Homologs in group_2261

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_17405 FBDBKF_17405 100.0 Morganella morganii S1 tgt tRNA guanosine(34) transglycosylase Tgt
EHELCC_17300 EHELCC_17300 100.0 Morganella morganii S2 tgt tRNA guanosine(34) transglycosylase Tgt
NLDBIP_17895 NLDBIP_17895 100.0 Morganella morganii S4 tgt tRNA guanosine(34) transglycosylase Tgt
LHKJJB_17815 LHKJJB_17815 100.0 Morganella morganii S3 tgt tRNA guanosine(34) transglycosylase Tgt
F4V73_RS16580 F4V73_RS16580 97.3 Morganella psychrotolerans tgt tRNA guanosine(34) transglycosylase Tgt
PMI_RS00365 PMI_RS00365 90.9 Proteus mirabilis HI4320 tgt tRNA guanosine(34) transglycosylase Tgt

Distribution of the homologs in the orthogroup group_2261

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2261

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
C6DB26 0.0 732 92 0 374 3 tgt Queuine tRNA-ribosyltransferase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
A8GAM5 0.0 731 92 0 373 3 tgt Queuine tRNA-ribosyltransferase Serratia proteamaculans (strain 568)
Q8ZRD8 0.0 729 91 0 373 3 tgt Queuine tRNA-ribosyltransferase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TZI0 0.0 729 91 0 373 3 tgt Queuine tRNA-ribosyltransferase Salmonella schwarzengrund (strain CVM19633)
A9MX29 0.0 729 91 0 373 3 tgt Queuine tRNA-ribosyltransferase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4SWP7 0.0 729 91 0 373 3 tgt Queuine tRNA-ribosyltransferase Salmonella newport (strain SL254)
B4T8P5 0.0 729 91 0 373 3 tgt Queuine tRNA-ribosyltransferase Salmonella heidelberg (strain SL476)
B5EWT9 0.0 729 91 0 373 3 tgt Queuine tRNA-ribosyltransferase Salmonella agona (strain SL483)
B5R6Q7 0.0 728 91 0 373 3 tgt Queuine tRNA-ribosyltransferase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5QTF4 0.0 728 91 0 373 3 tgt Queuine tRNA-ribosyltransferase Salmonella enteritidis PT4 (strain P125109)
B5FKR0 0.0 728 91 0 373 3 tgt Queuine tRNA-ribosyltransferase Salmonella dublin (strain CT_02021853)
A8AK48 0.0 728 91 0 373 3 tgt Queuine tRNA-ribosyltransferase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
B5BDC8 0.0 727 91 0 373 3 tgt Queuine tRNA-ribosyltransferase Salmonella paratyphi A (strain AKU_12601)
C0Q7S9 0.0 727 91 0 373 3 tgt Queuine tRNA-ribosyltransferase Salmonella paratyphi C (strain RKS4594)
Q5PFT6 0.0 727 91 0 373 3 tgt Queuine tRNA-ribosyltransferase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q57SF8 0.0 727 91 0 373 3 tgt Queuine tRNA-ribosyltransferase Salmonella choleraesuis (strain SC-B67)
A1JNT0 0.0 726 92 0 373 3 tgt Queuine tRNA-ribosyltransferase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q8Z8Y0 0.0 726 91 0 373 3 tgt Queuine tRNA-ribosyltransferase Salmonella typhi
Q6D855 0.0 726 91 0 374 3 tgt Queuine tRNA-ribosyltransferase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q7MB01 0.0 724 91 0 373 3 tgt Queuine tRNA-ribosyltransferase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A6T5D8 0.0 724 91 0 373 3 tgt Queuine tRNA-ribosyltransferase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B5Y0Y6 0.0 724 91 0 373 3 tgt Queuine tRNA-ribosyltransferase Klebsiella pneumoniae (strain 342)
A9MM57 0.0 723 91 0 373 3 tgt Queuine tRNA-ribosyltransferase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B1JIE9 0.0 722 91 0 373 3 tgt Queuine tRNA-ribosyltransferase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66DW5 0.0 722 91 0 373 3 tgt Queuine tRNA-ribosyltransferase Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TPH6 0.0 722 91 0 373 3 tgt Queuine tRNA-ribosyltransferase Yersinia pestis (strain Pestoides F)
Q1CLA2 0.0 722 91 0 373 3 tgt Queuine tRNA-ribosyltransferase Yersinia pestis bv. Antiqua (strain Nepal516)
A9R351 0.0 722 91 0 373 3 tgt Queuine tRNA-ribosyltransferase Yersinia pestis bv. Antiqua (strain Angola)
Q8ZC33 0.0 722 91 0 373 3 tgt Queuine tRNA-ribosyltransferase Yersinia pestis
B2K6S6 0.0 722 91 0 373 3 tgt Queuine tRNA-ribosyltransferase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C4H4 0.0 722 91 0 373 3 tgt Queuine tRNA-ribosyltransferase Yersinia pestis bv. Antiqua (strain Antiqua)
A7FLF5 0.0 722 91 0 373 3 tgt Queuine tRNA-ribosyltransferase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
B2VHQ1 0.0 719 89 0 374 3 tgt Queuine tRNA-ribosyltransferase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
B4EU13 0.0 717 91 0 373 3 tgt Queuine tRNA-ribosyltransferase Proteus mirabilis (strain HI4320)
C5BCF7 0.0 716 91 0 372 3 tgt Queuine tRNA-ribosyltransferase Edwardsiella ictaluri (strain 93-146)
Q3Z503 0.0 716 90 0 373 3 tgt Queuine tRNA-ribosyltransferase Shigella sonnei (strain Ss046)
Q32JG0 0.0 716 90 0 373 3 tgt Queuine tRNA-ribosyltransferase Shigella dysenteriae serotype 1 (strain Sd197)
Q325J5 0.0 716 90 0 373 3 tgt Queuine tRNA-ribosyltransferase Shigella boydii serotype 4 (strain Sb227)
B2U4K7 0.0 716 90 0 373 3 tgt Queuine tRNA-ribosyltransferase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B7LMI1 0.0 716 90 0 373 3 tgt Queuine tRNA-ribosyltransferase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q1RFD5 0.0 716 90 0 373 3 tgt Queuine tRNA-ribosyltransferase Escherichia coli (strain UTI89 / UPEC)
B1LJF4 0.0 716 90 0 373 3 tgt Queuine tRNA-ribosyltransferase Escherichia coli (strain SMS-3-5 / SECEC)
B6HZK6 0.0 716 90 0 373 3 tgt Queuine tRNA-ribosyltransferase Escherichia coli (strain SE11)
B7N8V8 0.0 716 90 0 373 3 tgt Queuine tRNA-ribosyltransferase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P0A847 0.0 716 90 0 373 1 tgt Queuine tRNA-ribosyltransferase Escherichia coli (strain K12)
B1J043 0.0 716 90 0 373 3 tgt Queuine tRNA-ribosyltransferase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P0A848 0.0 716 90 0 373 3 tgt Queuine tRNA-ribosyltransferase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TKN5 0.0 716 90 0 373 3 tgt Queuine tRNA-ribosyltransferase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1A876 0.0 716 90 0 373 3 tgt Queuine tRNA-ribosyltransferase Escherichia coli O1:K1 / APEC
A7ZX57 0.0 716 90 0 373 3 tgt Queuine tRNA-ribosyltransferase Escherichia coli O9:H4 (strain HS)
B1XEZ4 0.0 716 90 0 373 3 tgt Queuine tRNA-ribosyltransferase Escherichia coli (strain K12 / DH10B)
C4ZTG3 0.0 716 90 0 373 3 tgt Queuine tRNA-ribosyltransferase Escherichia coli (strain K12 / MC4100 / BW2952)
B7M3P5 0.0 716 90 0 373 3 tgt Queuine tRNA-ribosyltransferase Escherichia coli O8 (strain IAI1)
B7MPG7 0.0 716 90 0 373 3 tgt Queuine tRNA-ribosyltransferase Escherichia coli O81 (strain ED1a)
B7NJ96 0.0 716 90 0 373 3 tgt Queuine tRNA-ribosyltransferase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5Z2W2 0.0 716 90 0 373 3 tgt Queuine tRNA-ribosyltransferase Escherichia coli O157:H7 (strain EC4115 / EHEC)
P0A849 0.0 716 90 0 373 3 tgt Queuine tRNA-ribosyltransferase Escherichia coli O157:H7
B7L639 0.0 716 90 0 373 3 tgt Queuine tRNA-ribosyltransferase Escherichia coli (strain 55989 / EAEC)
B7MD64 0.0 716 90 0 373 3 tgt Queuine tRNA-ribosyltransferase Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UJM9 0.0 716 90 0 373 3 tgt Queuine tRNA-ribosyltransferase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A7ZIF8 0.0 716 90 0 373 3 tgt Queuine tRNA-ribosyltransferase Escherichia coli O139:H28 (strain E24377A / ETEC)
Q54177 0.0 716 90 0 373 3 tgt Queuine tRNA-ribosyltransferase Shigella flexneri
Q0T7I3 0.0 716 90 0 373 3 tgt Queuine tRNA-ribosyltransferase Shigella flexneri serotype 5b (strain 8401)
A4W779 0.0 715 90 0 373 3 tgt Queuine tRNA-ribosyltransferase Enterobacter sp. (strain 638)
