Homologs in group_290

Help

7 homologs were identified in 7 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_09410 FBDBKF_09410 100.0 Morganella morganii S1 potB spermidine/putrescine ABC transporter permease PotB
EHELCC_10000 EHELCC_10000 100.0 Morganella morganii S2 potB spermidine/putrescine ABC transporter permease PotB
NLDBIP_10345 NLDBIP_10345 100.0 Morganella morganii S4 potB spermidine/putrescine ABC transporter permease PotB
LHKJJB_11010 LHKJJB_11010 100.0 Morganella morganii S3 potB spermidine/putrescine ABC transporter permease PotB
HKOGLL_19760 HKOGLL_19760 95.9 Morganella morganii S5 - hypothetical protein
F4V73_RS10555 F4V73_RS10555 93.0 Morganella psychrotolerans potB spermidine/putrescine ABC transporter permease PotB
PMI_RS13485 PMI_RS13485 80.8 Proteus mirabilis HI4320 potB spermidine/putrescine ABC transporter permease PotB

Distribution of the homologs in the orthogroup group_290

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_290

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0CL49 3.11e-159 447 76 1 282 3 potB Spermidine/putrescine transport system permease protein PotB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
E1WF94 3.11e-159 447 76 1 282 3 potB Spermidine/putrescine transport system permease protein PotB Salmonella typhimurium (strain SL1344)
P0A2J8 3.11e-159 447 76 1 282 3 potB Spermidine/putrescine transport system permease protein PotB Salmonella typhi
P0AFK5 2.8e-158 444 78 0 274 3 potB Spermidine/putrescine transport system permease protein PotB Shigella flexneri
P0AFK4 2.8e-158 444 78 0 274 1 potB Spermidine/putrescine transport system permease protein PotB Escherichia coli (strain K12)
P45170 1.14e-117 342 60 0 286 3 potB Spermidine/putrescine transport system permease protein PotB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P31135 3e-61 199 42 2 229 1 potH Putrescine transport system permease protein PotH Escherichia coli (strain K12)
P77156 1.34e-26 108 30 5 253 1 ydcU Inner membrane ABC transporter permease protein YdcU Escherichia coli (strain K12)
P75058 2.7e-15 77 24 5 224 3 potB Spermidine/putrescine transport system permease protein PotB homolog Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
P47289 7.11e-14 73 27 4 172 3 potB Spermidine/putrescine transport system permease protein PotB homolog Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
P96064 9.14e-12 67 27 5 180 2 phnU Putative 2-aminoethylphosphonate transport system permease protein PhnU Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q57SD7 1.27e-11 67 27 5 180 3 phnU Putative 2-aminoethylphosphonate transport system permease protein PhnU Salmonella choleraesuis (strain SC-B67)
Q5PFQ6 1.38e-11 67 27 5 180 3 phnU Putative 2-aminoethylphosphonate transport system permease protein PhnU Salmonella paratyphi A (strain ATCC 9150 / SARB42)
P37731 3.05e-11 65 26 1 163 3 modB Molybdenum transport system permease protein ModB Azotobacter vinelandii
Q8Z8W9 1.07e-10 64 27 5 180 3 phnU Putative 2-aminoethylphosphonate transport system permease protein PhnU Salmonella typhi
Q9TJR4 4.38e-10 62 26 4 209 3 cysT Probable sulfate transport system permease protein cysT Prototheca wickerhamii
P41032 1.28e-09 61 25 6 205 3 cysU Sulfate transport system permease protein CysT Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P16701 1.52e-09 60 25 7 205 3 cysU Sulfate transport system permease protein CysT Escherichia coli (strain K12)
P0AF01 1.87e-09 60 28 4 185 1 modB Molybdenum transport system permease protein ModB Escherichia coli (strain K12)
P0AF02 1.87e-09 60 28 4 185 3 modB Molybdenum transport system permease protein ModB Escherichia coli O157:H7
P56343 7.5e-09 58 24 1 169 3 cysT Probable sulfate transport system permease protein cysT Chlorella vulgaris
P0AFK6 1.93e-08 57 28 2 168 3 potC Spermidine/putrescine transport system permease protein PotC Escherichia coli (strain K12)
P0AFK7 1.93e-08 57 28 2 168 3 potC Spermidine/putrescine transport system permease protein PotC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AFK8 1.93e-08 57 28 2 168 3 potC Spermidine/putrescine transport system permease protein PotC Escherichia coli O157:H7
Q83RR7 2.16e-08 57 28 2 168 3 potC Spermidine/putrescine transport system permease protein PotC Shigella flexneri
P45322 2.69e-08 56 24 4 179 3 modB Molybdenum transport system permease protein ModB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q6QJE2 3.35e-08 57 26 3 191 1 SULP2 Sulfate permease 2, chloroplastic Chlamydomonas reinhardtii
P9WG13 3.84e-08 56 23 3 177 3 modB Molybdenum transport system permease protein ModB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WG12 3.84e-08 56 23 3 177 3 modB Molybdenum transport system permease protein ModB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A625 3.84e-08 56 23 3 177 3 modB Molybdenum transport system permease protein ModB Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P74547 4.62e-08 56 25 4 189 3 cysW Sulfate transport system permease protein CysW Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q2EEX6 5.5e-08 56 29 2 130 3 cysT Probable sulfate transport system permease protein cysT Helicosporidium sp. subsp. Simulium jonesii
