2308)
P97027 9.43e-50 169 46 3 191 1 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Bacillus subtilis (strain 168)
Q5MZ54 1.56e-49 178 43 3 215 3 cmpC Bicarbonate transport ATP-binding protein CmpC Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q55107 1.56e-49 178 43 3 215 1 cmpC Bicarbonate transport ATP-binding protein CmpC Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q58762 2.49e-49 170 35 6 262 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P45022 3.42e-49 168 39 5 245 3 HI_1078 Probable amino-acid ABC transporter ATP-binding protein HI_1078 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8U648 3.86e-49 168 45 3 206 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q6HHI7 4.1e-49 168 40 4 231 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q5WKG4 4.39e-49 167 42 2 205 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Shouchella clausii (strain KSM-K16)
Q81P94 7.46e-49 167 40 4 231 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Bacillus anthracis
Q6FFZ1 7.67e-49 167 44 3 217 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q56927 7.76e-49 170 36 3 246 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Yersinia enterocolitica
Q63A38 1.17e-48 167 42 2 204 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Bacillus cereus (strain ZK / E33L)
Q1CJS9 1.17e-48 169 33 4 281 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZCM2 1.17e-48 169 33 4 281 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Yersinia pestis
Q1C607 1.17e-48 169 33 4 281 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Yersinia pestis bv. Antiqua (strain Antiqua)
Q668Q3 1.21e-48 169 33 4 281 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Yersinia pseudotuberculosis serotype I (strain IP32953)
Q81C68 1.87e-48 166 40 2 204 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
A0RFA4 2.13e-48 166 42 2 204 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Bacillus thuringiensis (strain Al Hakam)
P33360 2.27e-48 167 36 5 284 1 yehX Glycine betaine uptake system ATP-binding protein YehX Escherichia coli (strain K12)
Q81IN8 2.71e-48 168 34 6 305 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
P27675 2.75e-48 165 35 4 237 2 glnQ Glutamine transport ATP-binding protein GlnQ Geobacillus stearothermophilus
Q736E0 3e-48 166 42 2 204 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Bacillus cereus (strain ATCC 10987 / NRS 248)
Q6HP89 4.85e-48 167 34 6 305 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q81ZF5 9.36e-48 167 34 6 305 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus anthracis
Q2RWA3 2.55e-47 166 36 2 240 3 metN Methionine import ATP-binding protein MetN Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
P10346 2.68e-47 163 35 3 237 1 glnQ Glutamine transport ATP-binding protein GlnQ Escherichia coli (strain K12)
Q73EL7 2.79e-47 166 34 6 305 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q07LR5 3.28e-47 166 37 2 229 3 metN Methionine import ATP-binding protein MetN Rhodopseudomonas palustris (strain BisA53)
O30144 3.73e-47 162 42 3 220 1 wtpC Molybdate/tungstate import ATP-binding protein WtpC Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q0SFW6 4.61e-47 165 30 7 332 3 metN2 Methionine import ATP-binding protein MetN 2 Rhodococcus jostii (strain RHA1)
P17328 5.97e-47 166 36 2 245 2 proV Glycine betaine/proline betaine transport system ATP-binding protein ProV Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P14175 6.03e-47 166 36 2 245 1 proV Glycine betaine/proline betaine transport system ATP-binding protein ProV Escherichia coli (strain K12)
Q63GR8 8.95e-47 164 34 6 305 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus cereus (strain ZK / E33L)
Q8NQU4 9.97e-47 162 36 3 244 1 argV Arginine transport ATP-binding protein ArgV Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q4FMG5 1.14e-46 162 42 4 213 3 tauB Taurine import ATP-binding protein TauB Pelagibacter ubique (strain HTCC1062)
Q5KVK2 1.47e-46 164 37 2 237 3 metN Methionine import ATP-binding protein MetN Geobacillus kaustophilus (strain HTA426)
