Homologs in group_1332

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_08240 FBDBKF_08240 100.0 Morganella morganii S1 rffG dTDP-glucose 4,6-dehydratase
EHELCC_13285 EHELCC_13285 100.0 Morganella morganii S2 rffG dTDP-glucose 4,6-dehydratase
NLDBIP_13625 NLDBIP_13625 100.0 Morganella morganii S4 rffG dTDP-glucose 4,6-dehydratase
LHKJJB_12930 LHKJJB_12930 100.0 Morganella morganii S3 rffG dTDP-glucose 4,6-dehydratase
F4V73_RS18790 F4V73_RS18790 95.5 Morganella psychrotolerans rffG dTDP-glucose 4,6-dehydratase
PMI_RS16500 PMI_RS16500 85.4 Proteus mirabilis HI4320 rffG dTDP-glucose 4,6-dehydratase

Distribution of the homologs in the orthogroup group_1332

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1332

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P27830 0.0 610 80 0 353 1 rffG dTDP-glucose 4,6-dehydratase 2 Escherichia coli (strain K12)
P55294 0.0 586 77 0 355 3 rfbB1 dTDP-glucose 4,6-dehydratase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9S642 0.0 558 77 0 336 3 rfbB1 dTDP-glucose 4,6-dehydratase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
P37761 0.0 555 77 0 335 3 rfbB dTDP-glucose 4,6-dehydratase Neisseria gonorrhoeae
P37777 0.0 554 75 2 352 3 rfbB dTDP-glucose 4,6-dehydratase Shigella flexneri
P37759 0.0 545 74 2 352 3 rfbB dTDP-glucose 4,6-dehydratase 1 Escherichia coli (strain K12)
P55293 0.0 536 73 2 352 3 rfbB dTDP-glucose 4,6-dehydratase Escherichia coli
P26391 0.0 534 72 2 352 1 rfbB dTDP-glucose 4,6-dehydratase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q6E7F4 0.0 531 72 1 359 1 rmlB dTDP-glucose 4,6-dehydratase Escherichia coli
P44914 1.82e-165 468 63 0 336 3 rffG dTDP-glucose 4,6-dehydratase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P55462 5.43e-161 457 62 3 351 3 NGR_a03580 Probable dTDP-glucose 4,6-dehydratase Sinorhizobium fredii (strain NBRC 101917 / NGR234)
B0RVL0 1.59e-147 423 59 3 352 3 rfbB dTDP-glucose 4,6-dehydratase Xanthomonas campestris pv. campestris (strain B100)
P0C7J0 1.19e-146 421 58 3 352 3 rfbB dTDP-glucose 4,6-dehydratase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
A0QSK6 6.27e-104 311 48 7 344 1 rmlB dTDP-glucose 4,6-dehydratase Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
P39630 1.39e-102 307 47 3 334 1 rfbB dTDP-glucose 4,6-dehydratase Bacillus subtilis (strain 168)
P95780 1.22e-101 306 46 7 350 1 rmlB dTDP-glucose 4,6-dehydratase Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
P9WN65 1.57e-98 298 47 8 348 1 rmlB dTDP-glucose 4,6-dehydratase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WN64 1.57e-98 298 47 8 348 3 rmlB dTDP-glucose 4,6-dehydratase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q9ZAE8 1.18e-94 287 46 8 343 3 acbB dTDP-glucose 4,6-dehydratase Actinoplanes sp. (strain ATCC 31044 / CBS 674.73 / SE50/110)
Q9L9E8 2.82e-92 282 47 6 341 3 novT dTDP-glucose 4,6-dehydratase Streptomyces niveus
D4GU72 2.79e-91 278 46 6 332 3 agl12 Low-salt glycan biosynthesis protein Agl12 Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
Q9RR28 1.69e-85 265 42 7 345 3 oleE dTDP-glucose 4,6-dehydratase Streptomyces antibioticus
P29782 6.85e-84 260 45 7 338 1 strE dTDP-glucose 4,6-dehydratase Streptomyces griseus
P35675 4.37e-79 242 69 0 163 3 None Uncharacterized protein in galE 3'region (Fragment) Erwinia amylovora
Q9LPG6 4.43e-75 247 38 6 339 1 RHM2 Trifunctional UDP-glucose 4,6-dehydratase/UDP-4-keto-6-deoxy-D-glucose 3,5-epimerase/UDP-4-keto-L-rhamnose-reductase RHM2 Arabidopsis thaliana
Q8VDR7 1.96e-74 237 37 6 344 2 Tgds dTDP-D-glucose 4,6-dehydratase Mus musculus
Q9LH76 1.48e-73 243 39 6 339 2 RHM3 Trifunctional UDP-glucose 4,6-dehydratase/UDP-4-keto-6-deoxy-D-glucose 3,5-epimerase/UDP-4-keto-L-rhamnose-reductase RHM3 Arabidopsis thaliana