Q2NVA4 0.0 704 89 0 372 3 tgt Queuine tRNA-ribosyltransferase Sodalis glossinidius (strain morsitans)
A0KJ20 0.0 687 85 0 374 3 tgt Queuine tRNA-ribosyltransferase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
A4SP26 0.0 686 84 0 374 3 tgt Queuine tRNA-ribosyltransferase Aeromonas salmonicida (strain A449)
C4L7L3 0.0 685 86 0 372 3 tgt Queuine tRNA-ribosyltransferase Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
P57831 0.0 677 85 1 377 3 tgt Queuine tRNA-ribosyltransferase Pasteurella multocida (strain Pm70)
B8F3W0 0.0 676 85 1 377 3 tgt Queuine tRNA-ribosyltransferase Glaesserella parasuis serovar 5 (strain SH0165)
A5UAP3 0.0 671 84 1 377 3 tgt Queuine tRNA-ribosyltransferase Haemophilus influenzae (strain PittEE)
P44594 0.0 671 84 1 377 3 tgt Queuine tRNA-ribosyltransferase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
B7VJR8 0.0 669 82 0 374 3 tgt Queuine tRNA-ribosyltransferase Vibrio atlanticus (strain LGP32)
Q4QNU3 0.0 669 84 1 377 3 tgt Queuine tRNA-ribosyltransferase Haemophilus influenzae (strain 86-028NP)
A5UG47 0.0 669 84 1 377 3 tgt Queuine tRNA-ribosyltransferase Haemophilus influenzae (strain PittGG)
Q6LU69 0.0 668 84 0 372 3 tgt Queuine tRNA-ribosyltransferase Photobacterium profundum (strain SS9)
C3LSZ4 0.0 667 82 0 374 3 tgt Queuine tRNA-ribosyltransferase Vibrio cholerae serotype O1 (strain M66-2)
Q9KTY9 0.0 667 82 0 374 3 tgt Queuine tRNA-ribosyltransferase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F3H2 0.0 667 82 0 374 3 tgt Queuine tRNA-ribosyltransferase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
B3GXF8 0.0 662 83 1 377 3 tgt Queuine tRNA-ribosyltransferase Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
A3N087 0.0 662 83 1 377 3 tgt Queuine tRNA-ribosyltransferase Actinobacillus pleuropneumoniae serotype 5b (strain L20)
Q7VLQ4 0.0 661 83 1 376 3 tgt Queuine tRNA-ribosyltransferase Haemophilus ducreyi (strain 35000HP / ATCC 700724)
B0BP03 0.0 661 83 1 377 3 tgt Queuine tRNA-ribosyltransferase Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
Q7MNH1 0.0 658 81 0 374 3 tgt Queuine tRNA-ribosyltransferase Vibrio vulnificus (strain YJ016)
Q8DEY0 0.0 658 81 0 374 3 tgt Queuine tRNA-ribosyltransferase Vibrio vulnificus (strain CMCP6)
A3QFF5 0.0 657 81 0 374 3 tgt Queuine tRNA-ribosyltransferase Shewanella loihica (strain ATCC BAA-1088 / PV-4)
Q0HWQ9 0.0 656 83 0 372 3 tgt Queuine tRNA-ribosyltransferase Shewanella sp. (strain MR-7)
Q0HKF7 0.0 656 83 0 372 3 tgt Queuine tRNA-ribosyltransferase Shewanella sp. (strain MR-4)
A0KV50 0.0 656 83 0 372 3 tgt Queuine tRNA-ribosyltransferase Shewanella sp. (strain ANA-3)
A1S7P2 0.0 654 81 0 374 3 tgt Queuine tRNA-ribosyltransferase Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
B5F9Y3 0.0 654 81 0 374 3 tgt Queuine tRNA-ribosyltransferase Aliivibrio fischeri (strain MJ11)
Q5E3D2 0.0 654 81 0 374 3 tgt Queuine tRNA-ribosyltransferase Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q87S36 0.0 654 81 0 374 3 tgt Queuine tRNA-ribosyltransferase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
A1RI67 0.0 654 82 0 372 3 tgt Queuine tRNA-ribosyltransferase Shewanella sp. (strain W3-18-1)
A4Y8C2 0.0 654 82 0 372 3 tgt Queuine tRNA-ribosyltransferase Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
Q8ECM3 0.0 654 83 0 372 3 tgt Queuine tRNA-ribosyltransferase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
A7MT83 0.0 652 80 0 374 3 tgt Queuine tRNA-ribosyltransferase Vibrio campbellii (strain ATCC BAA-1116)
A8H2K8 0.0 651 81 0 374 3 tgt Queuine tRNA-ribosyltransferase Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
A9KUN0 0.0 651 81 0 374 3 tgt Queuine tRNA-ribosyltransferase Shewanella baltica (strain OS195)
A6WQ52 0.0 651 81 0 372 3 tgt Queuine tRNA-ribosyltransferase Shewanella baltica (strain OS185)
A3D6B1 0.0 651 81 0 374 3 tgt Queuine tRNA-ribosyltransferase Shewanella baltica (strain OS155 / ATCC BAA-1091)
B8EDJ7 0.0 651 81 0 374 3 tgt Queuine tRNA-ribosyltransferase Shewanella baltica (strain OS223)
B6EK65 0.0 651 81 0 374 3 tgt Queuine tRNA-ribosyltransferase Aliivibrio salmonicida (strain LFI1238)
A8FXC6 0.0 649 81 0 374 3 tgt Queuine tRNA-ribosyltransferase Shewanella sediminis (strain HAW-EB3)
B0TND4 0.0 649 81 0 374 3 tgt Queuine tRNA-ribosyltransferase Shewanella halifaxensis (strain HAW-EB4)
Q0I4R8 0.0 648 81 1 374 3 tgt Queuine tRNA-ribosyltransferase Histophilus somni (strain 129Pt)
Q07ZM2 0.0 648 81 0 372 3 tgt Queuine tRNA-ribosyltransferase Shewanella frigidimarina (strain NCIMB 400)
Q12PD9 0.0 645 80 0 374 3 tgt Queuine tRNA-ribosyltransferase Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
B8CLC5 0.0 645 81 0 374 3 tgt Queuine tRNA-ribosyltransferase Shewanella piezotolerans (strain WP3 / JCM 13877)
A6VN75 0.0 642 80 1 378 3 tgt Queuine tRNA-ribosyltransferase Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
Q65S94 0.0 641 79 1 378 3 tgt Queuine tRNA-ribosyltransferase Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
A1SWU0 0.0 635 79 0 372 3 tgt Queuine tRNA-ribosyltransferase Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
C4K8M3 0.0 618 76 0 369 3 tgt Queuine tRNA-ribosyltransferase Hamiltonella defensa subsp. Acyrthosiphon pisum (strain 5AT)
Q15WI4 0.0 600 75 1 372 3 tgt Queuine tRNA-ribosyltransferase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q1LSP0 0.0 593 75 0 364 3 tgt Queuine tRNA-ribosyltransferase Baumannia cicadellinicola subsp. Homalodisca coagulata
Q3ILB8 0.0 582 74 1 374 3 tgt Queuine tRNA-ribosyltransferase Pseudoalteromonas translucida (strain TAC 125)
Q5QVL2 0.0 582 72 1 372 3 tgt Queuine tRNA-ribosyltransferase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q9HXH9 0.0 574 71 1 372 3 tgt Queuine tRNA-ribosyltransferase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02RX7 0.0 574 71 1 372 3 tgt Queuine tRNA-ribosyltransferase Pseudomonas aeruginosa (strain UCBPP-PA14)
B7UVU4 0.0 574 71 1 372 3 tgt Queuine tRNA-ribosyltransferase Pseudomonas aeruginosa (strain LESB58)
C1DE76 0.0 572 70 1 373 3 tgt Queuine tRNA-ribosyltransferase Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
Q31FZ5 0.0 569 72 1 372 3 tgt Queuine tRNA-ribosyltransferase Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q887B0 0.0 567 70 1 372 3 tgt Queuine tRNA-ribosyltransferase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q21KW1 0.0 566 70 1 373 3 tgt Queuine tRNA-ribosyltransferase Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q88PL7 0.0 562 69 1 372 3 tgt Queuine tRNA-ribosyltransferase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A1TZN7 0.0 559 68 1 374 3 tgt Queuine tRNA-ribosyltransferase Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q1QTM9 0.0 559 69 1 373 3 tgt Queuine tRNA-ribosyltransferase Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q6FEJ4 0.0 550 69 1 372 3 tgt Queuine tRNA-ribosyltransferase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q493H3 0.0 546 66 0 367 3 tgt Queuine tRNA-ribosyltransferase Blochmanniella pennsylvanica (strain BPEN)
B0V625 0.0 545 68 1 372 3 tgt Queuine tRNA-ribosyltransferase Acinetobacter baumannii (strain AYE)
A3M8S3 0.0 545 68 1 372 3 tgt Queuine tRNA-ribosyltransferase Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
B0VRA8 0.0 545 68 1 372 3 tgt Queuine tRNA-ribosyltransferase Acinetobacter baumannii (strain SDF)
B2HYN7 0.0 545 68 1 372 3 tgt Queuine tRNA-ribosyltransferase Acinetobacter baumannii (strain ACICU)
B7I976 0.0 545 68 1 372 3 tgt Queuine tRNA-ribosyltransferase Acinetobacter baumannii (strain AB0057)
