Homologs in group_290

Help

7 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_09410 FBDBKF_09410 93.0 Morganella morganii S1 potB spermidine/putrescine ABC transporter permease PotB
EHELCC_10000 EHELCC_10000 93.0 Morganella morganii S2 potB spermidine/putrescine ABC transporter permease PotB
NLDBIP_10345 NLDBIP_10345 93.0 Morganella morganii S4 potB spermidine/putrescine ABC transporter permease PotB
LHKJJB_11010 LHKJJB_11010 93.0 Morganella morganii S3 potB spermidine/putrescine ABC transporter permease PotB
HKOGLL_14070 HKOGLL_14070 93.0 Morganella morganii S5 potB spermidine/putrescine ABC transporter permease PotB
HKOGLL_19760 HKOGLL_19760 89.8 Morganella morganii S5 - hypothetical protein
PMI_RS13485 PMI_RS13485 80.8 Proteus mirabilis HI4320 potB spermidine/putrescine ABC transporter permease PotB

Distribution of the homologs in the orthogroup group_290

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_290

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0CL49 1.48e-160 451 78 1 282 3 potB Spermidine/putrescine transport system permease protein PotB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
E1WF94 1.48e-160 451 78 1 282 3 potB Spermidine/putrescine transport system permease protein PotB Salmonella typhimurium (strain SL1344)
P0A2J8 1.48e-160 451 78 1 282 3 potB Spermidine/putrescine transport system permease protein PotB Salmonella typhi
P0AFK5 1.62e-158 445 79 0 274 3 potB Spermidine/putrescine transport system permease protein PotB Shigella flexneri
P0AFK4 1.62e-158 445 79 0 274 1 potB Spermidine/putrescine transport system permease protein PotB Escherichia coli (strain K12)
P45170 4.13e-118 343 60 0 286 3 potB Spermidine/putrescine transport system permease protein PotB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P31135 1.51e-62 202 41 3 252 1 potH Putrescine transport system permease protein PotH Escherichia coli (strain K12)
P77156 1.08e-25 106 30 5 253 1 ydcU Inner membrane ABC transporter permease protein YdcU Escherichia coli (strain K12)
P75058 2.26e-15 77 26 6 225 3 potB Spermidine/putrescine transport system permease protein PotB homolog Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
P47289 1.22e-13 72 28 4 175 3 potB Spermidine/putrescine transport system permease protein PotB homolog Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
P96064 5.82e-12 68 29 5 180 2 phnU Putative 2-aminoethylphosphonate transport system permease protein PhnU Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q5PFQ6 8.04e-12 67 29 5 180 3 phnU Putative 2-aminoethylphosphonate transport system permease protein PhnU Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q57SD7 8.46e-12 67 29 5 180 3 phnU Putative 2-aminoethylphosphonate transport system permease protein PhnU Salmonella choleraesuis (strain SC-B67)
P0AF01 2.05e-11 65 29 4 185 1 modB Molybdenum transport system permease protein ModB Escherichia coli (strain K12)
P0AF02 2.05e-11 65 29 4 185 3 modB Molybdenum transport system permease protein ModB Escherichia coli O157:H7
P37731 3.85e-11 65 26 1 163 3 modB Molybdenum transport system permease protein ModB Azotobacter vinelandii
Q9TJR4 6.42e-11 64 26 4 209 3 cysT Probable sulfate transport system permease protein cysT Prototheca wickerhamii
Q8Z8W9 6.51e-11 65 28 5 180 3 phnU Putative 2-aminoethylphosphonate transport system permease protein PhnU Salmonella typhi
Q6QJE2 7.62e-10 62 27 3 191 1 SULP2 Sulfate permease 2, chloroplastic Chlamydomonas reinhardtii
P56343 1.19e-09 61 25 1 169 3 cysT Probable sulfate transport system permease protein cysT Chlorella vulgaris
P27370 2.3e-09 60 26 1 178 2 cysW Sulfate transport system permease protein CysW Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P74547 5.39e-09 59 27 2 174 3 cysW Sulfate transport system permease protein CysW Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P41032 7.91e-09 58 25 4 208 3 cysU Sulfate transport system permease protein CysT Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q9V2C1 8.72e-09 58 24 4 198 3 wtpB Molybdate/tungstate transport system permease protein WtpB Pyrococcus abyssi (strain GE5 / Orsay)
P9WG13 1.57e-08 57 25 1 175 3 modB Molybdenum transport system permease protein ModB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WG12 1.57e-08 57 25 1 175 3 modB Molybdenum transport system permease protein ModB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A625 1.57e-08 57 25 1 175 3 modB Molybdenum transport system permease protein ModB Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q2EEX6 4.27e-08 56 30 2 130 3 cysT Probable sulfate transport system permease protein cysT Helicosporidium sp. subsp. Simulium jonesii
Q83RR7 4.8e-08 56 27 2 168 3 potC Spermidine/putrescine transport system permease protein PotC Shigella flexneri
P0AFK6 4.94e-08 56 27 2 168 3 potC Spermidine/putrescine transport system permease protein PotC Escherichia coli (strain K12)
P0AFK7 4.94e-08 56 27 2 168 3 potC Spermidine/putrescine transport system permease protein PotC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AFK8 4.94e-08 56 27 2 168 3 potC Spermidine/putrescine transport system permease protein PotC Escherichia coli O157:H7