Q08382 1.22e-07 54 25 1 176 3 modB Molybdenum transport system permease protein ModB Rhodobacter capsulatus
P27370 2.81e-07 54 25 3 180 2 cysW Sulfate transport system permease protein CysW Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P9WG01 2.86e-07 54 27 5 183 1 sugB Trehalose transport system permease protein SugB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WG00 2.86e-07 54 27 5 183 3 sugB Trehalose transport system permease protein SugB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A2CI71 3.92e-07 53 34 0 76 3 cysT Probable sulfate transport system permease protein cysT Chlorokybus atmophyticus
Q57341 3.97e-07 54 23 1 182 3 fbpB1 Putative ferric transport system permease protein FbpB 1 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q44123 4.59e-07 54 24 2 174 3 fbpB Ferric transport system permease protein FbpB Actinobacillus pleuropneumoniae
Q9MUL9 4.8e-07 53 24 1 153 3 cysT Probable sulfate transport system permease protein cysT Mesostigma viride
O32155 1.03e-06 52 24 7 271 3 yurN Probable ABC transporter permease protein YurN Bacillus subtilis (strain 168)
O30143 1.44e-06 52 20 2 174 1 wtpB Molybdate/tungstate transport system permease protein WtpB Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
D4GQ17 1.74e-06 52 26 2 156 3 HVO_B0370 Probable molybdenum ABC transporter permease protein HVO_B0370 Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
P45169 2.2e-06 51 35 0 62 3 potC Spermidine/putrescine transport system permease protein PotC Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P75057 4e-06 50 24 2 125 3 potC Spermidine/putrescine transport system permease protein PotC homolog Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q9V2C1 5.35e-06 50 22 2 160 3 wtpB Molybdate/tungstate transport system permease protein WtpB Pyrococcus abyssi (strain GE5 / Orsay)
P47290 1.19e-05 49 27 1 107 3 potC Spermidine/putrescine transport system permease protein PotC homolog Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
P0AFL1 1.5e-05 48 37 0 67 1 potI Putrescine transport system permease protein PotI Escherichia coli (strain K12)
P0AFL2 1.5e-05 48 37 0 67 3 potI Putrescine transport system permease protein PotI Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8U4K4 1.95e-05 48 22 4 213 3 wtpB Molybdate/tungstate transport system permease protein WtpB Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q8Y775 2.34e-05 48 34 1 79 1 egtUBC Probable ergothioneine transporter EgtUBC Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
P55452 2.74e-05 48 30 0 78 3 NGR_a03680 Probable ABC transporter permease protein y4fN Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q9TKU8 3.1e-05 48 26 0 102 3 cysT Probable sulfate transport system permease protein cysT Nephroselmis olivacea
P18795 3.36e-05 48 23 3 188 3 nifC Probable transport system permease protein NifC Clostridium pasteurianum
P0AEB0 4.54e-05 47 25 1 178 1 cysW Sulfate transport system permease protein CysW Escherichia coli (strain K12)
P0AEB1 4.54e-05 47 25 1 178 3 cysW Sulfate transport system permease protein CysW Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P26246 4.92e-05 47 22 1 163 3 cysT Probable sulfate transport system permease protein cysT Marchantia polymorpha
Q7LYX6 0.000104 46 29 6 188 1 malG Trehalose/maltose transport system permease protein MalG Thermococcus litoralis (strain ATCC 51850 / DSM 5473 / JCM 8560 / NS-C)
P14176 0.000131 46 24 4 153 1 proW Glycine betaine/proline betaine transport system permease protein ProW Escherichia coli (strain K12)
P17327 0.000156 46 24 4 153 2 proW Glycine betaine/proline betaine transport system permease protein ProW Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q58763 0.000207 45 24 7 212 3 wtpB Molybdate/tungstate transport system permease protein WtpB Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q32RF7 0.000321 45 22 4 153 3 cysT Probable sulfate transport system permease protein cysT Zygnema circumcarinatum
O32168 0.000484 44 26 0 67 1 metP Methionine import system permease protein MetP Bacillus subtilis (strain 168)
Q8RVC7 0.000524 44 29 0 94 1 SULP1 Sulfate permease 1, chloroplastic Chlamydomonas reinhardtii
Q01895 0.000526 44 33 4 129 2 cysT Sulfate transport system permease protein CysT Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
O57893 0.000575 44 20 2 160 3 wtpB Molybdate/tungstate transport system permease protein WtpB Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
P40979 0.000743 42 30 1 84 3 None Putative ABC transporter permease protein ORF1 (Fragment) Caldicellulosiruptor sp. (strain Rt8B.4)

