Homologs in group_37

Help

12 homologs were identified in 7 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_09415 FBDBKF_09415 100.0 Morganella morganii S1 potA spermidine/putrescine ABC transporter ATP-binding protein PotA
FBDBKF_17650 FBDBKF_17650 45.9 Morganella morganii S1 potA ABC-type Fe3+/spermidine/putrescine transport systems, ATPase component
EHELCC_18135 EHELCC_18135 45.9 Morganella morganii S2 potA ABC-type Fe3+/spermidine/putrescine transport systems, ATPase component
NLDBIP_10340 NLDBIP_10340 100.0 Morganella morganii S4 potA spermidine/putrescine ABC transporter ATP-binding protein PotA
NLDBIP_18015 NLDBIP_18015 45.9 Morganella morganii S4 potA ABC-type Fe3+/spermidine/putrescine transport systems, ATPase component
LHKJJB_11015 LHKJJB_11015 100.0 Morganella morganii S3 potA spermidine/putrescine ABC transporter ATP-binding protein PotA
LHKJJB_18210 LHKJJB_18210 45.9 Morganella morganii S3 potA ABC-type Fe3+/spermidine/putrescine transport systems, ATPase component
HKOGLL_14075 HKOGLL_14075 100.0 Morganella morganii S5 potA spermidine/putrescine ABC transporter ATP-binding protein PotA
HKOGLL_17990 HKOGLL_17990 45.9 Morganella morganii S5 potA ABC-type Fe3+/spermidine/putrescine transport systems, ATPase component
F4V73_RS10550 F4V73_RS10550 91.6 Morganella psychrotolerans potA spermidine/putrescine ABC transporter ATP-binding protein PotA
F4V73_RS15030 F4V73_RS15030 44.9 Morganella psychrotolerans - ABC transporter ATP-binding protein
PMI_RS13490 PMI_RS13490 85.2 Proteus mirabilis HI4320 potA spermidine/putrescine ABC transporter ATP-binding protein PotA