P16701 4.96e-08 56 25 5 194 3 cysU Sulfate transport system permease protein CysT Escherichia coli (strain K12)
O30143 9.32e-08 55 21 2 167 1 wtpB Molybdate/tungstate transport system permease protein WtpB Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
P45322 1.03e-07 55 25 3 173 3 modB Molybdenum transport system permease protein ModB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q58763 1.87e-07 54 25 7 211 3 wtpB Molybdate/tungstate transport system permease protein WtpB Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
A2CI71 2.21e-07 54 23 1 172 3 cysT Probable sulfate transport system permease protein cysT Chlorokybus atmophyticus
P47290 2.27e-07 54 28 1 117 3 potC Spermidine/putrescine transport system permease protein PotC homolog Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q08382 2.54e-07 53 26 1 176 3 modB Molybdenum transport system permease protein ModB Rhodobacter capsulatus
D4GQ17 3.37e-07 53 25 2 158 3 HVO_B0370 Probable molybdenum ABC transporter permease protein HVO_B0370 Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
P9WG01 4.5e-07 53 26 7 221 1 sugB Trehalose transport system permease protein SugB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WG00 4.5e-07 53 26 7 221 3 sugB Trehalose transport system permease protein SugB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q57341 4.67e-07 54 24 5 229 3 fbpB1 Putative ferric transport system permease protein FbpB 1 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9MUL9 5.57e-07 53 24 1 155 3 cysT Probable sulfate transport system permease protein cysT Mesostigma viride
P75057 5.95e-07 53 24 1 120 3 potC Spermidine/putrescine transport system permease protein PotC homolog Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q8U4K4 7.55e-07 52 25 4 198 3 wtpB Molybdate/tungstate transport system permease protein WtpB Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
P0AFL1 7.94e-07 52 40 0 67 1 potI Putrescine transport system permease protein PotI Escherichia coli (strain K12)
P0AFL2 7.94e-07 52 40 0 67 3 potI Putrescine transport system permease protein PotI Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P45169 1.68e-06 51 22 6 197 3 potC Spermidine/putrescine transport system permease protein PotC Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9TKU8 1.81e-06 52 25 2 155 3 cysT Probable sulfate transport system permease protein cysT Nephroselmis olivacea
Q44123 2.11e-06 52 24 2 174 3 fbpB Ferric transport system permease protein FbpB Actinobacillus pleuropneumoniae
P0AEB0 3.02e-06 51 26 1 178 1 cysW Sulfate transport system permease protein CysW Escherichia coli (strain K12)
P0AEB1 3.02e-06 51 26 1 178 3 cysW Sulfate transport system permease protein CysW Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
O57893 3.46e-06 50 22 2 161 3 wtpB Molybdate/tungstate transport system permease protein WtpB Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q8Y775 8.39e-06 50 35 1 79 1 egtUBC Probable ergothioneine transporter EgtUBC Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
O50501 9.57e-06 49 25 4 215 1 ngcG Diacetylchitobiose uptake system permease protein NgcG Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P55452 1.49e-05 49 30 0 78 3 NGR_a03680 Probable ABC transporter permease protein y4fN Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P18795 2.05e-05 48 23 3 188 3 nifC Probable transport system permease protein NifC Clostridium pasteurianum
O32155 3.9e-05 47 23 7 272 3 yurN Probable ABC transporter permease protein YurN Bacillus subtilis (strain 168)
P26246 7.15e-05 47 22 3 189 3 cysT Probable sulfate transport system permease protein cysT Marchantia polymorpha
P14176 7.22e-05 47 24 4 153 1 proW Glycine betaine/proline betaine transport system permease protein ProW Escherichia coli (strain K12)
P17327 0.000106 47 24 4 153 2 proW Glycine betaine/proline betaine transport system permease protein ProW Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q7LYX6 0.000113 46 29 6 190 1 malG Trehalose/maltose transport system permease protein MalG Thermococcus litoralis (strain ATCC 51850 / DSM 5473 / JCM 8560 / NS-C)
Q5JEB3 0.000148 45 22 4 164 3 wtpB Molybdate/tungstate transport system permease protein WtpB Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
A0A0H2XK79 0.000503 45 31 1 79 3 egtUBC Probable ergothioneine transporter EgtUBC Staphylococcus aureus (strain USA300)
Q01895 0.000503 44 33 4 129 2 cysT Sulfate transport system permease protein CysT Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q32RF7 0.00057 44 22 3 136 3 cysT Probable sulfate transport system permease protein cysT Zygnema circumcarinatum
P40979 0.00081 42 29 1 84 3 None Putative ABC transporter permease protein ORF1 (Fragment) Caldicellulosiruptor sp. (strain Rt8B.4)
E0SCY2 0.001 43 23 5 171 1 ousW Glycine betaine/choline transport system permease protein OusW Dickeya dadantii (strain 3937)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS10555
Feature type CDS
Gene potB
Product spermidine/putrescine ABC transporter permease PotB
Location 242728 - 243588 (strand: 1)
Length 861 (nucleotides) / 286 (amino acids)
In genomic island -