B7GWL4 0.0 545 68 1 372 3 tgt Queuine tRNA-ribosyltransferase Acinetobacter baumannii (strain AB307-0294)
B8GTQ4 0.0 541 66 1 372 3 tgt Queuine tRNA-ribosyltransferase Thioalkalivibrio sulfidiphilus (strain HL-EbGR7)
B0TYY3 0.0 539 69 1 363 3 tgt Queuine tRNA-ribosyltransferase Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
A0Q6X1 0.0 537 68 1 361 3 tgt Queuine tRNA-ribosyltransferase Francisella tularensis subsp. novicida (strain U112)
A4IYF8 0.0 535 67 1 361 3 tgt Queuine tRNA-ribosyltransferase Francisella tularensis subsp. tularensis (strain WY96-3418)
Q5NFU8 0.0 535 67 1 361 3 tgt Queuine tRNA-ribosyltransferase Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q14HA0 0.0 535 67 1 361 3 tgt Queuine tRNA-ribosyltransferase Francisella tularensis subsp. tularensis (strain FSC 198)
Q4FRI6 0.0 534 66 2 381 3 tgt Queuine tRNA-ribosyltransferase Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q0BMC7 0.0 534 67 1 361 3 tgt Queuine tRNA-ribosyltransferase Francisella tularensis subsp. holarctica (strain OSU18)
Q2A3Y7 0.0 534 67 1 361 3 tgt Queuine tRNA-ribosyltransferase Francisella tularensis subsp. holarctica (strain LVS)
A7NBL6 0.0 534 67 1 361 3 tgt Queuine tRNA-ribosyltransferase Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
A5WGS6 0.0 534 65 2 380 3 tgt Queuine tRNA-ribosyltransferase Psychrobacter sp. (strain PRwf-1)
Q1QA23 0.0 531 66 2 381 3 tgt Queuine tRNA-ribosyltransferase Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
B2SHD4 0.0 531 67 1 361 3 tgt Queuine tRNA-ribosyltransferase Francisella tularensis subsp. mediasiatica (strain FSC147)
Q5P720 0.0 525 67 0 361 3 tgt Queuine tRNA-ribosyltransferase Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
Q0AG55 0.0 523 66 1 361 3 tgt Queuine tRNA-ribosyltransferase Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
A5CW46 0.0 521 65 0 366 3 tgt Queuine tRNA-ribosyltransferase Vesicomyosocius okutanii subsp. Calyptogena okutanii (strain HA)
B8D738 0.0 520 63 0 367 3 tgt Queuine tRNA-ribosyltransferase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain Tuc7)
Q82VF0 0.0 520 66 1 361 3 tgt Queuine tRNA-ribosyltransferase Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
B8D8T4 0.0 519 63 0 367 3 tgt Queuine tRNA-ribosyltransferase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain 5A)
Q1H403 0.0 518 68 1 363 3 tgt Queuine tRNA-ribosyltransferase Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
P57233 0.0 518 63 0 367 3 tgt Queuine tRNA-ribosyltransferase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q1LJ59 0.0 518 67 1 368 3 tgt Queuine tRNA-ribosyltransferase Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q47AX3 0.0 518 67 0 361 3 tgt Queuine tRNA-ribosyltransferase Dechloromonas aromatica (strain RCB)
Q8KA09 0.0 511 63 1 366 3 tgt Queuine tRNA-ribosyltransferase Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q2Y6A3 0.0 510 64 0 361 3 tgt Queuine tRNA-ribosyltransferase Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
A6SUU4 0.0 510 65 1 367 3 tgt Queuine tRNA-ribosyltransferase Janthinobacterium sp. (strain Marseille)
Q7VQB1 0.0 510 63 1 362 3 tgt Queuine tRNA-ribosyltransferase Blochmanniella floridana
A4G1Z3 0.0 509 66 1 367 3 tgt Queuine tRNA-ribosyltransferase Herminiimonas arsenicoxydans
B3R6J4 0.0 509 65 1 366 3 tgt Queuine tRNA-ribosyltransferase Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
Q46XG4 0.0 509 65 1 366 3 tgt Queuine tRNA-ribosyltransferase Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
A1K3W9 1.74e-179 505 65 0 361 3 tgt Queuine tRNA-ribosyltransferase Azoarcus sp. (strain BH72)
C1DDA7 1.82e-179 505 65 0 364 3 tgt Queuine tRNA-ribosyltransferase Laribacter hongkongensis (strain HLHK9)
Q0K733 8.87e-179 504 65 1 366 3 tgt Queuine tRNA-ribosyltransferase Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
B2FN00 8e-178 501 63 1 373 3 tgt Queuine tRNA-ribosyltransferase Stenotrophomonas maltophilia (strain K279a)
B4SSS1 1.16e-177 501 63 1 373 3 tgt Queuine tRNA-ribosyltransferase Stenotrophomonas maltophilia (strain R551-3)
Q8PJL7 9.41e-177 499 63 1 373 3 tgt Queuine tRNA-ribosyltransferase Xanthomonas axonopodis pv. citri (strain 306)
Q3BS37 1.83e-176 498 63 1 373 3 tgt Queuine tRNA-ribosyltransferase Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
B0RRR1 3.61e-176 498 62 1 373 3 tgt Queuine tRNA-ribosyltransferase Xanthomonas campestris pv. campestris (strain B100)
Q8P868 9.78e-176 496 62 1 373 3 tgt Queuine tRNA-ribosyltransferase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q4UVX2 9.78e-176 496 62 1 373 3 tgt Queuine tRNA-ribosyltransferase Xanthomonas campestris pv. campestris (strain 8004)
Q3SH61 2.3e-175 495 64 1 362 3 tgt Queuine tRNA-ribosyltransferase Thiobacillus denitrificans (strain ATCC 25259)
Q5GZY3 5.39e-175 494 62 1 373 3 tgt Queuine tRNA-ribosyltransferase Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
B2SIN8 5.39e-175 494 62 1 373 3 tgt Queuine tRNA-ribosyltransferase Xanthomonas oryzae pv. oryzae (strain PXO99A)
Q2P2X0 5.39e-175 494 62 1 373 3 tgt Queuine tRNA-ribosyltransferase Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
A5EW66 9.56e-174 491 62 2 363 3 tgt Queuine tRNA-ribosyltransferase Dichelobacter nodosus (strain VCS1703A)
Q7NYC7 2e-173 490 63 0 369 3 tgt Queuine tRNA-ribosyltransferase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
B2UC75 1.28e-172 489 65 2 363 3 tgt Queuine tRNA-ribosyltransferase Ralstonia pickettii (strain 12J)
B5EK08 5.88e-172 486 62 1 362 3 tgt Queuine tRNA-ribosyltransferase Acidithiobacillus ferrooxidans (strain ATCC 53993 / BNL-5-31)
B7J4R9 5.88e-172 486 62 1 362 3 tgt Queuine tRNA-ribosyltransferase Acidithiobacillus ferrooxidans (strain ATCC 23270 / DSM 14882 / CIP 104768 / NCIMB 8455)
Q8XVW4 1.42e-171 486 64 2 363 3 tgt Queuine tRNA-ribosyltransferase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
A2SM97 5.89e-167 474 59 1 366 3 tgt Queuine tRNA-ribosyltransferase Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
B1XWG6 7.28e-167 474 59 3 384 3 tgt Queuine tRNA-ribosyltransferase Leptothrix cholodnii (strain ATCC 51168 / LMG 8142 / SP-6)
Q9PGS5 7.42e-167 474 61 1 375 3 tgt Queuine tRNA-ribosyltransferase Xylella fastidiosa (strain 9a5c)
Q9JVA4 1.86e-166 473 60 0 363 3 tgt Queuine tRNA-ribosyltransferase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
B4RJY2 8.5e-166 471 59 0 369 3 tgt Queuine tRNA-ribosyltransferase Neisseria gonorrhoeae (strain NCCP11945)
A1KSY1 1.55e-165 470 60 0 363 3 tgt Queuine tRNA-ribosyltransferase Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
Q5F9U5 1.57e-165 470 59 0 369 3 tgt Queuine tRNA-ribosyltransferase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
A9M374 3.6e-165 469 60 0 363 3 tgt Queuine tRNA-ribosyltransferase Neisseria meningitidis serogroup C (strain 053442)
Q9K096 5.63e-165 469 60 0 363 3 tgt Queuine tRNA-ribosyltransferase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
B0U1P6 1.06e-164 469 60 1 375 3 tgt Queuine tRNA-ribosyltransferase Xylella fastidiosa (strain M12)
Q87EW6 1.86e-164 468 60 1 373 3 tgt Queuine tRNA-ribosyltransferase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I6T4 1.86e-164 468 60 1 373 3 tgt Queuine tRNA-ribosyltransferase Xylella fastidiosa (strain M23)
A1VJ15 2.48e-164 468 61 1 355 3 tgt Queuine tRNA-ribosyltransferase Polaromonas naphthalenivorans (strain CJ2)
A1WCK2 2.73e-164 468 59 3 381 3 tgt Queuine tRNA-ribosyltransferase Acidovorax sp. (strain JS42)