Distribution of the homologs in the orthogroup group_37

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_37

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q32EY4 0.0 607 79 0 366 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella dysenteriae serotype 1 (strain Sd197)
P69877 0.0 606 79 0 366 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella flexneri
P69874 0.0 606 79 0 366 1 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli (strain K12)
P69875 0.0 606 79 0 366 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TIU8 0.0 606 79 0 366 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O6:K15:H31 (strain 536 / UPEC)
P69876 0.0 606 79 0 366 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O157:H7
Q1RD28 0.0 605 79 0 366 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli (strain UTI89 / UPEC)
A1AA20 0.0 605 79 0 366 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O1:K1 / APEC
Q3Z2Z3 0.0 605 78 0 366 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella sonnei (strain Ss046)
Q31ZK0 0.0 605 78 0 366 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella boydii serotype 4 (strain Sb227)
Q5PMK1 0.0 603 79 0 363 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella paratyphi A (strain ATCC 9150 / SARB42)
P40790 0.0 603 79 0 363 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q57QC8 0.0 603 79 0 363 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella choleraesuis (strain SC-B67)
Q8Z7H7 0.0 599 79 0 363 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella typhi
Q0T5R2 0.0 598 77 0 366 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella flexneri serotype 5b (strain 8401)
Q6D4E2 0.0 583 76 0 371 3 potA Spermidine/putrescine import ATP-binding protein PotA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q6LR20 0.0 572 74 0 368 3 potA Spermidine/putrescine import ATP-binding protein PotA Photobacterium profundum (strain SS9)
Q5E586 0.0 564 72 1 370 3 potA Spermidine/putrescine import ATP-binding protein PotA Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q65UE1 0.0 563 73 1 363 3 potA Spermidine/putrescine import ATP-binding protein PotA Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q9CP06 0.0 561 71 1 369 3 potA Spermidine/putrescine import ATP-binding protein PotA Pasteurella multocida (strain Pm70)
Q87PH3 0.0 544 73 1 362 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q9KS33 0.0 543 73 1 363 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q7MKU3 0.0 538 72 1 362 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio vulnificus (strain YJ016)
Q8D9J4 0.0 538 72 1 362 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio vulnificus (strain CMCP6)
Q0I3Y9 0.0 537 69 1 371 3 potA Spermidine/putrescine import ATP-binding protein PotA Histophilus somni (strain 129Pt)
O85818 0.0 527 67 1 371 3 potA Spermidine/putrescine import ATP-binding protein PotA Aggregatibacter actinomycetemcomitans
P45171 0.0 526 68 1 363 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q4QK57 0.0 523 68 1 363 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus influenzae (strain 86-028NP)
Q7VNG4 0.0 518 68 2 362 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q2SJY7 2.71e-155 444 61 0 364 3 potA Spermidine/putrescine import ATP-binding protein PotA Hahella chejuensis (strain KCTC 2396)
A1TXH7 3.85e-153 439 59 2 363 3 potA Spermidine/putrescine import ATP-binding protein PotA Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q30V33 1.82e-147 424 57 1 364 3 potA Spermidine/putrescine import ATP-binding protein PotA Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
Q72FW5 9.58e-146 420 57 2 360 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q1QE80 7.14e-143 414 54 5 402 3 potA Spermidine/putrescine import ATP-binding protein PotA Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q5ZWE4 3.48e-137 398 53 2 362 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q5WXF0 5.15e-136 395 52 2 362 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila (strain Lens)
Q60AI1 2.93e-135 394 53 2 365 3 potA Spermidine/putrescine import ATP-binding protein PotA Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q1MQ44 4.21e-135 393 54 2 361 3 potA Spermidine/putrescine import ATP-binding protein PotA Lawsonia intracellularis (strain PHE/MN1-00)
Q5X627 5.62e-135 392 52 2 362 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila (strain Paris)
Q18AM3 1.38e-105 317 50 5 322 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridioides difficile (strain 630)
Q4L5B3 2.25e-104 314 52 3 292 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus haemolyticus (strain JCSC1435)
Q49WM4 6.52e-104 313 51 3 290 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q5LBT4 6.62e-104 317 50 7 339 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
Q97KS6 7.14e-104 313 50 3 319 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q64SQ6 1.21e-103 316 49 6 339 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides fragilis (strain YCH46)
Q74K65 7.36e-103 310 53 3 292 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q0SRL2 1.71e-102 309 50 3 319 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain SM101 / Type A)
Q47T99 2.22e-102 310 46 7 373 3 potA Spermidine/putrescine import ATP-binding protein PotA Thermobifida fusca (strain YX)
Q6HLQ9 5.23e-102 307 60 0 240 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q63E84 5.23e-102 307 60 0 240 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ZK / E33L)
Q73BM0 5.23e-102 307 60 0 240 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ATCC 10987 / NRS 248)
A0RBB0 5.23e-102 307 60 0 240 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus thuringiensis (strain Al Hakam)
Q03PF2 7.33e-102 308 53 2 289 3 potA Spermidine/putrescine import ATP-binding protein PotA Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
Q8A883 7.55e-102 311 50 4 328 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q042G7 8.38e-102 308 53 3 292 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
Q81TH8 1.25e-101 306 60 0 240 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus anthracis
Q8XIZ5 1.3e-101 307 50 4 321 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain 13 / Type A)
Q0TNZ3 1.3e-101 307 50 4 321 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
A3DDF6 2.03e-101 306 49 4 317 3 potA Spermidine/putrescine import ATP-binding protein PotA Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q1AS06 2.13e-101 307 53 1 292 3 potA Spermidine/putrescine import ATP-binding protein PotA Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
Q1GB17 3.02e-101 306 51 4 297 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
Q02R79 3.22e-101 306 49 3 326 3 potA Spermidine/putrescine import ATP-binding protein PotA Pseudomonas aeruginosa (strain UCBPP-PA14)
Q81GC1 3.47e-101 305 60 0 240 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q9HY19 3.59e-101 306 49 3 326 3 potA2 Spermidine/putrescine import ATP-binding protein PotA 2 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A0PY57 4.4e-101 305 51 2 289 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium novyi (strain NT)
Q88ZJ6 8.37e-101 305 53 1 286 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q04BG2 9.55e-101 305 51 4 297 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q14Q07 3.82e-100 303 45 5 361 3 potA Spermidine/putrescine import ATP-binding protein PotA Spiroplasma citri
Q03AH0 5.37e-100 303 54 2 285 3 potA Spermidine/putrescine import ATP-binding protein PotA Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
Q8ELR4 1.24e-99 302 46 7 366 3 potA Spermidine/putrescine import ATP-binding protein PotA Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q160M2 1.39e-99 302 53 2 286 3 potA Spermidine/putrescine import ATP-binding protein PotA Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q1B8V9 1.41e-99 303 47 4 340 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycobacterium sp. (strain MCS)
A1UG51 1.41e-99 303 47 4 340 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycobacterium sp. (strain KMS)
Q5HQ70 1.54e-99 302 51 2 288 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
A1TAI4 1.77e-99 302 49 2 311 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
Q5FL41 3.7e-99 301 52 3 290 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
Q8RI39 5.12e-99 301 44 4 356 3 potA Spermidine/putrescine import ATP-binding protein PotA Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q8CPN0 1.03e-98 300 51 2 288 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q92DL6 1.6e-98 300 52 3 286 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q9X196 1.86e-98 299 46 1 321 3 potA Spermidine/putrescine import ATP-binding protein PotA Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q722B1 2.14e-98 299 52 3 286 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria monocytogenes serotype 4b (strain F2365)
A0LUE6 2.15e-98 300 45 4 364 3 potA Spermidine/putrescine import ATP-binding protein PotA Acidothermus cellulolyticus (strain ATCC 43068 / DSM 8971 / 11B)
Q03ZQ0 2.19e-98 299 49 2 310 3 potA Spermidine/putrescine import ATP-binding protein PotA Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
A0AGP9 2.69e-98 299 52 3 286 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q6F0V4 3.2e-98 298 43 6 356 3 potA Spermidine/putrescine import ATP-binding protein PotA Mesoplasma florum (strain ATCC 33453 / NBRC 100688 / NCTC 11704 / L1)