  • Number of RefSeq hits:

General

Source Morganella morganii S5
Locus tag HKOGLL_14070
Feature type CDS
Gene potB
Product spermidine/putrescine ABC transporter permease PotB
Location 111961 - 112821 (strand: -1)
Length 861 (nucleotides) / 286 (amino acids)
In genomic island -

Contig

Accession ZDB_692
Length 124746 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_290
Orthogroup size 8
N. genomes 7

Actions

Genomic region

Domains

PF00528 Binding-protein-dependent transport system inner membrane component

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1176 Amino acid transport and metabolism (E) E ABC-type spermidine/putrescine transport system, permease component I

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K11071 spermidine/putrescine transport system permease protein ABC transporters -

Protein Sequence

MKMTRKPFQTIVITGIVAWLLLFVFLPNLMIIGTSFLTRNDANLVDMVFTLDNYRRLFDPMYAQVMLHSFNMAVIATVCCLLIGYPFAAFIARMPQKYRPLMLFLLIVPFWTNSLIRIYGLKIFLSTRGYMNEFLLWTGLIDKPFKLMYTSEAVVLGLIYILLPFMVMPLYSSIEKLDKSYLEAARDLGANKCQTFFRIILPLTMPGIIAGCLLVLLPAMGLFYVADLMGGAKNLLIGNVIKSQFLNIRDWPFGAATSIFLTAAMGLLLYVYYRAAKMLNKKGELE

Flanking regions ( +/- flanking 50bp)

TCAGAAGATTGCGGTGACGTGGGTCGAAAGCTGGGAGGTGGTGCTGGGCGATGAAAATGACGCGTAAACCATTCCAGACTATCGTGATCACGGGGATTGTCGCCTGGTTACTGCTGTTTGTTTTCCTGCCCAATCTGATGATCATCGGCACCAGTTTCCTGACACGCAATGACGCGAATCTGGTCGATATGGTCTTTACCCTCGACAATTACCGCCGCTTGTTTGACCCGATGTACGCACAGGTAATGCTGCACTCGTTCAATATGGCGGTGATTGCCACGGTCTGCTGCCTGCTGATCGGCTATCCTTTTGCGGCGTTTATTGCAAGGATGCCGCAGAAGTACCGGCCACTGATGTTATTCCTGCTGATAGTTCCGTTCTGGACAAACTCGCTTATCCGCATTTACGGGCTGAAAATATTCCTCAGCACGCGCGGCTATATGAATGAGTTTTTATTATGGACCGGACTTATCGATAAACCCTTTAAGCTGATGTATACCTCTGAAGCGGTGGTGCTCGGGCTTATCTATATTCTGCTGCCGTTTATGGTGATGCCGCTTTACTCCAGTATTGAAAAGCTCGACAAATCTTATCTGGAAGCGGCGCGGGATCTGGGGGCAAATAAATGTCAGACCTTCTTCCGCATTATTCTGCCGCTGACCATGCCGGGTATTATCGCCGGTTGTCTGCTGGTACTGTTACCGGCGATGGGGCTGTTCTATGTGGCGGACCTGATGGGCGGGGCGAAAAACCTGCTGATTGGTAACGTGATAAAAAGTCAGTTCCTGAACATCCGTGACTGGCCGTTTGGTGCGGCAACCAGTATTTTCCTGACCGCAGCGATGGGGCTGCTGCTGTATGTCTATTACCGTGCGGCAAAAATGTTAAATAAGAAGGGTGAACTGGAATGATAGGACGCCTGTTACGCGGTGGTTTTATGACCATCATCTATGCTTATTTA