E0SCY1 2.04e-46 165 36 1 232 1 ousV Glycine betaine/choline transport system ATP-binding protein OusV Dickeya dadantii (strain 3937)
Q97KD5 2.86e-46 162 36 1 228 3 metN Methionine import ATP-binding protein MetN Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q3M5J9 3.15e-46 160 44 3 206 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q6G2E2 3.38e-46 163 36 3 235 3 metN Methionine import ATP-binding protein MetN Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
Q21XJ9 5.14e-46 160 41 2 214 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q21BU8 7.54e-46 162 35 3 239 3 metN Methionine import ATP-binding protein MetN Rhodopseudomonas palustris (strain BisB18)
Q11D92 7.83e-46 159 37 0 215 3 thiQ Thiamine import ATP-binding protein ThiQ Chelativorans sp. (strain BNC1)
Q6AE21 8.65e-46 162 32 9 322 3 metN Methionine import ATP-binding protein MetN Leifsonia xyli subsp. xyli (strain CTCB07)
P73265 1.28e-45 159 40 2 187 3 nrtD Nitrate import ATP-binding protein NrtD Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q8RFN2 1.61e-45 161 34 2 236 3 metN Methionine import ATP-binding protein MetN Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q83F44 2.08e-45 161 37 2 235 3 metN Methionine import ATP-binding protein MetN Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
Q831K6 2.11e-45 161 35 2 243 1 metN2 Methionine import ATP-binding protein MetN 2 Enterococcus faecalis (strain ATCC 700802 / V583)
P47288 2.17e-45 166 48 2 172 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
P47288 1.72e-21 98 43 1 124 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q55462 2.24e-45 167 40 3 215 2 cmpC Bicarbonate transport ATP-binding protein CmpC Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q13VD7 2.74e-45 160 35 2 237 3 metN1 Methionine import ATP-binding protein MetN 1 Paraburkholderia xenovorans (strain LB400)
P45769 4.78e-45 157 35 3 238 3 yhdZ Uncharacterized amino-acid ABC transporter ATP-binding protein YhdZ Escherichia coli (strain K12)
P39456 5.92e-45 157 37 3 238 1 tcyC L-cystine import ATP-binding protein TcyC Bacillus subtilis (strain 168)
Q8YA75 6.09e-45 159 37 1 219 3 metN1 Methionine import ATP-binding protein MetN 1 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q9A502 6.11e-45 159 35 2 235 3 metN Methionine import ATP-binding protein MetN Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q46ZU5 6.95e-45 158 40 2 210 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
P54537 7.06e-45 156 37 4 233 1 artM Arginine transport ATP-binding protein ArtM Bacillus subtilis (strain 168)
Q8ZPK4 7.91e-45 160 36 3 239 1 osmV Osmoprotectant import ATP-binding protein OsmV Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q52666 8.45e-45 157 35 4 237 3 bztD Glutamate/glutamine/aspartate/asparagine transport ATP-binding protein BztD Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
Q0K9I2 8.65e-45 158 40 1 209 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
P54954 1.41e-44 156 36 3 239 1 yxeO Probable amino-acid import ATP-binding protein YxeO Bacillus subtilis (strain 168)
Q0AU85 1.86e-44 158 37 2 236 3 metN Methionine import ATP-binding protein MetN Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
Q4JTG9 1.94e-44 159 35 1 218 3 metN Methionine import ATP-binding protein MetN Corynebacterium jeikeium (strain K411)
P37774 1.97e-44 155 37 4 250 1 tcyN L-cystine transport system ATP-binding protein TcyN Escherichia coli (strain K12)
Q6N9W0 2.02e-44 159 36 1 229 3 metN1 Methionine import ATP-binding protein MetN 1 Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q1LNM0 2.09e-44 157 41 3 206 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q325U1 2.19e-44 158 34 3 236 3 metN Methionine import ATP-binding protein MetN Shigella boydii serotype 4 (strain Sb227)
Q65M34 2.45e-44 158 35 1 221 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
O34677 2.49e-44 155 35 5 242 2 glnQ Glutamine transport ATP-binding protein GlnQ Bacillus subtilis (strain 168)