Q38VW6 4.45e-98 298 51 2 286 3 potA Spermidine/putrescine import ATP-binding protein PotA Latilactobacillus sakei subsp. sakei (strain 23K)
Q8Y8T6 1.3e-97 297 52 3 286 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q8DPC2 1.78e-97 297 55 4 292 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q97Q42 1.78e-97 297 55 4 292 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q04JW0 1.78e-97 297 55 4 292 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q8YM92 1.93e-97 297 57 1 247 3 potA Spermidine/putrescine import ATP-binding protein PotA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q3MAR5 2.27e-97 297 57 1 247 3 potA Spermidine/putrescine import ATP-binding protein PotA Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q8DUF7 2.66e-97 297 54 4 292 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q830W6 4.95e-97 295 52 3 289 3 potA Spermidine/putrescine import ATP-binding protein PotA Enterococcus faecalis (strain ATCC 700802 / V583)
Q7A169 5.16e-97 296 52 3 290 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain MW2)
Q6GAB5 5.16e-97 296 52 3 290 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain MSSA476)
Q6GHY6 5.16e-97 296 52 3 290 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain MRSA252)
Q7A679 5.16e-97 296 52 3 290 1 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain N315)
Q99V03 5.16e-97 296 52 3 290 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HGY5 5.16e-97 296 52 3 290 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain COL)
Q2YX74 5.16e-97 296 52 3 290 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q2G2A7 5.16e-97 296 52 3 290 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FHY1 5.16e-97 296 52 3 290 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain USA300)
A3CMQ7 6.32e-97 296 54 4 292 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus sanguinis (strain SK36)
Q5L222 7.86e-97 295 51 2 292 3 potA Spermidine/putrescine import ATP-binding protein PotA Geobacillus kaustophilus (strain HTA426)
Q7CN92 1.11e-96 295 53 5 290 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q99ZS8 1.11e-96 295 53 5 290 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M1
Q1GIE5 1.33e-96 295 45 7 381 3 potA Spermidine/putrescine import ATP-binding protein PotA Ruegeria sp. (strain TM1040)
Q5XCA4 2.98e-96 294 52 5 290 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q1J6Q6 3.25e-96 294 52 5 290 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q1JGY7 3.25e-96 294 52 5 290 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q1JLT7 3.25e-96 294 52 5 290 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1JBV6 3.25e-96 294 52 5 290 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M12 (strain MGAS2096)
Q5M397 4.55e-96 294 52 4 293 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q03JH1 4.86e-96 294 52 4 293 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q5LYN4 5.13e-96 294 52 4 293 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus thermophilus (strain CNRZ 1066)
P0CZ35 6.16e-96 293 52 5 290 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M3 (strain SSI-1)
Q48TP4 6.16e-96 293 52 5 290 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M28 (strain MGAS6180)
P0CZ34 6.16e-96 293 52 5 290 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q24XJ2 7.07e-96 292 50 2 285 3 potA Spermidine/putrescine import ATP-binding protein PotA Desulfitobacterium hafniense (strain Y51)
Q8DZJ0 9.93e-96 293 52 4 293 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E554 9.93e-96 293 52 4 293 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype III (strain NEM316)
Q3K0Y6 9.93e-96 293 52 4 293 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q9I6T2 3.8e-95 291 47 3 332 3 potA1 Spermidine/putrescine import ATP-binding protein PotA 1 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q6MCV4 9.71e-95 290 48 3 311 3 potA Spermidine/putrescine import ATP-binding protein PotA Protochlamydia amoebophila (strain UWE25)
Q110U3 1.15e-94 290 45 2 338 3 potA Spermidine/putrescine import ATP-binding protein PotA Trichodesmium erythraeum (strain IMS101)
Q04G50 3.6e-94 288 49 4 296 3 potA Spermidine/putrescine import ATP-binding protein PotA Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
Q3KBH4 4.5e-94 288 46 6 349 3 potA Spermidine/putrescine import ATP-binding protein PotA Pseudomonas fluorescens (strain Pf0-1)
Q1WVI7 6.43e-94 288 50 3 285 3 potA Spermidine/putrescine import ATP-binding protein PotA Ligilactobacillus salivarius (strain UCC118)
Q5LT05 8.66e-94 287 44 5 365 3 potA Spermidine/putrescine import ATP-binding protein PotA Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q0SML1 1.66e-93 286 49 4 289 3 potA Spermidine/putrescine import ATP-binding protein PotA Borreliella afzelii (strain PKo)
O51587 2.15e-93 286 49 4 289 3 potA Spermidine/putrescine import ATP-binding protein PotA Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
Q98HF7 1.57e-92 284 49 3 307 3 potA Spermidine/putrescine import ATP-binding protein PotA Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q578K3 1.71e-92 284 44 5 340 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella abortus biovar 1 (strain 9-941)
Q2YKX3 1.71e-92 284 44 5 340 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella abortus (strain 2308)
Q660M8 3.73e-92 283 48 4 289 3 potA Spermidine/putrescine import ATP-binding protein PotA Borrelia garinii subsp. bavariensis (strain ATCC BAA-2496 / DSM 23469 / PBi)
Q4K681 1.64e-91 282 46 5 338 3 potA Spermidine/putrescine import ATP-binding protein PotA Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q0AGF4 3.3e-91 281 43 5 369 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
O83658 3.78e-91 281 47 4 335 3 potA Spermidine/putrescine import ATP-binding protein PotA Treponema pallidum (strain Nichols)
Q02Z10 5.51e-91 282 49 4 289 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactococcus lactis subsp. cremoris (strain SK11)
Q8YCG3 1.57e-90 278 44 5 340 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q9CGD4 3.51e-90 280 49 4 289 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactococcus lactis subsp. lactis (strain IL1403)
Q8FVV5 3.51e-90 278 44 5 340 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella suis biovar 1 (strain 1330)
Q2K8C8 4.31e-90 278 42 7 366 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q2SSS4 7.43e-90 277 50 1 260 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma capricolum subsp. capricolum (strain California kid / ATCC 27343 / NCTC 10154)
Q6MU19 1.06e-89 276 50 1 260 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma mycoides subsp. mycoides SC (strain CCUG 32753 / NCTC 10114 / PG1)
Q9KLQ5 6.28e-89 275 49 2 283 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q92WJ0 1.23e-88 274 41 6 359 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Rhizobium meliloti (strain 1021)
Q0RAT5 1.64e-88 277 44 4 343 3 potA Spermidine/putrescine import ATP-binding protein PotA Frankia alni (strain DSM 45986 / CECT 9034 / ACN14a)
Q82TL6 4.34e-88 273 44 4 359 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q8U6M1 2.63e-87 270 41 6 363 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Agrobacterium fabrum (strain C58 / ATCC 33970)
P31134 7.82e-87 270 46 2 293 1 potG Putrescine transport ATP-binding protein PotG Escherichia coli (strain K12)
Q7NQN5 1.02e-86 269 43 2 343 3 potA Spermidine/putrescine import ATP-binding protein PotA Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q2YAD6 4.44e-86 268 40 5 369 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q609Q1 5.93e-85 264 53 1 245 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q6LKD4 7.81e-85 264 49 2 258 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Photobacterium profundum (strain SS9)
P77795 1.12e-84 263 40 6 367 3 ydcT Uncharacterized ABC transporter ATP-binding protein YdcT Escherichia coli (strain K12)
Q7AH43 1.34e-83 261 51 0 241 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Escherichia coli O157:H7
Q9YGA6 1.53e-83 261 47 4 292 1 malK Trehalose/maltose import ATP-binding protein MalK Thermococcus litoralis (strain ATCC 51850 / DSM 5473 / JCM 8560 / NS-C)
Q9KL04 6.01e-83 260 44 4 301 3 malK Maltose/maltodextrin import ATP-binding protein MalK Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q8RGC8 8.26e-83 259 40 3 323 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q92UV5 1.2e-82 260 57 0 226 3 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Rhizobium meliloti (strain 1021)
P37009 1.54e-82 258 51 0 240 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Escherichia coli (strain K12)
Q8YCB1 1.78e-82 258 53 1 233 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q6D734 3.95e-82 257 51 0 240 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
P44531 4.35e-82 256 42 4 328 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8FW07 7.91e-82 256 53 1 233 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Brucella suis biovar 1 (strain 1330)
Q578E9 7.91e-82 256 53 1 233 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Brucella abortus biovar 1 (strain 9-941)