Contig

Accession NZ_VXKB01000002
Length 573139 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_290
Orthogroup size 8
N. genomes 7

Actions

Genomic region

Domains

PF00528 Binding-protein-dependent transport system inner membrane component

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1176 Amino acid transport and metabolism (E) E ABC-type spermidine/putrescine transport system, permease component I

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K11071 spermidine/putrescine transport system permease protein ABC transporters -

Protein Sequence

MKKTRKPFQTIVITLIVAWLLLFVFLPNLMIIGTSFLTRNDADLVSMVFTLDNYRRLFDPMYAQVMLHSLNMAVIATLLCLLIGYPFASMIARMPQKLRPLMLFLLIVPFWTNSLIRIYGLKIFLSTRGYLNEFLLWTGVIDKPFKIMYTSEAVILGLIYILLPFMVMPLYSSIEKLDKSCLEAARDLGANKLQTFFRITLPLTMPGIIAGCLLVLLPAMGLFYVADLMGGAKNLLIGNVIKSQFLNIRDWPFGAATSIFLTAAMGLLLWVYYRAAKLLNKKGEQE

Flanking regions ( +/- flanking 50bp)

TCAGAAAATTGCAGTGACGTGGGTTGAAAGCTGGGAGGTGGTGCTGAGCGATGAAAAAGACGCGTAAACCTTTCCAGACTATTGTGATCACTCTGATTGTCGCGTGGTTACTGTTATTTGTTTTCCTGCCTAACCTGATGATAATCGGCACCAGTTTCCTGACGCGTAATGATGCGGACCTGGTCAGTATGGTCTTTACCCTCGATAACTACCGTCGGTTATTTGACCCGATGTACGCGCAGGTGATGTTGCATTCGCTTAATATGGCAGTGATCGCAACACTTCTGTGCCTGTTGATTGGCTATCCTTTTGCGTCAATGATTGCCCGCATGCCGCAGAAACTGCGCCCGTTGATGCTTTTCCTGCTGATAGTCCCGTTCTGGACAAATTCCCTTATCCGCATTTACGGGCTGAAAATATTTCTCAGTACGCGTGGTTATCTGAATGAGTTTTTATTATGGACGGGCGTGATAGATAAACCGTTTAAAATTATGTATACCTCAGAAGCCGTGATACTCGGGCTTATCTATATTTTACTGCCGTTTATGGTGATGCCGCTGTATTCAAGTATTGAGAAGCTGGATAAATCCTGCCTGGAAGCTGCCCGTGACCTGGGTGCAAATAAGCTTCAGACCTTTTTCCGTATTACTCTGCCGCTCACAATGCCCGGAATTATCGCCGGTTGTCTGCTGGTGCTGTTGCCGGCAATGGGGCTGTTTTATGTGGCGGACCTGATGGGCGGGGCAAAAAATCTGTTGATTGGTAATGTTATCAAGAGCCAGTTTTTAAATATCCGCGACTGGCCATTCGGGGCGGCAACCAGCATTTTCCTGACGGCAGCGATGGGCTTATTGCTCTGGGTCTACTACCGTGCGGCAAAATTGTTAAATAAGAAAGGTGAACAGGAATGACGGGACGCCTGTTGCGTGGTGGTTTTATGACCATCATTTATGCTTATTTA