Q9SYM5 1.21e-72 241 38 7 343 1 RHM1 Trifunctional UDP-glucose 4,6-dehydratase/UDP-4-keto-6-deoxy-D-glucose 3,5-epimerase/UDP-4-keto-L-rhamnose-reductase RHM1 Arabidopsis thaliana
O95455 2.78e-72 231 35 5 344 1 TGDS dTDP-D-glucose 4,6-dehydratase Homo sapiens
A6QLW2 4.69e-71 228 35 5 344 2 TGDS dTDP-D-glucose 4,6-dehydratase Bos taurus
Q54WS6 5.37e-69 225 32 5 379 3 tgds dTDP-D-glucose 4,6-dehydratase Dictyostelium discoideum
Q5UR12 2.35e-59 197 36 8 333 1 MIMI_R141 Putative dTDP-D-glucose 4,6-dehydratase Acanthamoeba polyphaga mimivirus
Q9HDU4 2.02e-48 170 30 10 357 3 SPBPB2B2.11 Uncharacterized protein PB2B2.11 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
F8C4X8 1.2e-32 127 29 11 339 1 TOPB45_0660 UDP-glucuronate 4-epimerase Thermodesulfobacterium geofontis (strain OPF15)
O06485 5.47e-32 125 26 7 332 3 yfnG Putative sugar dehydratase/epimerase YfnG Bacillus subtilis (strain 168)
Q57664 2.03e-31 123 31 14 335 3 MJ0211 Putative UDP-glucose 4-epimerase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P14169 3.72e-31 123 28 13 361 1 rfbE CDP-paratose 2-epimerase Salmonella typhi
P9WN67 5.14e-30 120 32 10 346 1 galE1 UDP-glucose 4-epimerase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WN66 5.14e-30 120 32 10 346 3 galE1 UDP-glucose 4-epimerase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P39858 6.21e-30 120 26 9 352 3 capI Protein CapI Staphylococcus aureus
A0R5C5 1.66e-28 115 32 11 336 1 MSMEG_6142 UDP-glucose 4-epimerase Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q58455 7.87e-28 114 26 8 351 3 MJ1055 Uncharacterized protein MJ1055 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q9T0A7 1.53e-26 111 30 13 360 1 UGE2 UDP-glucose 4-epimerase 2 Arabidopsis thaliana
Q8VZC0 2.9e-26 112 26 11 336 1 UXS1 UDP-glucuronic acid decarboxylase 1 Arabidopsis thaliana
O34886 3.07e-25 107 30 7 272 3 ytcB Uncharacterized UDP-glucose epimerase YtcB Bacillus subtilis (strain 168)
B9J8R3 3.46e-24 104 25 13 370 1 lpsL UDP-glucuronate 4-epimerase Rhizobium rhizogenes (strain K84 / ATCC BAA-868)
Q9SN58 4.32e-24 104 29 16 364 1 UGE5 UDP-glucose 4-epimerase 5 Arabidopsis thaliana
O54067 1.16e-23 103 26 16 373 3 lspL Probable UDP-glucuronate 4-epimerase Rhizobium meliloti (strain 1021)
Q6DF08 1.22e-23 104 25 11 335 2 uxs1 UDP-glucuronic acid decarboxylase 1 Xenopus tropicalis
Q2SYH7 1.67e-23 103 26 10 367 1 wbiB dTDP-L-rhamnose 4-epimerase Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q04871 2.17e-23 102 25 11 350 3 None Uncharacterized 37.6 kDa protein in cld 5'region Escherichia coli O111:H-
P33119 3.2e-23 101 29 13 334 3 galE UDP-glucose 4-epimerase Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
Q9FIE8 6.15e-23 101 26 8 327 1 UXS3 UDP-glucuronic acid decarboxylase 3 Arabidopsis thaliana
Q5PQX0 7.81e-23 102 24 11 335 1 Uxs1 UDP-glucuronic acid decarboxylase 1 Rattus norvegicus
Q91XL3 8.69e-23 102 24 11 335 1 Uxs1 UDP-glucuronic acid decarboxylase 1 Mus musculus
Q9ZV36 9.18e-23 100 27 11 328 2 UXS6 UDP-glucuronic acid decarboxylase 6 Arabidopsis thaliana
Q5R885 1.01e-22 101 24 11 335 2 UXS1 UDP-glucuronic acid decarboxylase 1 Pongo abelii
Q8NBZ7 1.08e-22 101 24 11 335 1 UXS1 UDP-glucuronic acid decarboxylase 1 Homo sapiens
Q9LZI2 2.86e-22 100 26 11 327 1 UXS2 UDP-glucuronic acid decarboxylase 2 Arabidopsis thaliana
Q9SN95 3.14e-22 99 25 8 327 2 UXS5 UDP-glucuronic acid decarboxylase 5 Arabidopsis thaliana
Q6GMI9 4.8e-22 99 24 10 335 1 uxs1 UDP-glucuronic acid decarboxylase 1 Danio rerio
Q6ZDJ7 5.27e-22 99 29 17 362 2 UGE-2 UDP-glucose 4-epimerase 2 Oryza sativa subsp. japonica