Q5DZC6 8.19e-82 257 44 3 286 3 malK Maltose/maltodextrin import ATP-binding protein MalK Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q2YKR8 1.01e-81 256 53 1 233 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Brucella abortus (strain 2308)
Q7NWX3 1.59e-81 256 45 3 298 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q87GB5 2.61e-81 256 44 3 286 3 malK Maltose/maltodextrin import ATP-binding protein MalK Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q9L0Q1 4.85e-81 255 52 0 221 1 msiK Diacetylchitobiose uptake system ATP-binding protein MsiK Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q7MFC4 5.63e-81 255 44 4 287 3 malK Maltose/maltodextrin import ATP-binding protein MalK Vibrio vulnificus (strain YJ016)
Q8D3V0 5.63e-81 255 44 4 287 3 malK Maltose/maltodextrin import ATP-binding protein MalK Vibrio vulnificus (strain CMCP6)
P54933 7.13e-81 253 52 0 233 3 smoK ATP-binding transport protein SmoK Cereibacter sphaeroides
Q8DIA0 7.63e-81 253 42 4 323 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q7N8B9 7.74e-81 254 50 0 242 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q0I2Z4 1.18e-80 253 50 0 240 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Histophilus somni (strain 129Pt)
Q7W9U5 1.32e-80 253 45 2 290 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7VZE5 1.53e-80 253 45 2 290 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q92WD6 1.93e-80 253 51 2 241 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Rhizobium meliloti (strain 1021)
Q7WGW1 2.05e-80 253 45 2 290 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q9CM80 4.28e-80 252 45 3 289 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Pasteurella multocida (strain Pm70)
Q6LK87 6.56e-80 252 42 4 310 3 malK Maltose/maltodextrin import ATP-binding protein MalK Photobacterium profundum (strain SS9)
P74548 7.73e-80 251 42 3 317 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
O31339 7.78e-80 251 51 2 245 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bacillus cereus (strain ATCC 10987 / NRS 248)
Q7CS28 8.28e-80 251 49 0 232 1 smoE Sulfoquinovosyl glycerol transport ATP-binding protein SmoE Agrobacterium fabrum (strain C58 / ATCC 33970)
P55604 8.54e-80 252 49 1 243 3 NGR_a02170 Uncharacterized ABC transporter ATP-binding protein y4oS Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q9G4F5 1.36e-79 250 51 1 239 3 CYSA Sulfate/thiosulfate import ATP-binding protein cysA Cucumis sativus
Q65S66 1.63e-79 250 44 2 288 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q1GID1 1.89e-79 250 48 1 243 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Ruegeria sp. (strain TM1040)
Q8UII7 2.47e-79 250 51 1 228 3 ugpC1 sn-glycerol-3-phosphate import ATP-binding protein UgpC 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q6F9A8 3.27e-79 249 42 5 329 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q79EE4 3.71e-79 250 48 1 252 1 ggtA Osmoprotective compounds uptake ATP-binding protein GgtA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q5LX21 4.89e-79 249 49 0 233 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q7NIW1 5.78e-79 249 41 4 324 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q82WT5 6.44e-79 249 45 2 296 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q8UB29 1.03e-78 248 51 1 234 3 ugpC3 sn-glycerol-3-phosphate import ATP-binding protein UgpC 3 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q66FU4 1.14e-78 248 49 2 244 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Yersinia pseudotuberculosis serotype I (strain IP32953)
D4GP39 1.55e-78 249 50 3 249 1 xacK Xylose/arabinose import ATP-binding protein XacK Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
Q8FHR3 2.72e-78 248 42 5 298 3 ycjV Uncharacterized ABC transporter ATP-binding protein YcjV Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8X8K4 3.27e-78 247 42 5 298 3 ycjV Uncharacterized ABC transporter ATP-binding protein YcjV Escherichia coli O157:H7
Q0TI47 6.8e-78 246 47 1 234 3 ycjV Uncharacterized ABC transporter ATP-binding protein YcjV Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q1CNC6 7.01e-78 246 49 2 244 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Yersinia pestis bv. Antiqua (strain Nepal516)
Q74R28 7.01e-78 246 49 2 244 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Yersinia pestis
Q1CBH2 7.01e-78 246 49 2 244 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Yersinia pestis bv. Antiqua (strain Antiqua)
Q9K876 9.18e-78 246 45 2 275 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
P77481 1e-77 246 42 5 298 5 ycjV Putative uncharacterized ABC transporter ATP-binding protein YcjV Escherichia coli (strain K12)
Q1RC47 1.05e-77 246 42 5 298 4 ycjV Uncharacterized ABC transporter ATP-binding protein YcjV Escherichia coli (strain UTI89 / UPEC)
Q9Z3R9 1.12e-77 246 44 5 295 3 aglK Alpha-glucoside transport ATP-binding protein AglK Rhizobium meliloti (strain 1021)
Q81GU1 1.38e-77 246 50 2 245 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
P94360 2.47e-77 245 49 2 235 1 msmX Oligosaccharides import ATP-binding protein MsmX Bacillus subtilis (strain 168)
A1SWH9 2.55e-77 245 43 4 289 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q93DX8 4.13e-77 241 48 1 248 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA (Fragment) Burkholderia cepacia
Q8Z0H0 4.31e-77 244 48 0 240 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
P96063 4.42e-77 244 49 1 243 2 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q57SD6 4.52e-77 244 49 1 243 3 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella choleraesuis (strain SC-B67)
A1B9Q7 4.53e-77 244 45 3 288 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Paracoccus denitrificans (strain Pd 1222)
Q9JUX4 4.89e-77 244 47 1 245 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q8F6Z1 5.01e-77 244 49 1 245 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72PE5 5.01e-77 244 49 1 245 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q65T42 5.14e-77 244 41 4 320 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
O32151 5.46e-77 244 47 0 232 3 yurJ Uncharacterized ABC transporter ATP-binding protein YurJ Bacillus subtilis (strain 168)
Q9JZW0 5.56e-77 244 47 1 245 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q8FVT0 5.91e-77 244 48 0 233 3 BRA0745 Putative ATP-binding protein BRA0745/BS1330_II0738 Brucella suis biovar 1 (strain 1330)
Q2YKZ7 5.98e-77 244 48 0 233 3 BAB2_0493 Putative ATP-binding protein BAB2_0493 Brucella abortus (strain 2308)
Q578M5 5.98e-77 244 48 0 233 3 BruAb2_0487 Putative ATP-binding protein BruAb2_0487 Brucella abortus biovar 1 (strain 9-941)
Q98G42 6.94e-77 244 43 4 290 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q88AS5 1.23e-76 242 44 6 310 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q88CL2 1.4e-76 242 43 6 310 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q01937 1.46e-76 243 44 2 285 3 lacK Lactose transport ATP-binding protein LacK Rhizobium radiobacter
Q8Z8W8 1.53e-76 243 49 1 243 3 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella typhi
Q63TY1 1.61e-76 243 48 1 245 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Burkholderia pseudomallei (strain K96243)
Q62K82 1.66e-76 243 48 1 245 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Burkholderia mallei (strain ATCC 23344)
Q5PFQ7 1.78e-76 243 49 1 243 3 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q8XZX8 2.89e-76 243 48 0 233 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q9PDN2 3.41e-76 242 48 1 239 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xylella fastidiosa (strain 9a5c)
Q8E8K8 5.4e-76 241 48 1 247 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
P10907 7.66e-76 241 48 2 244 1 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Escherichia coli (strain K12)
P9WQI3 7.95e-76 242 49 2 242 1 sugC Trehalose import ATP-binding protein SugC Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQI2 7.95e-76 242 49 2 242 3 sugC Trehalose import ATP-binding protein SugC Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q3YW77 8.53e-76 241 48 2 244 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Shigella sonnei (strain Ss046)
A1JIE0 8.56e-76 241 49 1 234 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q31VH5 9e-76 241 48 2 244 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Shigella boydii serotype 4 (strain Sb227)
Q9KUI0 1.21e-75 241 50 1 244 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q8EBC3 1.29e-75 241 50 1 244 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q2K6L3 1.36e-75 240 46 1 244 3 ugpC1 sn-glycerol-3-phosphate import ATP-binding protein UgpC 1 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q9TKX3 1.48e-75 240 47 0 235 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nephroselmis olivacea
Q8X6U5 1.53e-75 240 48 2 244 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Escherichia coli O157:H7
Q7NX01 1.65e-75 240 40 7 351 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q0K998 2.21e-75 240 48 1 234 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q9KRT4 2.49e-75 240 41 4 284 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q28QL7 2.82e-75 239 49 1 233 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Jannaschia sp. (strain CCS1)
Q1M8R6 3.01e-75 239 46 1 244 3 ugpC2 sn-glycerol-3-phosphate import ATP-binding protein UgpC 2 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q46ZM0 3.63e-75 240 48 1 234 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