Q12GB2 3.27e-164 468 59 3 389 3 tgt Queuine tRNA-ribosyltransferase Polaromonas sp. (strain JS666 / ATCC BAA-500)
B9MGI1 7.21e-164 467 59 3 381 3 tgt Queuine tRNA-ribosyltransferase Acidovorax ebreus (strain TPSY)
A9BRD7 1.25e-162 464 59 3 381 3 tgt Queuine tRNA-ribosyltransferase Delftia acidovorans (strain DSM 14801 / SPH-1)
A1TVN0 1.86e-161 461 58 3 381 3 tgt Queuine tRNA-ribosyltransferase Paracidovorax citrulli (strain AAC00-1)
A1WFH2 1.88e-157 450 57 3 381 3 tgt Queuine tRNA-ribosyltransferase Verminephrobacter eiseniae (strain EF01-2)
Q65GP9 1.21e-156 448 59 2 362 3 tgt Queuine tRNA-ribosyltransferase Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
O32053 7.18e-156 446 59 2 362 3 tgt Queuine tRNA-ribosyltransferase Bacillus subtilis (strain 168)
B0K0M1 1.34e-154 442 57 2 368 3 tgt Queuine tRNA-ribosyltransferase Thermoanaerobacter sp. (strain X514)
B0K959 2.26e-154 442 57 2 368 3 tgt Queuine tRNA-ribosyltransferase Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
P28720 2.31e-154 442 57 1 366 1 tgt Queuine tRNA-ribosyltransferase Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
Q92BI4 1.3e-153 440 57 2 368 3 tgt Queuine tRNA-ribosyltransferase Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
A7Z766 3.37e-153 439 58 2 362 3 tgt Queuine tRNA-ribosyltransferase Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
B8DHL8 3.46e-153 439 57 2 368 3 tgt Queuine tRNA-ribosyltransferase Listeria monocytogenes serotype 4a (strain HCC23)
A0AIX9 4.81e-153 439 56 3 371 3 tgt Queuine tRNA-ribosyltransferase Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q8RAM9 1.38e-152 437 57 2 366 3 tgt Queuine tRNA-ribosyltransferase Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q8Y700 2.15e-152 437 56 3 371 3 tgt Queuine tRNA-ribosyltransferase Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q71ZE0 2.15e-152 437 56 3 371 3 tgt Queuine tRNA-ribosyltransferase Listeria monocytogenes serotype 4b (strain F2365)
C1KVH7 2.15e-152 437 56 3 371 3 tgt Queuine tRNA-ribosyltransferase Listeria monocytogenes serotype 4b (strain CLIP80459)
B5YHX4 2.26e-152 437 54 0 361 3 tgt Queuine tRNA-ribosyltransferase Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
B8FQV2 2.49e-152 437 58 1 356 3 tgt Queuine tRNA-ribosyltransferase Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
P66906 5.69e-151 434 59 1 355 3 tgt Queuine tRNA-ribosyltransferase Staphylococcus aureus (strain MW2)
A8Z2G7 5.69e-151 434 59 1 355 3 tgt Queuine tRNA-ribosyltransferase Staphylococcus aureus (strain USA300 / TCH1516)
Q6G8T0 5.69e-151 434 59 1 355 3 tgt Queuine tRNA-ribosyltransferase Staphylococcus aureus (strain MSSA476)
Q6GG65 5.69e-151 434 59 1 355 3 tgt Queuine tRNA-ribosyltransferase Staphylococcus aureus (strain MRSA252)
P66905 5.69e-151 434 59 1 355 1 tgt Queuine tRNA-ribosyltransferase Staphylococcus aureus (strain N315)
P66904 5.69e-151 434 59 1 355 3 tgt Queuine tRNA-ribosyltransferase Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QHI1 5.69e-151 434 59 1 355 3 tgt Queuine tRNA-ribosyltransferase Staphylococcus aureus (strain Newman)
Q5HFC4 5.69e-151 434 59 1 355 3 tgt Queuine tRNA-ribosyltransferase Staphylococcus aureus (strain COL)
A5ITG3 5.69e-151 434 59 1 355 3 tgt Queuine tRNA-ribosyltransferase Staphylococcus aureus (strain JH9)
Q2FXT6 5.69e-151 434 59 1 355 3 tgt Queuine tRNA-ribosyltransferase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FG88 5.69e-151 434 59 1 355 3 tgt Queuine tRNA-ribosyltransferase Staphylococcus aureus (strain USA300)
A6U2A7 5.69e-151 434 59 1 355 3 tgt Queuine tRNA-ribosyltransferase Staphylococcus aureus (strain JH1)
A7X354 5.69e-151 434 59 1 355 3 tgt Queuine tRNA-ribosyltransferase Staphylococcus aureus (strain Mu3 / ATCC 700698)
B1HVA1 1.15e-150 433 57 3 371 3 tgt Queuine tRNA-ribosyltransferase Lysinibacillus sphaericus (strain C3-41)
A3DE13 1.63e-150 432 57 3 370 3 tgt Queuine tRNA-ribosyltransferase Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
A8FFQ9 2.16e-150 432 58 2 358 3 tgt Queuine tRNA-ribosyltransferase Bacillus pumilus (strain SAFR-032)
Q2YT91 2.8e-150 432 58 1 355 3 tgt Queuine tRNA-ribosyltransferase Staphylococcus aureus (strain bovine RF122 / ET3-1)
B7GFN1 1.2e-149 430 56 2 372 3 tgt Queuine tRNA-ribosyltransferase Anoxybacillus flavithermus (strain DSM 21510 / WK1)
B8CXG0 1.4e-149 430 56 1 356 3 tgt Queuine tRNA-ribosyltransferase Halothermothrix orenii (strain H 168 / OCM 544 / DSM 9562)
B9E716 1.41e-149 430 58 1 355 3 tgt Queuine tRNA-ribosyltransferase Macrococcus caseolyticus (strain JCSC5402)
A4IRA9 1.43e-149 430 57 1 359 3 tgt Queuine tRNA-ribosyltransferase Geobacillus thermodenitrificans (strain NG80-2)
A4J541 3.4e-149 429 58 2 356 3 tgt Queuine tRNA-ribosyltransferase Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
Q5WHR2 4.94e-149 429 57 1 357 3 tgt Queuine tRNA-ribosyltransferase Shouchella clausii (strain KSM-K16)
A5D3G6 1.29e-148 427 57 1 353 3 tgt Queuine tRNA-ribosyltransferase Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
Q8CXC4 3.62e-148 426 54 2 368 3 tgt Queuine tRNA-ribosyltransferase Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q5KWR4 6.6e-148 426 57 1 359 3 tgt Queuine tRNA-ribosyltransferase Geobacillus kaustophilus (strain HTA426)
Q9KDI5 1.6e-147 425 55 2 372 3 tgt Queuine tRNA-ribosyltransferase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q8CML7 1.69e-147 425 58 1 355 3 tgt Queuine tRNA-ribosyltransferase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HNR2 1.69e-147 425 58 1 355 3 tgt Queuine tRNA-ribosyltransferase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q817W6 1.92e-147 424 55 2 372 3 tgt Queuine tRNA-ribosyltransferase Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
B7HE51 1.92e-147 424 55 2 372 3 tgt Queuine tRNA-ribosyltransferase Bacillus cereus (strain B4264)
B7IIS9 1.92e-147 424 55 2 372 3 tgt Queuine tRNA-ribosyltransferase Bacillus cereus (strain G9842)
A9VIP3 3.82e-147 424 54 2 372 3 tgt Queuine tRNA-ribosyltransferase Bacillus mycoides (strain KBAB4)
Q6HDA9 5.48e-147 423 55 2 372 3 tgt Queuine tRNA-ribosyltransferase Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q634C7 5.48e-147 423 55 2 372 3 tgt Queuine tRNA-ribosyltransferase Bacillus cereus (strain ZK / E33L)
B7HQH6 5.48e-147 423 55 2 372 3 tgt Queuine tRNA-ribosyltransferase Bacillus cereus (strain AH187)
C1ESW1 5.48e-147 423 55 2 372 3 tgt Queuine tRNA-ribosyltransferase Bacillus cereus (strain 03BB102)
Q730B4 5.48e-147 423 55 2 372 3 tgt Queuine tRNA-ribosyltransferase Bacillus cereus (strain ATCC 10987 / NRS 248)
B7JQ03 5.48e-147 423 55 2 372 3 tgt Queuine tRNA-ribosyltransferase Bacillus cereus (strain AH820)
Q81LH2 5.48e-147 423 55 2 372 3 tgt Queuine tRNA-ribosyltransferase Bacillus anthracis
A0RJ24 5.48e-147 423 55 2 372 3 tgt Queuine tRNA-ribosyltransferase Bacillus thuringiensis (strain Al Hakam)
C3L6U6 5.48e-147 423 55 2 372 3 tgt Queuine tRNA-ribosyltransferase Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3P9A4 5.48e-147 423 55 2 372 3 tgt Queuine tRNA-ribosyltransferase Bacillus anthracis (strain A0248)
B9IYZ1 5.79e-147 423 55 2 372 3 tgt Queuine tRNA-ribosyltransferase Bacillus cereus (strain Q1)
Q4L6Y4 9.89e-147 423 57 1 355 3 tgt Queuine tRNA-ribosyltransferase Staphylococcus haemolyticus (strain JCSC1435)
B8I6M0 1.03e-146 422 55 2 368 3 tgt Queuine tRNA-ribosyltransferase Ruminiclostridium cellulolyticum (strain ATCC 35319 / DSM 5812 / JCM 6584 / H10)
Q837E7 3.19e-146 422 54 3 370 3 tgt Queuine tRNA-ribosyltransferase Enterococcus faecalis (strain ATCC 700802 / V583)
