Homologs in group_108

Help

10 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_00215 FBDBKF_00215 50.0 Morganella morganii S1 ninB Recombination protein NinB
FBDBKF_11300 FBDBKF_11300 100.0 Morganella morganii S1 ninB NinB protein
EHELCC_01330 EHELCC_01330 50.0 Morganella morganii S2 ninB Recombination protein NinB
EHELCC_17915 EHELCC_17915 100.0 Morganella morganii S2 ninB NinB protein
NLDBIP_02130 NLDBIP_02130 50.0 Morganella morganii S4 ninB Recombination protein NinB
NLDBIP_05245 NLDBIP_05245 100.0 Morganella morganii S4 ninB NinB protein
LHKJJB_02125 LHKJJB_02125 100.0 Morganella morganii S3 ninB NinB protein
LHKJJB_03645 LHKJJB_03645 50.0 Morganella morganii S3 ninB Recombination protein NinB
HKOGLL_03400 HKOGLL_03400 50.0 Morganella morganii S5 ninB Recombination protein NinB
PMI_RS02405 PMI_RS02405 31.3 Proteus mirabilis HI4320 - YbcN family protein

Distribution of the homologs in the orthogroup group_108

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_108

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q47269 4.92e-39 132 44 1 142 4 ybcN Uncharacterized protein YbcN Escherichia coli (strain K12)
Q37870 5.98e-39 132 44 1 142 4 None Uncharacterized protein in rusA 5'region Enterobacteria phage 82

  • Number of RefSeq hits:

General

Source Morganella morganii S5
Locus tag HKOGLL_15505
Feature type CDS
Gene ninB
Product NinB protein
Location 31619 - 32062 (strand: -1)
Length 444 (nucleotides) / 147 (amino acids)

Contig

Accession ZDB_695
Length 101591 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_108
Orthogroup size 11
N. genomes 6

Actions

Genomic region

Domains

PF05772 NinB protein

Protein Sequence

MEAEFLFHETTKDAAWQHLKEALATNKPHRVIIKPWKSTRSLSQNATFHMWCGEISKYLCDNGSKFTPETVKEMLKHTFLGYEVTEMIDATTQHTERVRTMRKTSKLDTGEMFHFMGQVERWATGIGCFVTIPENSEYMKLKREQDA

Flanking regions ( +/- flanking 50bp)

AGCGCAACGCAAAAGCCAGAATCCGGAGAGCCAAAAAATCAGGAGGCTAAATGGAAGCAGAATTTCTCTTCCACGAAACAACCAAAGATGCAGCCTGGCAACACCTCAAAGAAGCACTCGCAACAAACAAACCCCACCGAGTAATCATCAAGCCCTGGAAATCTACCCGCTCACTATCTCAGAACGCCACGTTTCATATGTGGTGCGGCGAGATAAGCAAGTACCTGTGTGACAACGGCTCTAAATTCACGCCTGAGACAGTCAAGGAAATGCTTAAGCATACATTCCTCGGCTACGAGGTTACTGAAATGATAGATGCCACCACGCAGCATACAGAGCGCGTAAGGACTATGAGAAAAACATCAAAGTTAGACACCGGGGAAATGTTCCACTTCATGGGGCAGGTTGAGCGCTGGGCTACAGGCATCGGTTGTTTTGTGACGATACCCGAGAATTCGGAATATATGAAACTCAAAAGGGAGCAGGACGCATGAAAGAGCCTCACATACACCAGCTTCTCACCAATGACGAAGCCGATAACCTC