P55453 3.75e-75 239 49 0 236 3 NGR_a03670 Uncharacterized ABC transporter ATP-binding protein y4fO Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q2K4V4 4.08e-75 239 46 0 232 3 ugpC2 sn-glycerol-3-phosphate import ATP-binding protein UgpC 2 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
A1URR2 5.32e-75 238 48 2 247 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bartonella bacilliformis (strain ATCC 35685 / KC583 / Herrer 020/F12,63)
Q8UBB7 9.53e-75 239 40 5 306 3 ugpC2 sn-glycerol-3-phosphate import ATP-binding protein UgpC 2 Agrobacterium fabrum (strain C58 / ATCC 33970)
A3PRY1 9.63e-75 238 48 1 241 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
Q9I6L0 1.18e-74 237 43 6 310 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q87DT9 1.44e-74 238 48 1 239 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q664X5 1.69e-74 238 42 3 293 3 malK Maltose/maltodextrin import ATP-binding protein MalK Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CNR8 1.69e-74 238 42 3 293 3 malK Maltose/maltodextrin import ATP-binding protein MalK Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZAS8 1.69e-74 238 42 3 293 3 malK Maltose/maltodextrin import ATP-binding protein MalK Yersinia pestis
Q1CC21 1.69e-74 238 42 3 293 3 malK Maltose/maltodextrin import ATP-binding protein MalK Yersinia pestis bv. Antiqua (strain Antiqua)
Q8UA73 1.71e-74 237 40 4 304 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8D653 1.82e-74 237 42 8 341 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Vibrio vulnificus (strain CMCP6)
Q2L0H5 1.85e-74 238 46 2 244 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bordetella avium (strain 197N)
Q6G5J0 2.39e-74 237 47 2 246 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
Q7N6Z2 2.75e-74 237 43 4 291 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q1MCN6 2.84e-74 238 46 0 232 3 ugpC1 sn-glycerol-3-phosphate import ATP-binding protein UgpC 1 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q65QT6 3.16e-74 238 42 4 288 3 malK Maltose/maltodextrin import ATP-binding protein MalK Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
P14788 4.14e-74 236 49 0 237 2 cysA Sulfate/thiosulfate import ATP-binding protein CysA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q7NRX5 4.39e-74 237 42 4 289 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q8PC11 5.04e-74 236 44 4 287 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q6G194 5.3e-74 236 47 2 246 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bartonella quintana (strain Toulouse)
Q57293 1.01e-73 235 39 5 342 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Actinobacillus pleuropneumoniae
Q3IX40 1.02e-73 235 48 1 241 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q6D201 1.21e-73 234 47 1 239 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q8UH62 1.55e-73 235 49 2 251 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q164Y5 1.59e-73 235 46 2 240 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q0BIZ6 1.61e-73 235 49 1 234 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q1LLP5 2.23e-73 235 48 1 234 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q8FCQ2 2.31e-73 234 44 4 277 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8D954 2.49e-73 235 44 2 245 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Vibrio vulnificus (strain CMCP6)
Q1R5H8 2.6e-73 234 44 4 277 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Escherichia coli (strain UTI89 / UPEC)
Q0TC10 2.6e-73 234 47 2 244 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AGY1 2.6e-73 234 44 4 277 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Escherichia coli O1:K1 / APEC
Q7MLB8 2.72e-73 235 44 2 245 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Vibrio vulnificus (strain YJ016)
Q1BRZ8 2.88e-73 234 48 1 234 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Burkholderia orbicola (strain AU 1054)
A0K3S5 2.88e-73 234 48 1 234 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Burkholderia cenocepacia (strain HI2424)
Q6CZ34 3.7e-73 234 49 1 234 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q8PNN4 4.3e-73 234 49 1 234 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xanthomonas axonopodis pv. citri (strain 306)
Q7N986 6.29e-73 234 42 2 292 3 malK Maltose/maltodextrin import ATP-binding protein MalK Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q5YZY9 6.34e-73 233 47 0 235 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nocardia farcinica (strain IFM 10152)
Q89UD2 9.42e-73 233 46 3 265 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q39KB9 1.25e-72 233 48 1 234 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q21CA3 1.95e-72 233 43 4 284 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Rhodopseudomonas palustris (strain BisB18)
P9WQM1 3.32e-72 231 44 0 246 1 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQM0 3.32e-72 231 44 0 246 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A4W3 3.32e-72 231 44 0 246 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q2K1C8 3.7e-72 231 45 1 253 3 ugpC3 sn-glycerol-3-phosphate import ATP-binding protein UgpC 3 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q89WG0 4.44e-72 231 42 3 288 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q7VYN2 6.38e-72 231 40 5 297 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7WID6 6.45e-72 231 40 5 297 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q6NBT1 1.14e-71 230 47 1 245 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q7W6G5 1.19e-71 230 40 5 297 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7UBD0 1.31e-71 231 41 4 295 3 malK Maltose/maltodextrin import ATP-binding protein MalK Shigella flexneri
Q8FB37 1.31e-71 231 41 4 295 3 malK Maltose/maltodextrin import ATP-binding protein MalK Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q2J2E9 1.48e-71 230 41 6 316 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Rhodopseudomonas palustris (strain HaA2)
Q8Z1U0 1.64e-71 230 41 4 294 3 malK Maltose/maltodextrin import ATP-binding protein MalK Salmonella typhi
P19566 1.71e-71 230 41 4 294 1 malK Maltose/maltodextrin import ATP-binding protein MalK Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q57GZ7 1.71e-71 230 41 4 294 3 malK Maltose/maltodextrin import ATP-binding protein MalK Salmonella choleraesuis (strain SC-B67)
Q57IS3 1.71e-71 230 47 2 242 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Salmonella choleraesuis (strain SC-B67)
Q3YUV0 1.75e-71 230 41 4 295 3 malK Maltose/maltodextrin import ATP-binding protein MalK Shigella sonnei (strain Ss046)
Q1R3Q1 1.75e-71 230 41 4 295 1 malK Maltose/maltodextrin import ATP-binding protein MalK Escherichia coli (strain UTI89 / UPEC)
P68187 1.75e-71 230 41 4 295 1 malK Maltose/maltodextrin import ATP-binding protein MalK Escherichia coli (strain K12)
P68188 1.75e-71 230 41 4 295 3 malK Maltose/maltodextrin import ATP-binding protein MalK Escherichia coli O157:H7
Q668K6 1.88e-71 230 42 4 294 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Yersinia pseudotuberculosis serotype I (strain IP32953)
Q5PJL1 2.08e-71 229 46 2 242 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q07UI9 2.18e-71 230 45 3 248 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Rhodopseudomonas palustris (strain BisA53)
Q8ZLF4 2.22e-71 229 46 2 242 1 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q1M589 2.3e-71 229 45 1 244 3 ugpC3 sn-glycerol-3-phosphate import ATP-binding protein UgpC 3 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q73XU8 2.37e-71 229 44 0 243 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q0SXQ1 2.66e-71 230 41 4 295 3 malK Maltose/maltodextrin import ATP-binding protein MalK Shigella flexneri serotype 5b (strain 8401)
Q5PKZ8 3.33e-71 229 41 4 294 3 malK Maltose/maltodextrin import ATP-binding protein MalK Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q8XZP8 4.08e-71 229 44 3 275 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q00752 4.59e-71 229 45 2 238 3 msmK Multiple sugar-binding transport ATP-binding protein MsmK Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q13TV1 5.72e-71 229 45 2 244 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Paraburkholderia xenovorans (strain LB400)
Q2SU77 5.82e-71 229 47 1 234 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
D4GP38 6.6e-71 229 49 1 234 1 xacJ Xylose/arabinose import ATP-binding protein XacJ Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
Q92VJ2 8.36e-71 228 45 3 278 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Rhizobium meliloti (strain 1021)
Q0TA26 1.01e-70 228 41 4 295 3 malK Maltose/maltodextrin import ATP-binding protein MalK Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q9MUN1 1.05e-70 228 43 0 240 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mesostigma viride
Q8D0W8 1.13e-70 228 41 4 294 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Yersinia pestis
P63354 1.43e-70 228 47 1 245 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Brucella suis biovar 1 (strain 1330)
P63353 1.43e-70 228 47 1 245 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q13ER6 1.66e-70 228 40 6 317 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Rhodopseudomonas palustris (strain BisB5)