C0QKY2 4.44e-146 421 54 0 359 3 tgt Queuine tRNA-ribosyltransferase Desulforapulum autotrophicum (strain ATCC 43914 / DSM 3382 / VKM B-1955 / HRM2)
B9DNG7 5.5e-146 421 58 1 355 3 tgt Queuine tRNA-ribosyltransferase Staphylococcus carnosus (strain TM300)
A7GT99 7.45e-146 421 55 1 359 3 tgt Queuine tRNA-ribosyltransferase Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q67Q92 3.05e-145 420 55 3 369 3 tgt Queuine tRNA-ribosyltransferase Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q2G639 4.63e-145 418 57 1 363 3 tgt Queuine tRNA-ribosyltransferase Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
A8F2K6 5.21e-144 415 57 1 353 3 tgt Queuine tRNA-ribosyltransferase Rickettsia massiliae (strain Mtu5)
Q3J2H4 2.21e-143 414 56 1 361 3 tgt Queuine tRNA-ribosyltransferase Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
A3PJT9 3.62e-143 414 56 1 361 3 tgt Queuine tRNA-ribosyltransferase Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
A8GUA5 9.11e-143 412 58 1 343 3 tgt Queuine tRNA-ribosyltransferase Rickettsia bellii (strain OSU 85-389)
B2A5K8 1.18e-142 412 54 2 365 3 tgt Queuine tRNA-ribosyltransferase Natranaerobius thermophilus (strain ATCC BAA-1301 / DSM 18059 / JW/NM-WN-LF)
A8GTF4 2.54e-142 411 57 1 353 3 tgt Queuine tRNA-ribosyltransferase Rickettsia rickettsii (strain Sheila Smith)
B0BUZ2 2.54e-142 411 57 1 353 3 tgt Queuine tRNA-ribosyltransferase Rickettsia rickettsii (strain Iowa)
Q8RDN0 5.16e-142 410 53 2 366 3 tgt Queuine tRNA-ribosyltransferase Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q68W26 5.17e-142 410 56 1 353 3 tgt Queuine tRNA-ribosyltransferase Rickettsia typhi (strain ATCC VR-144 / Wilmington)
C4K0T2 1.16e-141 409 58 1 343 3 tgt Queuine tRNA-ribosyltransferase Rickettsia peacockii (strain Rustic)
Q92GM6 1.2e-141 409 56 1 353 3 tgt Queuine tRNA-ribosyltransferase Rickettsia conorii (strain ATCC VR-613 / Malish 7)
C3PLJ4 1.2e-141 409 56 1 353 3 tgt Queuine tRNA-ribosyltransferase Rickettsia africae (strain ESF-5)
A8GPN2 1.58e-141 409 56 1 353 3 tgt Queuine tRNA-ribosyltransferase Rickettsia akari (strain Hartford)
Q03ER2 1.64e-141 409 53 3 370 3 tgt Queuine tRNA-ribosyltransferase Pediococcus pentosaceus (strain ATCC 25745 / CCUG 21536 / LMG 10740 / 183-1w)
Q1GR26 1.65e-141 409 55 1 365 3 tgt Queuine tRNA-ribosyltransferase Sphingopyxis alaskensis (strain DSM 13593 / LMG 18877 / RB2256)
Q2RHU3 1.17e-140 407 56 2 356 3 tgt Queuine tRNA-ribosyltransferase Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q1RH25 1.24e-140 407 58 3 344 3 tgt Queuine tRNA-ribosyltransferase Rickettsia bellii (strain RML369-C)
Q30XF7 1.97e-140 407 51 0 360 3 tgt Queuine tRNA-ribosyltransferase Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
O67331 1.97e-140 407 52 5 380 3 tgt Queuine tRNA-ribosyltransferase Aquifex aeolicus (strain VF5)
Q5LQ80 2.01e-140 407 55 1 361 3 tgt Queuine tRNA-ribosyltransferase Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
C4XSI9 2.11e-140 406 53 0 358 3 tgt Queuine tRNA-ribosyltransferase Solidesulfovibrio magneticus (strain ATCC 700980 / DSM 13731 / RS-1)
Q4UN16 3.35e-140 405 56 1 353 3 tgt Queuine tRNA-ribosyltransferase Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q1GIL3 9.36e-140 405 54 2 372 3 tgt Queuine tRNA-ribosyltransferase Ruegeria sp. (strain TM1040)
A8LRQ1 5.6e-139 403 58 1 353 3 tgt Queuine tRNA-ribosyltransferase Dinoroseobacter shibae (strain DSM 16493 / NCIMB 14021 / DFL 12)
Q9ZCK8 1.14e-138 402 56 1 353 3 tgt Queuine tRNA-ribosyltransferase Rickettsia prowazekii (strain Madrid E)
Q9A7Y1 4.1e-138 400 54 2 363 3 tgt Queuine tRNA-ribosyltransferase Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
B1I4K8 1.59e-137 399 54 1 364 3 tgt Queuine tRNA-ribosyltransferase Desulforudis audaxviator (strain MP104C)
Q28PC5 5.13e-137 398 55 2 362 3 tgt Queuine tRNA-ribosyltransferase Jannaschia sp. (strain CCS1)
A0LFR2 6.94e-137 397 54 1 351 3 tgt Queuine tRNA-ribosyltransferase Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
A3CK60 1.85e-136 397 52 1 355 3 tgt Queuine tRNA-ribosyltransferase Streptococcus sanguinis (strain SK36)
B9DVZ9 2.38e-136 396 53 1 355 3 tgt Queuine tRNA-ribosyltransferase Streptococcus uberis (strain ATCC BAA-854 / 0140J)
P0DF87 3.12e-136 396 52 2 368 3 tgt Queuine tRNA-ribosyltransferase Streptococcus pyogenes serotype M3 (strain SSI-1)
Q48VG9 3.12e-136 396 52 2 368 3 tgt Queuine tRNA-ribosyltransferase Streptococcus pyogenes serotype M28 (strain MGAS6180)
A2RCC9 3.12e-136 396 52 2 368 3 tgt Queuine tRNA-ribosyltransferase Streptococcus pyogenes serotype M5 (strain Manfredo)
Q1JIT0 3.12e-136 396 52 2 368 3 tgt Queuine tRNA-ribosyltransferase Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q1JNN4 3.12e-136 396 52 2 368 3 tgt Queuine tRNA-ribosyltransferase Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1JDS0 3.12e-136 396 52 2 368 3 tgt Queuine tRNA-ribosyltransferase Streptococcus pyogenes serotype M12 (strain MGAS2096)
P66910 3.12e-136 396 52 2 368 3 tgt Queuine tRNA-ribosyltransferase Streptococcus pyogenes serotype M18 (strain MGAS8232)
P0DF86 3.12e-136 396 52 2 368 3 tgt Queuine tRNA-ribosyltransferase Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
B5XJL3 3.8e-136 396 51 2 368 3 tgt Queuine tRNA-ribosyltransferase Streptococcus pyogenes serotype M49 (strain NZ131)
Q1J8P1 3.8e-136 396 51 2 368 3 tgt Queuine tRNA-ribosyltransferase Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q5XE18 5.04e-136 395 52 2 368 3 tgt Queuine tRNA-ribosyltransferase Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
A8AUL3 6.34e-136 395 52 1 355 3 tgt Queuine tRNA-ribosyltransferase Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
Q72E53 1.11e-135 395 52 0 340 3 tgt Queuine tRNA-ribosyltransferase Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q9A1L6 1.27e-135 395 52 1 355 3 tgt Queuine tRNA-ribosyltransferase Streptococcus pyogenes serotype M1
A4VW51 1.69e-135 394 52 1 355 3 tgt Queuine tRNA-ribosyltransferase Streptococcus suis (strain 05ZYH33)
A4W2F8 1.69e-135 394 52 1 355 3 tgt Queuine tRNA-ribosyltransferase Streptococcus suis (strain 98HAH33)
A1VFP3 3.46e-135 393 52 0 340 3 tgt Queuine tRNA-ribosyltransferase Nitratidesulfovibrio vulgaris (strain DP4)
Q03IQ5 6.62e-135 393 52 1 355 3 tgt Queuine tRNA-ribosyltransferase Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
A8EZT7 6.81e-135 392 54 1 353 3 tgt Queuine tRNA-ribosyltransferase Rickettsia canadensis (strain McKiel)
C1CTW4 9.28e-135 392 52 1 355 3 tgt Queuine tRNA-ribosyltransferase Streptococcus pneumoniae (strain Taiwan19F-14)
C1CAA6 9.28e-135 392 52 1 355 3 tgt Queuine tRNA-ribosyltransferase Streptococcus pneumoniae (strain 70585)
B1I9B4 1.06e-134 392 52 1 355 3 tgt Queuine tRNA-ribosyltransferase Streptococcus pneumoniae (strain Hungary19A-6)
C1CGY8 1.18e-134 392 52 1 355 3 tgt Queuine tRNA-ribosyltransferase Streptococcus pneumoniae (strain JJA)
P66908 1.18e-134 392 52 1 355 3 tgt Queuine tRNA-ribosyltransferase Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
B2IMN3 1.18e-134 392 52 1 355 3 tgt Queuine tRNA-ribosyltransferase Streptococcus pneumoniae (strain CGSP14)
P66907 1.18e-134 392 52 1 355 3 tgt Queuine tRNA-ribosyltransferase Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
B8ZPB8 1.18e-134 392 52 1 355 3 tgt Queuine tRNA-ribosyltransferase Streptococcus pneumoniae (strain ATCC 700669 / Spain 23F-1)
B5E2X9 1.18e-134 392 52 1 355 3 tgt Queuine tRNA-ribosyltransferase Streptococcus pneumoniae serotype 19F (strain G54)