Q724C0 2.67e-44 158 37 1 219 3 metN1 Methionine import ATP-binding protein MetN 1 Listeria monocytogenes serotype 4b (strain F2365)
P38046 2.96e-44 156 41 2 191 1 nrtD Nitrate import ATP-binding protein NrtD Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q8RQL7 2.99e-44 155 34 4 235 3 gluA Glutamate transport ATP-binding protein GluA Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
P30750 5.04e-44 157 34 3 236 1 metN Methionine import ATP-binding protein MetN Escherichia coli (strain K12)
Q8U8D6 5.42e-44 155 41 2 205 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q98DA2 5.48e-44 158 34 2 269 3 metN Methionine import ATP-binding protein MetN Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q92EZ6 5.54e-44 157 37 1 219 3 metN1 Methionine import ATP-binding protein MetN 1 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q3Z5F8 6.29e-44 157 34 3 236 3 metN Methionine import ATP-binding protein MetN Shigella sonnei (strain Ss046)
Q1RFY9 6.29e-44 157 34 3 236 3 metN Methionine import ATP-binding protein MetN Escherichia coli (strain UTI89 / UPEC)
P63355 6.29e-44 157 34 3 236 3 metN Methionine import ATP-binding protein MetN Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P63356 6.29e-44 157 34 3 236 3 metN Methionine import ATP-binding protein MetN Escherichia coli O157:H7
Q0TLD2 6.36e-44 157 34 3 236 3 metN Methionine import ATP-binding protein MetN Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1VZQ5 6.79e-44 154 35 3 235 3 peb1C Probable ABC transporter ATP-binding protein PEB1C Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
Q6A6X6 6.91e-44 157 32 2 242 3 metN Methionine import ATP-binding protein MetN Cutibacterium acnes (strain DSM 16379 / KPA171202)
Q134N9 7.42e-44 157 36 2 229 3 metN Methionine import ATP-binding protein MetN Rhodopseudomonas palustris (strain BisB5)
Q0P9X7 8.05e-44 154 35 3 235 3 peb1C Probable ABC transporter ATP-binding protein PEB1C Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q7N8M2 8.19e-44 157 35 1 221 3 metN Methionine import ATP-binding protein MetN Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q5WCI1 8.98e-44 154 39 2 209 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Shouchella clausii (strain KSM-K16)
Q39CJ6 9.07e-44 154 38 2 195 3 tauB Taurine import ATP-binding protein TauB Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q32JQ8 1.24e-43 156 34 3 236 3 metN Methionine import ATP-binding protein MetN Shigella dysenteriae serotype 1 (strain Sd197)
Q6D1C4 1.48e-43 156 33 2 236 3 metN3 Methionine import ATP-binding protein MetN 3 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
P73450 1.57e-43 162 42 2 191 3 nrtC Nitrate import ATP-binding protein NrtC Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q48CA0 1.67e-43 154 39 2 205 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
O34900 1.81e-43 153 38 5 244 1 tcyN L-cystine import ATP-binding protein TcyN Bacillus subtilis (strain 168)
Q8XZQ4 1.91e-43 154 40 2 203 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q8ZRM9 1.93e-43 155 34 3 236 3 metN1 Methionine import ATP-binding protein MetN 1 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8PGE8 1.93e-43 155 37 1 218 3 metN Methionine import ATP-binding protein MetN Xanthomonas axonopodis pv. citri (strain 306)
Q3JKX3 2.02e-43 153 39 4 219 3 tauB Taurine import ATP-binding protein TauB Burkholderia pseudomallei (strain 1710b)
Q62AW4 2.02e-43 153 39 4 219 3 tauB Taurine import ATP-binding protein TauB Burkholderia mallei (strain ATCC 23344)
Q83MC5 2.16e-43 155 34 3 236 3 metN Methionine import ATP-binding protein MetN Shigella flexneri
Q0T810 2.16e-43 155 34 3 236 3 metN Methionine import ATP-binding protein MetN Shigella flexneri serotype 5b (strain 8401)
Q3BNZ3 2.24e-43 155 37 1 218 3 metN Methionine import ATP-binding protein MetN Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q8FYU9 2.25e-43 152 35 0 214 3 thiQ Thiamine import ATP-binding protein ThiQ Brucella suis biovar 1 (strain 1330)
Q8YJ04 2.25e-43 152 35 0 214 3 thiQ Thiamine import ATP-binding protein ThiQ Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)