Q8Z245 1.69e-70 227 46 2 242 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Salmonella typhi
P56344 1.85e-70 223 47 0 232 3 cysA Probable sulfate/thiosulfate import ATP-binding protein CysA Chlorella vulgaris
Q3JMW7 3.82e-70 226 42 5 289 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Burkholderia pseudomallei (strain 1710b)
Q6NDQ0 5.05e-70 226 41 2 283 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q63Q62 5.94e-70 226 47 1 234 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Burkholderia pseudomallei (strain K96243)
Q62GB4 7.36e-70 226 47 1 234 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Burkholderia mallei (strain ATCC 23344)
Q9A7X1 1.09e-69 224 48 1 245 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q92XW1 5.58e-69 223 47 1 242 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Rhizobium meliloti (strain 1021)
Q0SBZ1 2.36e-68 221 41 11 333 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Rhodococcus jostii (strain RHA1)
P18813 4.3e-68 219 41 5 294 3 malK Maltose/maltodextrin import ATP-binding protein MalK (Fragment) Klebsiella aerogenes
P44513 5.15e-68 221 36 4 338 1 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q4QP85 5.48e-68 221 36 4 338 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Haemophilus influenzae (strain 86-028NP)
Q0S0Z3 7.38e-68 220 40 10 333 3 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Rhodococcus jostii (strain RHA1)
Q1QTX6 8.14e-68 221 45 1 232 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q8FFB3 2.95e-67 219 46 1 239 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P16676 3.05e-67 219 46 1 239 1 cysA Sulfate/thiosulfate import ATP-binding protein CysA Escherichia coli (strain K12)
Q8XBJ8 3.29e-67 219 46 1 239 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Escherichia coli O157:H7
O86751 3.52e-67 218 38 5 328 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P40860 5.5e-67 218 46 1 240 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8Z4V6 6.28e-67 218 47 1 234 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Salmonella typhi
Q7UC29 8.72e-67 218 45 1 239 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Shigella flexneri
Q8U4K3 8.8e-67 217 37 6 350 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q82JY6 2.07e-66 216 35 4 362 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q5FA19 2.27e-66 216 38 6 327 1 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q0RYP7 8.32e-66 215 39 10 341 3 fbpC3 Fe(3+) ions import ATP-binding protein FbpC 3 Rhodococcus jostii (strain RHA1)
Q4W575 1.22e-65 214 38 6 327 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9JVH1 1.22e-65 214 38 6 327 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q98K23 1.09e-64 212 47 1 237 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q5JEB0 1.54e-64 211 39 4 294 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
O57896 5.85e-64 210 38 2 285 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
P10091 8.54e-64 210 41 0 232 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Marchantia polymorpha
Q3KCC5 1.04e-62 207 38 9 330 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Pseudomonas fluorescens (strain Pf0-1)
Q98G43 5.4e-62 206 37 9 343 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q9V2C0 3.71e-61 203 38 4 294 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Pyrococcus abyssi (strain GE5 / Orsay)
Q6D2F6 6.41e-61 202 38 5 300 3 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q50966 1.68e-60 201 36 6 327 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria gonorrhoeae
Q4KC87 3.27e-60 201 39 8 314 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q85A69 7.37e-60 201 41 0 229 2 cysA Sulfate/thiosulfate import ATP-binding protein CysA Anthoceros angustus
Q97UY8 4.06e-58 195 35 6 335 1 glcV Glucose import ATP-binding protein GlcV Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
P21410 8.22e-57 191 42 3 246 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Serratia marcescens
Q9KIF7 9.03e-56 191 43 1 219 3 opuAA Glycine betaine transport ATP-binding protein OpuAA Lactococcus lactis subsp. lactis (strain IL1403)
Q9KHT9 9.21e-56 190 42 4 241 1 opuCA Carnitine transport ATP-binding protein OpuCA Listeria monocytogenes
G2JZ44 9.21e-56 190 42 4 241 1 opuCA Carnitine transport ATP-binding protein OpuCA Listeria monocytogenes serotype 1/2a (strain 10403S)
P46920 1.3e-55 191 37 4 297 1 opuAA Glycine betaine transport ATP-binding protein OpuAA Bacillus subtilis (strain 168)
O34992 4.35e-55 188 41 4 238 1 opuCA Glycine betaine/carnitine/choline transport ATP-binding protein OpuCA Bacillus subtilis (strain 168)
Q45460 2.63e-54 186 40 4 238 2 opuBA Choline transport ATP-binding protein OpuBA Bacillus subtilis (strain 168)
A0A0H2ZLL3 4.22e-53 179 40 2 237 3 egtUA Probable ergothioneine transport ATP-binding protein EgtUA Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
E0SCY1 1.84e-52 182 33 9 372 1 ousV Glycine betaine/choline transport system ATP-binding protein OusV Dickeya dadantii (strain 3937)
Q56927 3.94e-51 177 39 3 241 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Yersinia enterocolitica
Q1CJS9 1.83e-50 175 39 3 244 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZCM2 1.83e-50 175 39 3 244 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Yersinia pestis
Q1C607 1.83e-50 175 39 3 244 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Yersinia pestis bv. Antiqua (strain Antiqua)
Q668Q3 1.91e-50 175 39 3 244 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Yersinia pseudotuberculosis serotype I (strain IP32953)
Q0K9I2 3.2e-50 173 41 5 252 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q57855 9.56e-50 171 42 5 217 3 MJ0412 Uncharacterized ABC transporter ATP-binding protein MJ0412 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P17328 3.57e-49 173 40 1 227 2 proV Glycine betaine/proline betaine transport system ATP-binding protein ProV Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P14175 4.74e-49 173 39 3 246 1 proV Glycine betaine/proline betaine transport system ATP-binding protein ProV Escherichia coli (strain K12)
Q46ZU5 6.61e-49 169 45 2 205 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q4FL37 1.63e-48 170 40 2 237 1 tmoW Trimethylamine N-oxide transport system ATP-binding protein TmoW Pelagibacter ubique (strain HTCC1062)
Q8U648 1.99e-48 167 41 2 219 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q58762 2.34e-48 168 38 5 239 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q2NK31 2.59e-48 171 41 8 254 3 potA Spermidine/putrescine import ATP-binding protein PotA Aster yellows witches'-broom phytoplasma (strain AYWB)
Q2NK31 5.81e-31 125 51 0 104 3 potA Spermidine/putrescine import ATP-binding protein PotA Aster yellows witches'-broom phytoplasma (strain AYWB)
Q9RR46 2.6e-48 171 37 1 226 1 gbuA Glycine betaine/carnitine transport ATP-binding protein GbuA Listeria monocytogenes serotype 1/2a (strain 10403S)
Q89ER4 4.85e-48 167 42 3 222 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q5LT65 5.92e-48 168 40 7 266 1 tmoW Trimethylamine N-oxide transport system ATP-binding protein TmoW Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q07LQ4 6.87e-48 166 44 4 213 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Rhodopseudomonas palustris (strain BisA53)
Q88R93 7.77e-48 166 43 3 217 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q1CDR0 1.12e-47 166 41 3 215 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pestis bv. Antiqua (strain Nepal516)
Q74PI5 1.12e-47 166 41 3 215 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pestis
Q1C1S0 1.12e-47 166 41 3 215 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pestis bv. Antiqua (strain Antiqua)
O30144 1.15e-47 164 41 3 212 1 wtpC Molybdate/tungstate import ATP-binding protein WtpC Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q21XJ9 1.72e-47 165 43 5 219 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q8ZPK4 2.35e-47 168 38 3 243 1 osmV Osmoprotectant import ATP-binding protein OsmV Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q02QT1 2.46e-47 165 38 6 246 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Pseudomonas aeruginosa (strain UCBPP-PA14)
Q3BNZ3 3.36e-47 166 37 2 245 3 metN Methionine import ATP-binding protein MetN Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q7NB11 3.65e-47 170 42 6 247 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasmoides gallisepticum (strain R(low / passage 15 / clone 2))
Q7NB11 8.39e-27 114 47 1 106 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasmoides gallisepticum (strain R(low / passage 15 / clone 2))
Q6YPR6 3.75e-47 168 47 2 189 3 potA Spermidine/putrescine import ATP-binding protein PotA Onion yellows phytoplasma (strain OY-M)
Q6YPR6 2.9e-31 125 51 0 104 3 potA Spermidine/putrescine import ATP-binding protein PotA Onion yellows phytoplasma (strain OY-M)
Q665B6 4.15e-47 164 40 3 215 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pseudotuberculosis serotype I (strain IP32953)
Q6KIP2 4.22e-47 169 44 5 237 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma mobile (strain ATCC 43663 / 163K / NCTC 11711)
Q6KIP2 6.34e-26 111 39 1 128 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma mobile (strain ATCC 43663 / 163K / NCTC 11711)