Q04IB3 1.18e-134 392 52 1 355 3 tgt Queuine tRNA-ribosyltransferase Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q8E1F9 1.5e-134 392 51 2 368 3 tgt Queuine tRNA-ribosyltransferase Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E6X6 1.5e-134 392 51 2 368 3 tgt Queuine tRNA-ribosyltransferase Streptococcus agalactiae serotype III (strain NEM316)
Q3K2Y7 1.5e-134 392 51 2 368 3 tgt Queuine tRNA-ribosyltransferase Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q38YP9 1.77e-134 392 51 2 357 3 tgt Queuine tRNA-ribosyltransferase Latilactobacillus sakei subsp. sakei (strain 23K)
Q5M2K9 2.25e-134 391 52 1 355 3 tgt Queuine tRNA-ribosyltransferase Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
A5N204 3.13e-134 391 50 2 375 3 tgt Queuine tRNA-ribosyltransferase Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
B9E5Q6 3.13e-134 391 50 2 375 3 tgt Queuine tRNA-ribosyltransferase Clostridium kluyveri (strain NBRC 12016)
Q5LY05 3.25e-134 391 52 1 355 3 tgt Queuine tRNA-ribosyltransferase Streptococcus thermophilus (strain CNRZ 1066)
Q032U4 3.41e-134 391 53 2 360 3 tgt Queuine tRNA-ribosyltransferase Lactococcus lactis subsp. cremoris (strain SK11)
Q0SRN5 3.63e-134 391 50 2 367 3 tgt Queuine tRNA-ribosyltransferase Clostridium perfringens (strain SM101 / Type A)
Q0TP15 3.63e-134 391 50 2 367 3 tgt Queuine tRNA-ribosyltransferase Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q92PY4 4.64e-134 390 54 2 360 3 tgt Queuine tRNA-ribosyltransferase Rhizobium meliloti (strain 1021)
C0MAH5 4.76e-134 390 52 1 355 3 tgt Queuine tRNA-ribosyltransferase Streptococcus equi subsp. equi (strain 4047)
A2RHN5 5.44e-134 390 53 2 360 3 tgt Queuine tRNA-ribosyltransferase Lactococcus lactis subsp. cremoris (strain MG1363)
Q88V05 5.67e-134 390 51 1 355 3 tgt Queuine tRNA-ribosyltransferase Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
C1CN05 5.8e-134 390 52 1 355 3 tgt Queuine tRNA-ribosyltransferase Streptococcus pneumoniae (strain P1031)
Q8XJ16 6.61e-134 390 50 2 367 3 tgt Queuine tRNA-ribosyltransferase Clostridium perfringens (strain 13 / Type A)
Q1MPU5 7.21e-134 390 48 0 361 3 tgt Queuine tRNA-ribosyltransferase Lawsonia intracellularis (strain PHE/MN1-00)
C0MEV8 1.13e-133 390 52 1 355 3 tgt Queuine tRNA-ribosyltransferase Streptococcus equi subsp. zooepidemicus (strain H70)
Q9CJ54 3.05e-133 389 53 2 360 3 tgt Queuine tRNA-ribosyltransferase Lactococcus lactis subsp. lactis (strain IL1403)
Q8DVZ3 4.81e-133 388 52 1 355 3 tgt Queuine tRNA-ribosyltransferase Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
B5YFK5 5.59e-133 388 52 2 364 3 tgt Queuine tRNA-ribosyltransferase Dictyoglomus thermophilum (strain ATCC 35947 / DSM 3960 / H-6-12)
Q0BVG4 8.64e-133 387 53 3 364 3 tgt Queuine tRNA-ribosyltransferase Granulibacter bethesdensis (strain ATCC BAA-1260 / CGDNIH1)
A9HBJ2 9.73e-133 387 54 1 358 3 tgt Queuine tRNA-ribosyltransferase Gluconacetobacter diazotrophicus (strain ATCC 49037 / DSM 5601 / CCUG 37298 / CIP 103539 / LMG 7603 / PAl5)
B8E2N5 4.63e-132 386 51 2 364 3 tgt Queuine tRNA-ribosyltransferase Dictyoglomus turgidum (strain DSM 6724 / Z-1310)
Q8UES8 1.81e-131 384 54 1 358 3 tgt Queuine tRNA-ribosyltransferase Agrobacterium fabrum (strain C58 / ATCC 33970)
A9AW42 3.31e-131 384 51 2 366 3 tgt Queuine tRNA-ribosyltransferase Herpetosiphon aurantiacus (strain ATCC 23779 / DSM 785 / 114-95)
C4Z563 4.24e-131 383 50 4 370 3 tgt Queuine tRNA-ribosyltransferase Lachnospira eligens (strain ATCC 27750 / DSM 3376 / VPI C15-48 / C15-B4)
Q98M57 6.4e-131 382 53 2 363 3 tgt Queuine tRNA-ribosyltransferase Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q1IVF1 6.46e-131 383 50 2 359 3 tgt Queuine tRNA-ribosyltransferase Koribacter versatilis (strain Ellin345)
Q9RRB5 2.77e-130 382 49 1 364 3 tgt Queuine tRNA-ribosyltransferase Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
Q8YHB2 5.09e-130 380 54 2 359 3 tgt Queuine tRNA-ribosyltransferase Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q8G0K1 1.13e-129 379 54 2 359 3 tgt Queuine tRNA-ribosyltransferase Brucella suis biovar 1 (strain 1330)
Q72H19 3.42e-129 379 50 3 375 3 tgt Queuine tRNA-ribosyltransferase Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
Q5SLI7 5.28e-129 378 50 3 375 3 tgt Queuine tRNA-ribosyltransferase Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
A7GHT6 1.36e-127 374 50 2 356 3 tgt Queuine tRNA-ribosyltransferase Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
B1IMF1 1.36e-127 374 50 2 356 3 tgt Queuine tRNA-ribosyltransferase Clostridium botulinum (strain Okra / Type B1)
B1L0B0 2.02e-127 374 50 2 356 3 tgt Queuine tRNA-ribosyltransferase Clostridium botulinum (strain Loch Maree / Type A3)
C1FKF9 2.02e-127 374 50 2 356 3 tgt Queuine tRNA-ribosyltransferase Clostridium botulinum (strain Kyoto / Type A2)
C3KTD0 2.02e-127 374 50 2 356 3 tgt Queuine tRNA-ribosyltransferase Clostridium botulinum (strain 657 / Type Ba4)
A5I6E9 2.2e-127 374 50 2 356 3 tgt Queuine tRNA-ribosyltransferase Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
A7FY17 2.2e-127 374 50 2 356 3 tgt Queuine tRNA-ribosyltransferase Clostridium botulinum (strain ATCC 19397 / Type A)
Q97GT3 3.02e-127 373 48 2 366 3 tgt Queuine tRNA-ribosyltransferase Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
B8HX02 3.45e-126 370 49 2 360 3 tgt Queuine tRNA-ribosyltransferase Cyanothece sp. (strain PCC 7425 / ATCC 29141)
Q7UWK9 9.64e-126 369 52 3 359 3 tgt Queuine tRNA-ribosyltransferase Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
Q892A0 9.77e-126 369 47 2 366 3 tgt Queuine tRNA-ribosyltransferase Clostridium tetani (strain Massachusetts / E88)
B9K8N7 1.16e-125 369 50 2 360 3 tgt Queuine tRNA-ribosyltransferase Thermotoga neapolitana (strain ATCC 49049 / DSM 4359 / NBRC 107923 / NS-E)
B9L8E1 3.39e-125 368 48 2 369 3 tgt Queuine tRNA-ribosyltransferase Nautilia profundicola (strain ATCC BAA-1463 / DSM 18972 / AmH)
A5IM22 8.78e-125 367 49 2 363 3 tgt Queuine tRNA-ribosyltransferase Thermotoga petrophila (strain ATCC BAA-488 / DSM 13995 / JCM 10881 / RKU-1)
Q9X1P7 8.78e-125 367 49 2 363 1 tgt Queuine tRNA-ribosyltransferase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
B1LB70 1.5e-124 366 49 2 363 3 tgt Queuine tRNA-ribosyltransferase Thermotoga sp. (strain RQ2)
A8ZRX7 2.51e-123 363 50 2 346 3 tgt Queuine tRNA-ribosyltransferase Desulfosudis oleivorans (strain DSM 6200 / JCM 39069 / Hxd3)
C0R0X6 2.78e-123 363 48 1 347 3 tgt Queuine tRNA-ribosyltransferase Brachyspira hyodysenteriae (strain ATCC 49526 / WA1)
A6LMW2 1e-122 361 48 1 360 3 tgt Queuine tRNA-ribosyltransferase Thermosipho melanesiensis (strain DSM 12029 / CIP 104789 / BI429)
Q8GAA6 1.08e-122 362 47 1 366 3 tgt Queuine tRNA-ribosyltransferase Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
A9KHU4 1.3e-122 362 47 3 374 3 tgt Queuine tRNA-ribosyltransferase Lachnoclostridium phytofermentans (strain ATCC 700394 / DSM 18823 / ISDg)
O08314 2.51e-122 360 46 3 366 3 tgt Queuine tRNA-ribosyltransferase Helicobacter pylori (strain ATCC 700392 / 26695)
Q30S46 2.68e-122 360 47 2 372 3 tgt Queuine tRNA-ribosyltransferase Sulfurimonas denitrificans (strain ATCC 33889 / DSM 1251)
Q17YB5 2.93e-122 360 46 3 366 3 tgt Queuine tRNA-ribosyltransferase Helicobacter acinonychis (strain Sheeba)
B7IDU1 3.01e-122 360 48 1 360 3 tgt Queuine tRNA-ribosyltransferase Thermosipho africanus (strain TCF52B)
A5FSU3 3.67e-122 361 48 2 365 3 tgt Queuine tRNA-ribosyltransferase Dehalococcoides mccartyi (strain ATCC BAA-2100 / JCM 16839 / KCTC 5957 / BAV1)
Q7M8N8 1.38e-121 359 48 4 373 3 tgt Queuine tRNA-ribosyltransferase Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