  • Number of RefSeq hits:

General

Source Morganella morganii S5
Locus tag HKOGLL_17990
Feature type CDS
Gene potA
Product ABC-type Fe3+/spermidine/putrescine transport systems, ATPase component
Location 25975 - 27003 (strand: -1)
Length 1029 (nucleotides) / 342 (amino acids)

Contig

Accession ZDB_703
Length 38736 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2298
Orthogroup size 7
N. genomes 6

Actions

Genomic region

Domains

PF00005 ABC transporter
PF08402 TOBE domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG3842 Amino acid transport and metabolism (E) E ABC-type Fe3+/spermidine/putrescine transport systems, ATPase component

Protein Sequence

MSYVIAENLTKSFAATPVFSGLNFSVSKGEFITLLGPSGCGKSTLLRCLAGLEPVNDGRIYVNKQDITSSPPQQREIGMVFQSYALFPNMTTERNIAFGLKMQKVPENEQRKSVAEVIELVGLKGKEQHLPHQLSGGQRQRVALARALVMKPRILLLDEPLSALDAQIRKHLRQQIRQIQRELNLTTIFVTHDQEEAMLMSDRIFLMNKGEIVQSDTAENIYTQPANEFVARFMGHYNLVSAHNANSLLGLNLSGIVAIRPESIYVREAGRQYGEHISHPVSGTIRDSQLLGNIIRYQVDTGLGALTVDLLNRSSERLFEQGTQLELMFNKNEIRALAPSVN

Flanking regions ( +/- flanking 50bp)

CCTGATCCTGACCCTGATCGCGACACGCTTAAGCCGCTGAGGAATCACTGATGAGCTATGTAATTGCTGAAAACCTGACAAAATCCTTTGCTGCCACTCCGGTCTTTTCCGGTCTGAATTTTTCTGTCAGCAAAGGGGAATTTATTACTCTGCTCGGCCCGAGCGGCTGCGGTAAATCTACCTTGCTGCGTTGTCTCGCCGGGCTGGAACCGGTCAATGACGGCAGAATTTATGTGAATAAACAGGATATTACTTCATCTCCGCCACAGCAGCGGGAAATCGGCATGGTGTTTCAGAGCTATGCGCTGTTTCCGAATATGACCACTGAACGCAACATTGCTTTCGGTCTGAAGATGCAGAAAGTCCCGGAAAATGAACAGCGCAAATCCGTTGCAGAGGTGATTGAGCTGGTGGGTCTGAAAGGAAAAGAACAGCATCTGCCGCATCAGCTTTCCGGCGGCCAGCGCCAGCGGGTGGCACTGGCACGGGCACTGGTGATGAAGCCGCGCATCCTGCTGCTGGATGAACCGCTCTCCGCACTGGATGCGCAGATCCGCAAACATCTGCGCCAGCAAATCCGTCAGATCCAGCGCGAGCTGAATCTCACCACCATTTTTGTCACCCACGACCAGGAAGAAGCCATGCTGATGTCTGACCGCATCTTCCTGATGAACAAAGGTGAAATCGTGCAGAGCGATACCGCCGAAAATATCTACACCCAGCCCGCCAATGAGTTTGTCGCGCGTTTTATGGGGCATTACAATCTGGTCAGCGCGCACAACGCCAACAGCCTGCTCGGCCTGAATCTCAGCGGTATTGTGGCGATCCGCCCGGAATCCATTTATGTGCGTGAGGCCGGAAGGCAGTACGGGGAACACATTTCTCACCCGGTTTCAGGTACAATCCGTGACAGTCAGTTACTGGGCAATATTATCCGTTATCAGGTGGATACCGGACTGGGCGCACTGACCGTGGATCTGCTGAACCGCTCCTCAGAGCGGCTGTTTGAACAGGGCACTCAGCTGGAGCTGATGTTCAATAAAAATGAAATCCGCGCCCTTGCCCCGTCAGTTAATTAAAGGAACGTCATGTCAACATTAGCGGTTTTCGACCTCGATCACACCTTAAT