Q9HYG4 6.61e-47 164 38 6 246 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8EUR3 8.11e-47 171 51 2 179 3 potA Spermidine/putrescine import ATP-binding protein PotA Malacoplasma penetrans (strain HF-2)
Q8EUR3 5.39e-23 103 44 1 105 3 potA Spermidine/putrescine import ATP-binding protein PotA Malacoplasma penetrans (strain HF-2)
Q0I354 9.25e-47 161 40 0 211 3 thiQ Thiamine import ATP-binding protein ThiQ Histophilus somni (strain 129Pt)
P55662 1.48e-46 162 34 3 250 3 NGR_a01510 Probable amino-acid ABC transporter ATP-binding protein y4tH Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q2P7S3 1.49e-46 164 37 2 245 3 metN Methionine import ATP-binding protein MetN Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q81ZF5 1.51e-46 164 35 2 241 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus anthracis
Q4FMG5 1.61e-46 162 42 4 220 3 tauB Taurine import ATP-binding protein TauB Pelagibacter ubique (strain HTCC1062)
Q8PGE8 1.66e-46 164 37 2 245 3 metN Methionine import ATP-binding protein MetN Xanthomonas axonopodis pv. citri (strain 306)
Q5H503 1.71e-46 164 37 2 245 3 metN Methionine import ATP-binding protein MetN Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
A1VZQ5 1.98e-46 161 35 2 239 3 peb1C Probable ABC transporter ATP-binding protein PEB1C Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
Q6HP89 2.46e-46 164 35 2 241 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q0P9X7 2.64e-46 161 35 2 239 3 peb1C Probable ABC transporter ATP-binding protein PEB1C Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q97KD5 2.65e-46 163 37 1 228 3 metN Methionine import ATP-binding protein MetN Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q0I5E9 2.93e-46 164 36 3 241 3 metN Methionine import ATP-binding protein MetN Histophilus somni (strain 129Pt)
Q8P4S7 3.06e-46 164 37 3 254 3 metN Methionine import ATP-binding protein MetN Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q4UQD2 3.06e-46 164 37 3 254 3 metN Methionine import ATP-binding protein MetN Xanthomonas campestris pv. campestris (strain 8004)
Q63GR8 3.37e-46 164 35 2 241 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus cereus (strain ZK / E33L)
Q0SFW6 3.6e-46 164 33 8 330 3 metN2 Methionine import ATP-binding protein MetN 2 Rhodococcus jostii (strain RHA1)
Q81IN8 4.48e-46 163 35 2 241 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q8KZQ6 4.7e-46 161 42 3 216 1 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pseudomonas putida
Q98QE1 5.05e-46 166 41 7 252 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasmopsis pulmonis (strain UAB CTIP)
Q98QE1 6.21e-24 105 43 0 105 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasmopsis pulmonis (strain UAB CTIP)
P54537 8.56e-46 160 37 3 240 1 artM Arginine transport ATP-binding protein ArtM Bacillus subtilis (strain 168)
Q8FYU9 9.19e-46 159 40 0 220 3 thiQ Thiamine import ATP-binding protein ThiQ Brucella suis biovar 1 (strain 1330)
Q8YJ04 9.19e-46 159 40 0 220 3 thiQ Thiamine import ATP-binding protein ThiQ Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q4A5Q4 1.08e-45 165 39 6 251 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasmopsis synoviae (strain 53)
Q4A5Q4 5.79e-25 108 40 0 118 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasmopsis synoviae (strain 53)
Q57BC2 1.14e-45 159 40 0 220 3 thiQ Thiamine import ATP-binding protein ThiQ Brucella abortus biovar 1 (strain 9-941)
Q2YLW6 1.14e-45 159 40 0 220 3 thiQ Thiamine import ATP-binding protein ThiQ Brucella abortus (strain 2308)
Q6N6K5 1.63e-45 160 44 3 210 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q73EL7 1.64e-45 162 38 1 216 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q6AE21 1.66e-45 162 35 2 242 3 metN Methionine import ATP-binding protein MetN Leifsonia xyli subsp. xyli (strain CTCB07)
P33360 1.67e-45 161 36 2 236 1 yehX Glycine betaine uptake system ATP-binding protein YehX Escherichia coli (strain K12)
Q28K97 2.12e-45 159 39 5 241 3 tauB Taurine import ATP-binding protein TauB Jannaschia sp. (strain CCS1)
Q81IZ6 2.61e-45 161 36 2 241 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q9CK97 3.83e-45 161 35 2 241 3 metN Methionine import ATP-binding protein MetN Pasteurella multocida (strain Pm70)
Q8XZQ4 4.43e-45 159 43 3 205 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q8PHQ3 4.64e-45 159 40 3 222 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Xanthomonas axonopodis pv. citri (strain 306)
Q16BJ3 5.17e-45 159 41 3 219 3 tauB Taurine import ATP-binding protein TauB Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
P27675 5.89e-45 157 37 4 240 2 glnQ Glutamine transport ATP-binding protein GlnQ Geobacillus stearothermophilus
P10346 6.32e-45 157 37 3 241 1 glnQ Glutamine transport ATP-binding protein GlnQ Escherichia coli (strain K12)
Q8RFN2 6.37e-45 160 35 2 241 3 metN Methionine import ATP-binding protein MetN Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q1LNM0 7.02e-45 159 42 3 205 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q6CYU2 7.81e-45 158 40 3 220 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q3M5J9 9.72e-45 157 42 3 207 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Trichormus variabilis (strain ATCC 29413 / PCC 7937)
P45769 1.31e-44 157 35 3 240 3 yhdZ Uncharacterized amino-acid ABC transporter ATP-binding protein YhdZ Escherichia coli (strain K12)
Q1RDS4 1.5e-44 157 38 8 264 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Escherichia coli (strain UTI89 / UPEC)
A1A9L0 1.5e-44 157 38 8 264 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Escherichia coli O1:K1 / APEC
Q5WBL0 1.57e-44 157 39 3 218 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Shouchella clausii (strain KSM-K16)
Q8DRR9 2.29e-44 157 36 4 233 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q5HIL5 2.32e-44 159 34 2 244 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain COL)
Q2G0V2 2.32e-44 159 34 2 244 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FJI0 2.32e-44 159 34 2 244 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain USA300)
Q87UI3 2.33e-44 157 41 2 212 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q2YVT7 2.42e-44 159 35 2 244 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q9PR37 2.59e-44 163 46 3 176 3 potA Spermidine/putrescine import ATP-binding protein PotA Ureaplasma parvum serovar 3 (strain ATCC 700970)
Q9PR37 7.33e-27 114 46 1 113 3 potA Spermidine/putrescine import ATP-binding protein PotA Ureaplasma parvum serovar 3 (strain ATCC 700970)
Q48CA0 2.65e-44 157 40 2 212 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q9I1C8 3.17e-44 159 34 3 262 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8FJ95 3.33e-44 156 38 8 264 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q5ZUG5 3.35e-44 159 39 2 231 3 metN Methionine import ATP-binding protein MetN Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q5WKG4 3.37e-44 155 40 2 209 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Shouchella clausii (strain KSM-K16)
Q4K441 3.41e-44 156 39 2 212 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q7A7E3 3.53e-44 158 35 2 244 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain N315)
Q99WE1 3.53e-44 158 35 2 244 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q7VM95 3.79e-44 158 36 3 241 3 metN Methionine import ATP-binding protein MetN Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q8YA75 4.02e-44 158 35 3 248 3 metN1 Methionine import ATP-binding protein MetN 1 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
P37774 4.34e-44 155 39 3 242 1 tcyN L-cystine transport system ATP-binding protein TcyN Escherichia coli (strain K12)
Q5WVL8 4.55e-44 158 39 2 231 3 metN Methionine import ATP-binding protein MetN Legionella pneumophila (strain Lens)
Q8NY21 5e-44 158 34 2 244 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain MW2)
Q6GC27 5e-44 158 34 2 244 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain MSSA476)
Q0RKH4 5.17e-44 155 37 4 245 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Frankia alni (strain DSM 45986 / CECT 9034 / ACN14a)
Q8DMX9 5.96e-44 156 41 4 213 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q97N50 5.96e-44 156 41 4 213 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q04HV7 5.96e-44 156 41 4 213 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q6GJL2 6.44e-44 158 35 2 244 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain MRSA252)
Q5X484 7.94e-44 157 39 2 231 3 metN Methionine import ATP-binding protein MetN Legionella pneumophila (strain Paris)
Q5NFU5 1.07e-43 157 35 2 241 3 metN Methionine import ATP-binding protein MetN Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q0BMC9 1.3e-43 157 35 2 241 3 metN Methionine import ATP-binding protein MetN Francisella tularensis subsp. holarctica (strain OSU18)
Q2A3Z2 1.3e-43 157 35 2 241 3 metN Methionine import ATP-binding protein MetN Francisella tularensis subsp. holarctica (strain LVS)
Q4JTG9 1.37e-43 157 38 1 222 3 metN Methionine import ATP-binding protein MetN Corynebacterium jeikeium (strain K411)
Q8RQL7 1.41e-43 154 36 5 246 3 gluA Glutamate transport ATP-binding protein GluA Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
P39456 1.55e-43 154 38 3 244 1 tcyC L-cystine import ATP-binding protein TcyC Bacillus subtilis (strain 168)
Q63H29 1.64e-43 157 36 2 241 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus cereus (strain ZK / E33L)