Q3ZAE2 1.5e-121 359 49 1 353 3 tgt Queuine tRNA-ribosyltransferase Dehalococcoides mccartyi (strain ATCC BAA-2266 / KCTC 15142 / 195)
Q9ZMF4 2.1e-121 358 46 3 366 3 tgt Queuine tRNA-ribosyltransferase Helicobacter pylori (strain J99 / ATCC 700824)
Q1CUM2 2.24e-121 358 46 3 366 3 tgt Queuine tRNA-ribosyltransferase Helicobacter pylori (strain HPAG1)
A7I2I6 2.34e-121 358 46 2 370 3 tgt Queuine tRNA-ribosyltransferase Campylobacter hominis (strain ATCC BAA-381 / DSM 21671 / CCUG 45161 / LMG 19568 / NCTC 13146 / CH001A)
B5ZA47 2.58e-121 358 45 3 366 3 tgt Queuine tRNA-ribosyltransferase Helicobacter pylori (strain G27)
B2USB2 4.55e-121 357 46 3 366 3 tgt Queuine tRNA-ribosyltransferase Helicobacter pylori (strain Shi470)
B6JKL0 5.85e-121 357 46 3 366 3 tgt Queuine tRNA-ribosyltransferase Helicobacter pylori (strain P12)
Q3ZWC1 1.62e-120 357 48 2 365 3 tgt Queuine tRNA-ribosyltransferase Dehalococcoides mccartyi (strain CBDB1)
Q8YVT9 6.43e-120 354 49 3 354 3 tgt Queuine tRNA-ribosyltransferase Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q029K6 1.47e-119 353 50 2 347 3 tgt Queuine tRNA-ribosyltransferase Solibacter usitatus (strain Ellin6076)
Q0IDF3 1.67e-119 353 47 3 363 3 tgt Queuine tRNA-ribosyltransferase Synechococcus sp. (strain CC9311)
A6Q3Y5 2.51e-119 353 46 2 370 3 tgt Queuine tRNA-ribosyltransferase Nitratiruptor sp. (strain SB155-2)
Q7NMG4 3.72e-119 353 46 4 378 3 tgt Queuine tRNA-ribosyltransferase Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
A6Q906 4.46e-119 352 46 2 373 3 tgt Queuine tRNA-ribosyltransferase Sulfurovum sp. (strain NBC37-1)
B3DYE4 1.1e-118 352 46 3 371 3 tgt Queuine tRNA-ribosyltransferase Methylacidiphilum infernorum (isolate V4)
Q8CWM7 1.29e-118 351 48 2 358 3 tgt Queuine tRNA-ribosyltransferase Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
A8ERD1 1.41e-117 348 44 2 373 3 tgt Queuine tRNA-ribosyltransferase Aliarcobacter butzleri (strain RM4018)
A7GYD5 1.16e-114 342 45 5 382 3 tgt Queuine tRNA-ribosyltransferase Campylobacter curvus (strain 525.92)
A7ZD89 3.03e-114 340 45 3 370 3 tgt Queuine tRNA-ribosyltransferase Campylobacter concisus (strain 13826)
A5USV3 4.13e-114 340 44 7 396 3 tgt Queuine tRNA-ribosyltransferase Roseiflexus sp. (strain RS-1)
A0RPL5 1.08e-113 338 43 2 372 3 tgt Queuine tRNA-ribosyltransferase Campylobacter fetus subsp. fetus (strain 82-40)
A9BDP3 2.92e-112 335 46 2 354 3 tgt Queuine tRNA-ribosyltransferase Prochlorococcus marinus (strain MIT 9211)
A2BUQ2 2.3e-111 333 45 1 345 3 tgt Queuine tRNA-ribosyltransferase Prochlorococcus marinus (strain MIT 9515)
Q7VHX2 2.43e-111 333 45 3 377 3 tgt Queuine tRNA-ribosyltransferase Helicobacter hepaticus (strain ATCC 51449 / 3B1)
B9KFT3 3.56e-111 332 42 2 370 3 tgt Queuine tRNA-ribosyltransferase Campylobacter lari (strain RM2100 / D67 / ATCC BAA-1060)
A8G2T1 9.89e-111 331 44 1 345 3 tgt Queuine tRNA-ribosyltransferase Prochlorococcus marinus (strain MIT 9215)
Q7TUG0 1.45e-110 330 44 2 354 3 tgt Queuine tRNA-ribosyltransferase Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
A9FI06 2.45e-110 331 49 2 351 3 tgt Queuine tRNA-ribosyltransferase Sorangium cellulosum (strain So ce56)
Q31CR1 9.19e-110 328 44 2 354 3 tgt Queuine tRNA-ribosyltransferase Prochlorococcus marinus (strain MIT 9312)
A3PAZ2 1.75e-109 328 45 2 350 3 tgt Queuine tRNA-ribosyltransferase Prochlorococcus marinus (strain MIT 9301)
A2BP70 1.93e-109 328 44 2 354 3 tgt Queuine tRNA-ribosyltransferase Prochlorococcus marinus (strain AS9601)
Q7TUM6 3.99e-109 327 45 2 351 3 tgt Queuine tRNA-ribosyltransferase Prochlorococcus marinus (strain MIT 9313)
Q3AN18 4.59e-109 327 46 3 353 3 tgt Queuine tRNA-ribosyltransferase Synechococcus sp. (strain CC9605)
A2CCL1 2.08e-108 325 46 3 351 3 tgt Queuine tRNA-ribosyltransferase Prochlorococcus marinus (strain MIT 9303)
Q55983 8.45e-108 323 43 2 365 3 tgt Queuine tRNA-ribosyltransferase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q73QK5 3.58e-107 322 43 1 361 3 tgt Queuine tRNA-ribosyltransferase Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q7VDR5 4.18e-107 322 46 2 356 3 tgt Queuine tRNA-ribosyltransferase Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
B0SKS9 5.55e-106 319 42 0 350 3 tgt Queuine tRNA-ribosyltransferase Leptospira biflexa serovar Patoc (strain Patoc 1 / ATCC 23582 / Paris)
B0SCA8 5.55e-106 319 42 0 350 3 tgt Queuine tRNA-ribosyltransferase Leptospira biflexa serovar Patoc (strain Patoc 1 / Ames)
Q04Z48 8.29e-106 318 41 0 358 3 tgt Queuine tRNA-ribosyltransferase Leptospira borgpetersenii serovar Hardjo-bovis (strain L550)
Q04UC6 8.29e-106 318 41 0 358 3 tgt Queuine tRNA-ribosyltransferase Leptospira borgpetersenii serovar Hardjo-bovis (strain JB197)
Q3B088 1.02e-105 318 44 2 351 3 tgt Queuine tRNA-ribosyltransferase Synechococcus sp. (strain CC9902)
Q8CXS3 6.67e-105 316 40 0 358 3 tgt Queuine tRNA-ribosyltransferase Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72TL3 6.67e-105 316 40 0 358 3 tgt Queuine tRNA-ribosyltransferase Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q9PNT0 8.12e-105 316 42 2 373 3 tgt Queuine tRNA-ribosyltransferase Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q5HUF2 4.37e-104 314 42 2 373 3 tgt Queuine tRNA-ribosyltransferase Campylobacter jejuni (strain RM1221)
A1VZZ8 4.77e-104 314 42 2 373 3 tgt Queuine tRNA-ribosyltransferase Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
Q9VPY8 9.9e-104 315 44 3 371 2 Tgt Queuine tRNA-ribosyltransferase catalytic subunit Drosophila melanogaster
A7H331 5.03e-103 311 41 2 373 3 tgt Queuine tRNA-ribosyltransferase Campylobacter jejuni subsp. doylei (strain ATCC BAA-1458 / RM4099 / 269.97)
O28787 5.05e-103 312 39 4 402 3 tgt Putative queuine tRNA-ribosyltransferase Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
A8FM59 8.11e-103 311 41 2 373 3 tgt Queuine tRNA-ribosyltransferase Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
Q7TTX7 4.86e-101 306 45 3 351 3 tgt Queuine tRNA-ribosyltransferase Parasynechococcus marenigrum (strain WH8102)
B5RN03 9.89e-99 300 40 1 351 3 tgt Queuine tRNA-ribosyltransferase Borrelia duttonii (strain Ly)
B2S1F3 1.44e-98 300 40 1 351 3 tgt Queuine tRNA-ribosyltransferase Borrelia hermsii (strain HS1 / DAH)
Q4QR99 2.01e-98 301 41 1 365 1 Qtrt1 Queuine tRNA-ribosyltransferase catalytic subunit 1 Rattus norvegicus
Q9JMA2 3.42e-98 300 41 1 365 1 Qtrt1 Queuine tRNA-ribosyltransferase catalytic subunit 1 Mus musculus
A1R0N4 4.05e-98 299 40 1 351 3 tgt Queuine tRNA-ribosyltransferase Borrelia turicatae (strain 91E135)
B5RQE7 1.25e-97 298 40 1 351 3 tgt Queuine tRNA-ribosyltransferase Borrelia recurrentis (strain A1)
Q9BXR0 2.83e-97 298 42 1 361 1 QTRT1 Queuine tRNA-ribosyltransferase catalytic subunit 1 Homo sapiens
Q4QQY7 7.51e-97 296 42 3 357 2 qtrt1 Queuine tRNA-ribosyltransferase catalytic subunit 1 Xenopus laevis
Q28HC6 2.08e-96 295 43 4 364 2 qtrt1 Queuine tRNA-ribosyltransferase catalytic subunit 1 Xenopus tropicalis
Q23623 3.51e-96 295 42 3 362 3 tgt-1 Queuine tRNA-ribosyltransferase catalytic subunit Caenorhabditis elegans
A8X0P0 6.69e-94 289 42 3 362 3 tgt-1 Queuine tRNA-ribosyltransferase catalytic subunit Caenorhabditis briggsae
Q65ZW4 8.31e-94 288 39 1 355 3 tgt Queuine tRNA-ribosyltransferase Borrelia garinii subsp. bavariensis (strain ATCC BAA-2496 / DSM 23469 / PBi)
Q7SYK1 1.45e-90 280 41 3 358 2 qtrt1 Queuine tRNA-ribosyltransferase catalytic subunit 1 Danio rerio
O51749 1.25e-86 270 38 2 357 3 tgt Queuine tRNA-ribosyltransferase Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
