Homologs in group_2211

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_16910 FBDBKF_16910 100.0 Morganella morganii S1 rfaH transcription/translation regulatory transformer protein RfaH
EHELCC_19520 EHELCC_19520 90.6 Morganella morganii S2 - hypothetical protein
NLDBIP_16890 NLDBIP_16890 100.0 Morganella morganii S4 rfaH transcription/translation regulatory transformer protein RfaH
LHKJJB_16580 LHKJJB_16580 100.0 Morganella morganii S3 rfaH transcription/translation regulatory transformer protein RfaH
F4V73_RS18380 F4V73_RS18380 90.2 Morganella psychrotolerans rfaH transcription/translation regulatory transformer protein RfaH
PMI_RS17605 PMI_RS17605 63.2 Proteus mirabilis HI4320 rfaH transcription/translation regulatory transformer protein RfaH

Distribution of the homologs in the orthogroup group_2211

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2211

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q8FBI4 1.73e-72 218 61 1 163 1 rfaH Transcription antitermination protein RfaH Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TAL4 1.73e-72 218 61 1 163 1 rfaH Transcription antitermination protein RfaH Escherichia coli O6:K15:H31 (strain 536 / UPEC)
P0AFW0 3.23e-72 217 61 1 163 1 rfaH Transcription antitermination protein RfaH Escherichia coli (strain K12)
P0AFW1 3.23e-72 217 61 1 163 3 rfaH Transcription antitermination protein RfaH Escherichia coli O157:H7
Q92J91 1.27e-07 52 24 2 146 3 nusG Transcription termination/antitermination protein NusG Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q68XN3 3.27e-07 51 23 2 146 3 nusG Transcription termination/antitermination protein NusG Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q1RHC5 7.67e-07 50 24 4 143 3 nusG Transcription termination/antitermination protein NusG Rickettsia bellii (strain RML369-C)
Q4UKC9 7.68e-07 50 24 2 146 3 nusG Transcription termination/antitermination protein NusG Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
P50056 2.71e-06 48 25 2 135 3 nusG Transcription termination/antitermination protein NusG Rickettsia prowazekii (strain Madrid E)
P55976 1.02e-05 46 25 7 162 3 nusG Transcription termination/antitermination protein NusG Helicobacter pylori (strain ATCC 700392 / 26695)
Q9ZK20 1.68e-05 46 25 7 162 3 nusG Transcription termination/antitermination protein NusG Helicobacter pylori (strain J99 / ATCC 700824)

  • Number of RefSeq hits:

General

Source Morganella morganii S5
Locus tag HKOGLL_17545
Feature type CDS
Gene rfaH
Product transcription/translation regulatory transformer protein RfaH
Location 11109 - 11600 (strand: 1)
Length 492 (nucleotides) / 163 (amino acids)

Contig

Accession ZDB_701
Length 44890 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2211
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF02357 Transcription termination factor nusG

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0250 Transcription (K) K Transcription termination/antitermination protein NusG

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K05785 transcriptional antiterminator RfaH - -

Protein Sequence

MKDWYLLYCKRGQLPRAMEHLQRQQVECLTPMANIEKVVRGKRVTVNEPLFPNYLFISFDPETIHTTTINSTRGVNHFVRFGPLPAVVPASLIEELKNAECVSLSEQNVPQPGDIVEITEGMFKGLEAIYQEPDGDTRSVLLLTLISKELTKKVDNTSFIRKL

Flanking regions ( +/- flanking 50bp)

TTTGTTATTATCAGGCTTTATATAAGCCCCCGTTTGTGTTGGATAGCGTAATGAAGGATTGGTATTTATTGTACTGCAAACGCGGACAACTTCCGCGGGCAATGGAACATTTGCAGCGGCAGCAGGTGGAATGCCTGACACCGATGGCGAATATTGAAAAAGTGGTTCGCGGCAAACGTGTGACGGTCAATGAGCCCCTGTTCCCGAATTACCTGTTTATTTCTTTTGATCCCGAGACTATTCATACAACCACGATTAACTCAACGCGCGGCGTCAATCATTTCGTCCGTTTCGGACCACTGCCTGCCGTTGTTCCCGCATCATTGATTGAAGAGCTGAAAAATGCCGAATGTGTCAGCCTGTCAGAGCAAAATGTTCCGCAGCCGGGGGATATTGTGGAAATCACTGAAGGGATGTTTAAAGGCCTGGAAGCGATTTATCAGGAGCCGGACGGCGACACCCGCTCCGTGCTGCTGCTGACGCTGATCAGTAAAGAGCTGACCAAAAAAGTGGATAACACCAGCTTTATCCGGAAACTCTGAGTATCTCCGTCACCCGGAAACAAAAAACCGCCCTGTTATTAAGGCGGTTT