  • Number of RefSeq hits:

General

Source Morganella morganii S2
Locus tag EHELCC_09995
Feature type CDS
Gene potA
Product spermidine/putrescine ABC transporter ATP-binding protein PotA
Location 32638 - 33753 (strand: 1)
Length 1116 (nucleotides) / 371 (amino acids)
In genomic island -

Contig

Accession ZDB_219
Length 213167 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_37
Orthogroup size 13
N. genomes 7

Actions

Genomic region

Domains

PF00005 ABC transporter
PF08402 TOBE domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG3842 Amino acid transport and metabolism (E) E ABC-type Fe3+/spermidine/putrescine transport systems, ATPase component

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K11072 spermidine/putrescine transport system ATP-binding protein [EC:7.6.2.11] ABC transporters -

Protein Sequence

MTETTSLTPLVTLKGLSKSFDDKNIIKHFDLTINHGEFVTILGPSGCGKTTVLRLIAGLEDADEGTIMLGDQDITHIPAEQRHINTVFQSYALFPHMTVFENVAFGLRMQKTPENEITQRVEEALKMVQLEDFAGRKPGHLSGGQQQRVAIARAVVNKPEVLLLDESLSALDYKLRKQMQSELKALQRQLGITFVFVTHDQEEALTMSDRIIVMRDGRIEQDGTPREIYEEPKNLFVAQFIGEINIFDADVLHRIDEQRIRANVEGHECDIYTTLDVTPGQRVHVLLRPEDLRVEEIHDNEPIAGLIGYVRERNYKGMTLDSEVEMENGKRVMVSEFFNEDDPDVDHSLNQKIAVTWVESWEVVLGDENDA

Flanking regions ( +/- flanking 50bp)

TCAGTTACGGTTCTATCTGCATGACCTCCGGGATAGAGTGAATAGCATAAATGACTGAGACAACCTCTCTGACACCACTTGTCACCCTGAAAGGGCTGAGCAAAAGCTTTGATGACAAGAACATAATTAAGCATTTCGACCTCACAATTAATCATGGTGAGTTCGTCACCATTCTGGGTCCGTCCGGGTGCGGTAAAACCACGGTTTTACGGTTAATCGCCGGGCTTGAGGATGCGGATGAAGGCACTATTATGCTCGGCGACCAGGATATTACCCATATCCCCGCTGAACAGCGCCATATCAACACTGTTTTCCAGAGTTATGCCCTGTTTCCGCACATGACGGTCTTTGAAAACGTCGCGTTCGGGCTGCGCATGCAGAAAACCCCGGAAAATGAAATCACACAGCGCGTGGAAGAAGCCCTGAAAATGGTGCAGCTGGAAGATTTCGCCGGGCGCAAACCGGGTCACCTTTCCGGCGGACAACAGCAGCGTGTTGCCATTGCCCGTGCGGTGGTGAATAAACCGGAAGTGCTGCTGCTGGATGAATCCCTCTCCGCGCTGGATTACAAACTGCGCAAACAGATGCAGAGTGAACTGAAAGCCCTTCAGCGTCAGCTGGGGATCACGTTTGTGTTTGTCACCCATGACCAGGAAGAGGCGCTGACCATGTCTGATCGTATCATTGTGATGCGCGATGGCAGGATTGAGCAGGACGGCACGCCGCGTGAAATCTACGAAGAGCCGAAAAACCTGTTTGTGGCGCAGTTTATCGGCGAGATAAATATCTTTGATGCGGATGTTCTGCACCGGATCGATGAACAGCGGATCCGCGCAAATGTCGAGGGGCACGAGTGTGATATTTATACCACCCTGGATGTCACACCGGGGCAGCGGGTGCATGTGCTGCTGCGTCCGGAGGATCTGCGCGTTGAAGAGATCCATGATAATGAGCCGATTGCCGGGCTTATCGGCTATGTCCGCGAGCGCAACTATAAAGGAATGACGCTGGACTCCGAAGTGGAGATGGAAAACGGCAAACGGGTGATGGTCAGTGAGTTCTTTAATGAGGATGATCCGGATGTGGATCACTCACTGAATCAGAAGATTGCGGTGACGTGGGTCGAAAGCTGGGAGGTGGTGCTGGGCGATGAAAATGACGCGTAAACCATTCCAGACTATCGTGATCACGGGGATTGTCGCCTGGTTACTGCTGT