O94460 1.53e-86 270 39 3 369 3 SPAC1687.19c Queuine tRNA-ribosyltransferase catalytic subunit Schizosaccharomyces pombe (strain 972 / ATCC 24843)
B7J0Q4 2.79e-86 268 38 2 357 3 tgt Queuine tRNA-ribosyltransferase Borreliella burgdorferi (strain ZS7)
Q6MD31 4.5e-86 268 39 5 373 3 tgt Queuine tRNA-ribosyltransferase Protochlamydia amoebophila (strain UWE25)
Q254U7 9.61e-77 244 35 4 363 3 tgt Queuine tRNA-ribosyltransferase Chlamydia felis (strain Fe/C-56)
O84196 1.22e-76 244 35 7 377 3 tgt Queuine tRNA-ribosyltransferase Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
B0BBH3 1.22e-76 244 35 7 377 3 tgt Queuine tRNA-ribosyltransferase Chlamydia trachomatis serovar L2b (strain UCH-1/proctitis)
B0B9U3 1.22e-76 244 35 7 377 3 tgt Queuine tRNA-ribosyltransferase Chlamydia trachomatis serovar L2 (strain ATCC VR-902B / DSM 19102 / 434/Bu)
Q5L5T1 1.66e-76 243 35 4 368 3 tgt Queuine tRNA-ribosyltransferase Chlamydia abortus (strain DSM 27085 / S26/3)
Q822U8 2.27e-76 243 35 4 363 3 tgt Queuine tRNA-ribosyltransferase Chlamydia caviae (strain ATCC VR-813 / DSM 19441 / 03DC25 / GPIC)
Q3KMG9 3.04e-76 243 35 7 377 3 tgt Queuine tRNA-ribosyltransferase Chlamydia trachomatis serovar A (strain ATCC VR-571B / DSM 19440 / HAR-13)
Q9PKK0 1.18e-74 239 34 7 377 3 tgt Queuine tRNA-ribosyltransferase Chlamydia muridarum (strain MoPn / Nigg)
Q9Z8W5 1.25e-72 233 35 5 370 3 tgt Queuine tRNA-ribosyltransferase Chlamydia pneumoniae
Q46DI6 9.79e-32 128 27 8 358 3 tgtA tRNA-guanine(15) transglycosylase Methanosarcina barkeri (strain Fusaro / DSM 804)
Q8PXW5 6.5e-31 125 27 8 358 3 tgtA tRNA-guanine(15) transglycosylase Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q8THU2 1.19e-30 125 27 8 358 3 tgtA tRNA-guanine(15) transglycosylase Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
O26278 3.17e-30 125 27 9 366 3 tgtA tRNA-guanine(15) transglycosylase Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
Q5JHC0 4.58e-29 121 26 8 360 3 tgtA tRNA-guanine(15) transglycosylase Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
A6UVD8 4.99e-29 122 26 6 366 3 tgtA tRNA-guanine(15) transglycosylase Methanococcus aeolicus (strain ATCC BAA-1280 / DSM 17508 / OCM 812 / Nankai-3)
Q9YAC2 2.47e-27 116 28 10 360 3 tgtA tRNA-guanine(15) transglycosylase Aeropyrum pernix (strain ATCC 700893 / DSM 11879 / JCM 9820 / NBRC 100138 / K1)
B6YUR8 2.51e-27 116 26 7 360 3 tgtA tRNA-guanine(15) transglycosylase Thermococcus onnurineus (strain NA1)
Q6LZL5 3.22e-27 116 26 8 364 3 tgtA tRNA-guanine(15) transglycosylase Methanococcus maripaludis (strain DSM 14266 / JCM 13030 / NBRC 101832 / S2 / LL)
O58843 4.53e-27 115 26 7 360 1 tgtA tRNA-guanine(15) transglycosylase Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
A6VJR4 5.99e-27 115 26 8 364 3 tgtA tRNA-guanine(15) transglycosylase Methanococcus maripaludis (strain C7 / ATCC BAA-1331)
Q2NGY4 6.02e-27 115 26 9 358 3 tgtA tRNA-guanine(15) transglycosylase Methanosphaera stadtmanae (strain ATCC 43021 / DSM 3091 / JCM 11832 / MCB-3)
B7Q5K1 6.33e-27 113 31 2 193 3 ISCW021855 Queuine tRNA-ribosyltransferase accessory subunit 2 Ixodes scapularis
Q9UZN0 6.56e-27 115 26 8 360 3 tgtA tRNA-guanine(15) transglycosylase Pyrococcus abyssi (strain GE5 / Orsay)
Q57878 7.98e-27 115 27 7 364 1 tgtA tRNA-guanine(15) transglycosylase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
A4FYL8 3.17e-26 113 26 8 364 3 tgtA tRNA-guanine(15) transglycosylase Methanococcus maripaludis (strain C5 / ATCC BAA-1333)
A9A6B5 3.72e-26 113 26 7 364 3 tgtA tRNA-guanine(15) transglycosylase Methanococcus maripaludis (strain C6 / ATCC BAA-1332)
Q8TH08 5.58e-26 112 25 7 360 1 tgtA tRNA-guanine(15) transglycosylase Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
A5UNI4 2.74e-25 110 26 6 365 3 tgtA tRNA-guanine(15) transglycosylase Methanobrevibacter smithii (strain ATCC 35061 / DSM 861 / OCM 144 / PS)
Q8ZYH2 8.05e-25 108 26 9 359 3 tgtA tRNA-guanine(15) transglycosylase Pyrobaculum aerophilum (strain ATCC 51768 / DSM 7523 / JCM 9630 / CIP 104966 / NBRC 100827 / IM2)
Q28DX0 1.58e-24 107 25 5 288 2 qtrt2 Queuine tRNA-ribosyltransferase accessory subunit 2 Xenopus tropicalis
O29667 5e-24 106 26 9 356 3 tgtA tRNA-guanine(15) transglycosylase Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q6DF96 9.34e-24 104 25 5 290 2 qtrt2 Queuine tRNA-ribosyltransferase accessory subunit 2 Xenopus laevis
B4PEV9 3.47e-22 100 30 7 253 3 GE21237 Queuine tRNA-ribosyltransferase accessory subunit 2 Drosophila yakuba
B3NCH1 3.54e-22 100 31 7 253 3 GG14034 Queuine tRNA-ribosyltransferase accessory subunit 2 Drosophila erecta
B4HL48 5.26e-22 100 30 7 266 3 GM24868 Queuine tRNA-ribosyltransferase accessory subunit 2 Drosophila sechellia
Q8TYV3 5.3e-22 100 27 11 365 3 tgtA tRNA-guanine(15) transglycosylase Methanopyrus kandleri (strain AV19 / DSM 6324 / JCM 9639 / NBRC 100938)
Q9VSZ6 1.02e-21 99 29 7 266 2 CG3434 Queuine tRNA-ribosyltransferase accessory subunit 2 Drosophila melanogaster
Q3IR98 2.29e-21 99 27 11 363 3 tgtA tRNA-guanine(15) transglycosylase Natronomonas pharaonis (strain ATCC 35678 / DSM 2160 / CIP 103997 / JCM 8858 / NBRC 14720 / NCIMB 2260 / Gabara)

  • Number of RefSeq hits:

General

Source Morganella morganii S5
Locus tag HKOGLL_17825
Feature type CDS
Gene tgt
Product tRNA guanosine(34) transglycosylase Tgt
Location 30008 - 31132 (strand: 1)
Length 1125 (nucleotides) / 374 (amino acids)

Contig

Accession ZDB_702
Length 42793 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2261
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF01702 Queuine tRNA-ribosyltransferase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0343 Translation, ribosomal structure and biogenesis (J) J Queuine/archaeosine tRNA-ribosyltransferase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K00773 queuine tRNA-ribosyltransferase [EC:2.4.2.29] - -

Protein Sequence

MKYELQTTDGRARRGRLIFDRGVVETPAFMPVGTYGTVKGMTPEEVKETGAQILLGNTFHLWLRPGQEIMKLHGDLHDFMQWKGPILTDSGGFQVFSLGAMRKIKEEGVHFRNPINGEKIFLSPEKSMEIQYDLGSDIVMIFDECTPYPADWDYAKKSMEMSLRWAKRSRDRFDELGNPNALFGIIQGSVYEDLRDVSVKGLVEIGFDGYAVGGLAVGEPKEDMHRILEHVCPQIPEDKPRYLMGVGKPEDLVEGVRRGIDMFDCVMPTRNARNGHLFVTDGVVKIRNAKYKSDTSPLDAECDCYTCRNYTRAYLHHLDRCNEILGARLNTIHNLRYYQRLMAGIRQAIEEGRLEAFAAEFYQRIGKPVPPLSE

Flanking regions ( +/- flanking 50bp)

CTGCCGCTAATTAAACATCATCAGACTGTTTTTCTGATGCCGGAGGTTTTGTGAAATATGAACTGCAGACGACAGACGGCCGTGCGCGCCGTGGTCGCTTAATTTTTGATCGTGGCGTTGTTGAAACCCCTGCATTTATGCCGGTGGGGACTTATGGCACAGTGAAAGGGATGACACCGGAAGAAGTGAAAGAGACCGGTGCGCAAATCTTATTAGGTAACACGTTCCATCTGTGGCTGCGTCCCGGTCAGGAAATTATGAAACTGCACGGCGATCTGCATGACTTTATGCAGTGGAAAGGCCCGATTCTGACTGACTCCGGCGGTTTCCAGGTGTTCAGCCTGGGCGCAATGCGCAAAATCAAAGAAGAAGGTGTCCATTTCCGTAACCCGATCAACGGTGAAAAAATCTTCTTAAGTCCTGAAAAATCGATGGAAATTCAGTACGATCTCGGGTCTGATATCGTGATGATTTTTGACGAGTGCACACCGTATCCGGCGGACTGGGACTACGCGAAGAAATCCATGGAAATGTCTCTGCGCTGGGCTAAACGCAGCCGCGACCGTTTCGATGAACTGGGTAACCCGAATGCACTGTTCGGTATTATCCAGGGCAGTGTTTACGAAGATTTACGCGATGTGTCTGTGAAAGGACTGGTGGAAATCGGATTTGATGGGTACGCTGTGGGCGGTCTGGCTGTCGGCGAGCCGAAAGAAGATATGCACCGGATTCTCGAGCATGTCTGTCCGCAGATCCCGGAAGATAAACCGCGCTATTTAATGGGCGTGGGTAAACCGGAAGATCTGGTGGAAGGTGTGCGCCGCGGTATTGATATGTTCGACTGCGTGATGCCGACCCGTAATGCCCGTAACGGTCATCTGTTTGTGACGGACGGCGTGGTAAAAATCCGTAATGCGAAGTATAAATCAGATACATCGCCGCTGGATGCGGAATGTGACTGCTATACCTGCCGCAATTATACGCGTGCGTATCTGCATCATTTGGATCGCTGTAATGAAATCCTTGGCGCGCGCTTAAATACCATTCATAATCTGCGCTACTATCAGCGTCTGATGGCGGGTATCCGGCAGGCAATTGAAGAAGGCCGTCTGGAAGCATTTGCCGCTGAATTTTATCAGCGGATCGGGAAACCCGTTCCGCCGTTAAGTGAGTGATTTCCCCGAAACGGGATCACCCGGTGGTGTATAACATAGGCGATACACCA