Homologs in group_2824

Help

5 homologs were identified in 5 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_09250 FBDBKF_09250 100.0 Morganella morganii S1 bltR2 GyrI-like small molecule binding domain
EHELCC_10160 EHELCC_10160 100.0 Morganella morganii S2 bltR2 GyrI-like small molecule binding domain
NLDBIP_10505 NLDBIP_10505 100.0 Morganella morganii S4 bltR2 GyrI-like small molecule binding domain
LHKJJB_10850 LHKJJB_10850 100.0 Morganella morganii S3 bltR2 GyrI-like small molecule binding domain
F4V73_RS10720 F4V73_RS10720 93.3 Morganella psychrotolerans - MerR family transcriptional regulator

Distribution of the homologs in the orthogroup group_2824

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2824

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P96690 4.03e-32 122 32 6 278 4 ydfL Uncharacterized HTH-type transcriptional regulator YdfL Bacillus subtilis (strain 168)
P39075 3.99e-26 107 27 4 280 1 bmrR Multidrug-efflux transporter 1 regulator Bacillus subtilis (strain 168)
P39842 8.58e-19 87 27 9 283 4 bltR Multidrug-efflux transporter 2 regulator Bacillus subtilis (strain 168)
P0A4T9 9.64e-07 52 25 1 112 1 tipA HTH-type transcriptional activator TipA Streptomyces lividans
P0A4T8 9.64e-07 52 25 1 112 3 tipA HTH-type transcriptional activator TipA Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P58379 1.66e-06 50 30 3 107 3 hmrR2 Heavy metal-dependent transcription regulator 2 Rhizobium meliloti (strain 1021)
Q9X5X4 2.72e-06 49 30 3 107 1 hmrR HTH-type transcriptional regulator HmrR Sinorhizobium medicae (strain WSM419)
Q9X5V4 2.4e-05 46 28 3 106 4 hmrR HTH-type transcriptional regulator HmrR Rhizobium leguminosarum bv. viciae
B8H172 2.72e-05 48 27 2 108 3 skgA HTH-type transcriptional regulator SkgA Caulobacter vibrioides (strain NA1000 / CB15N)
P0CAV4 2.72e-05 48 27 2 108 1 skgA HTH-type transcriptional regulator SkgA Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
P22853 3.29e-05 46 31 2 118 1 merR1 Mercuric resistance operon regulatory protein Bacillus cereus
P45277 0.000207 43 31 3 95 3 zntR HTH-type transcriptional regulator ZntR homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
O07586 0.000216 43 36 1 73 4 cueR HTH-type transcriptional regulator CueR Bacillus subtilis (strain 168)
Q9HV30 0.00039 43 26 2 106 3 PA4778 Uncharacterized HTH-type transcriptional regulator PA4778 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P0A2Q9 0.000505 43 30 4 110 4 merR Mercuric resistance operon regulatory protein Shigella flexneri
P0A2Q8 0.000505 43 30 4 110 3 merR Mercuric resistance operon regulatory protein Salmonella typhi
P22896 0.000823 42 29 2 103 4 merR Mercuric resistance operon regulatory protein (Fragment) Acidithiobacillus ferrooxidans

  • Number of RefSeq hits:

General

Source Morganella morganii S5
Locus tag HKOGLL_13910
Feature type CDS
Gene bltR2
Product GyrI-like small molecule binding domain
Location 82069 - 82926 (strand: -1)
Length 858 (nucleotides) / 285 (amino acids)
In genomic island -

Contig

Accession ZDB_692
Length 124746 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2824
Orthogroup size 6
N. genomes 6

Actions

Genomic region

Domains

PF13411 MerR HTH family regulatory protein

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0789 Transcription (K) K DNA-binding transcriptional regulator, MerR family

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K19575 MerR family transcriptional regulator, activator of bmr gene - -

Protein Sequence

MAKYFSIGEMAKLHKISIQTLRYYDQLGLFRPVYVDQESNYRYYTIDQFSQLDIIKYLKYLGMPLKEIKHRLEDSDTQILSLLTRKISVVDEKIRELELIKKVLSTKKETLEKGIDTDSIGKITRRYIPRRHILSMNYEPGLSFEETMEFSRRHIANILEENISIFYGGVSGLVSREEFLATQQVHYLNSFVIVERDLFNPQVQDKITEIPDGEFICLMYQGSYSENTAAFKALTDYAEYKRIPVDDMMYEIPVIDPLSTNDERQLLTEIQIKVKRREIDTRCLV

Flanking regions ( +/- flanking 50bp)

TTATTGTGCCGCCGGTTAATTCCTGAGACGTTCATCAGAGGCGGCACAATATGGCGAAATATTTTTCCATCGGTGAGATGGCAAAGCTCCATAAAATCAGCATTCAGACACTGCGTTACTATGACCAGCTGGGGCTGTTCCGCCCGGTGTATGTCGATCAGGAAAGTAACTACCGCTATTACACTATCGATCAGTTTTCTCAGCTGGATATTATTAAGTATCTGAAATACCTGGGTATGCCGCTGAAAGAGATCAAACACCGCCTGGAAGACAGCGACACACAAATTCTCAGCCTGCTGACCCGGAAAATTTCCGTGGTGGATGAGAAAATCCGCGAGCTGGAGCTGATTAAAAAAGTCCTCTCCACCAAAAAAGAGACACTGGAAAAAGGGATTGATACCGACAGTATCGGCAAAATCACCCGCCGTTATATTCCGCGCCGTCATATTTTATCGATGAATTATGAGCCCGGTCTGAGCTTTGAGGAGACCATGGAGTTCTCACGGCGGCACATTGCCAATATCCTCGAGGAAAACATTTCTATTTTCTACGGCGGCGTCAGTGGTCTGGTCTCCCGCGAAGAATTTCTGGCCACACAGCAGGTGCATTATCTGAACAGTTTTGTGATTGTCGAGCGCGACCTGTTTAATCCGCAGGTGCAGGACAAAATTACAGAAATTCCCGACGGTGAATTTATCTGCCTGATGTATCAGGGGTCTTACAGCGAAAATACGGCAGCATTTAAAGCGCTGACGGATTATGCGGAATACAAACGCATTCCGGTGGATGACATGATGTATGAAATCCCGGTGATTGACCCGCTTTCCACCAATGATGAGCGCCAGTTGCTGACAGAAATTCAGATCAAAGTGAAACGGCGTGAAATTGATACCCGCTGCCTGGTGTAAAACTCTCCCTCTGCTATAGGTATTAATGCTTTCAATACAGAAACAGGCTG