Q8S8T4 7.66e-22 99 26 11 327 2 UXS4 UDP-glucuronic acid decarboxylase 4 Arabidopsis thaliana
Q7WTB1 1.07e-21 97 27 15 351 2 galE UDP-glucose 4-epimerase Lactobacillus helveticus
Q59083 1.59e-21 97 30 14 345 3 exoB UDP-glucose 4-epimerase Azospirillum brasilense
O84903 5.15e-21 95 28 11 351 3 galE UDP-glucose 4-epimerase Lacticaseibacillus casei
Q9KDV3 6.46e-21 95 28 17 349 3 galE UDP-glucose 4-epimerase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q9C7W7 8.77e-21 95 28 14 359 1 UGE4 UDP-glucose 4-epimerase 4 Arabidopsis thaliana
P04397 1.67e-20 96 26 15 364 1 GAL10 Bifunctional protein GAL10 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P55180 3.73e-20 93 26 14 363 3 galE UDP-glucose 4-epimerase Bacillus subtilis (strain 168)
Q04973 4.95e-20 93 27 12 351 3 vipB Vi polysaccharide biosynthesis protein VipB/TviC Salmonella typhi
P13226 6.33e-20 92 28 14 347 3 galE UDP-glucose 4-epimerase Streptomyces lividans
Q8LNZ3 8.37e-20 92 29 20 366 2 UGE-1 UDP-glucose 4-epimerase 1 Oryza sativa subsp. japonica
Q6K2E1 1.05e-19 92 27 14 359 2 UGE-4 UDP-glucose 4-epimerase 4 Oryza sativa subsp. japonica
Q564Q1 2.13e-19 91 26 13 367 1 gale-1 UDP-glucose 4-epimerase Caenorhabditis elegans
P75517 7.55e-19 89 25 11 350 3 galE UDP-glucose 4-epimerase Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q59745 1.05e-18 89 29 12 343 3 exoB UDP-glucose 4-epimerase Rhizobium leguminosarum bv. trifolii
P09609 1.1e-18 90 28 11 295 2 GAL10 Bifunctional protein GAL10 Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
O65781 2.91e-18 88 27 16 372 2 None UDP-glucose 4-epimerase GEPI48 Cyamopsis tetragonoloba
P35673 3.84e-18 87 26 14 354 3 galE UDP-glucose 4-epimerase Erwinia amylovora
P96995 3.85e-18 87 28 13 336 3 galE UDP-glucose 4-epimerase Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q553X7 4.6e-18 87 26 15 357 1 galE UDP-glucose 4-epimerase Dictyostelium discoideum
Q9CNY5 5.55e-18 87 26 13 361 3 galE UDP-glucose 4-epimerase Pasteurella multocida (strain Pm70)
B0M3E8 6.34e-18 87 27 15 362 1 UGE1 Bifunctional UDP-glucose 4-epimerase and UDP-xylose 4-epimerase 1 Pisum sativum
Q6T1X6 1.11e-17 85 27 6 257 1 rmd GDP-6-deoxy-D-mannose reductase Aneurinibacillus thermoaerophilus
P56986 1.31e-17 86 24 13 361 3 galE UDP-glucose 4-epimerase Neisseria meningitidis serogroup C
Q57301 1.61e-17 85 27 15 352 3 galE UDP-glucose 4-epimerase Yersinia enterocolitica
P56985 1.89e-17 85 24 13 361 3 galE UDP-glucose 4-epimerase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
P0AC91 3.15e-17 85 27 11 308 3 gmd GDP-mannose 4,6-dehydratase Shigella flexneri
P0AC88 3.15e-17 85 27 11 308 1 gmd GDP-mannose 4,6-dehydratase Escherichia coli (strain K12)
P0AC89 3.15e-17 85 27 11 308 3 gmd GDP-mannose 4,6-dehydratase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AC90 3.15e-17 85 27 11 308 3 gmd GDP-mannose 4,6-dehydratase Escherichia coli O157:H7
O65780 3.27e-17 85 27 15 361 2 None UDP-glucose 4-epimerase GEPI42 Cyamopsis tetragonoloba
Q45291 4.53e-17 84 27 16 337 3 galE UDP-glucose 4-epimerase Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q43070 5.23e-17 84 26 15 362 2 GALE UDP-glucose 4-epimerase Pisum sativum
Q9F7D4 5.58e-17 84 27 16 357 3 galE UDP-glucose 4-epimerase Yersinia pestis
Q9W0P5 8.51e-17 84 27 18 384 1 Gale UDP-glucose 4-epimerase Drosophila melanogaster
P24325 1.17e-16 83 26 18 364 3 galE UDP-glucose 4-epimerase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P21977 1.42e-16 83 26 12 349 3 galE UDP-glucose 4-epimerase Streptococcus thermophilus
O81312 2.21e-16 83 24 13 348 2 GAE3 UDP-glucuronate 4-epimerase 3 Arabidopsis thaliana
P09147 2.78e-16 82 25 15 354 1 galE UDP-glucose 4-epimerase Escherichia coli (strain K12)
Q9SUN3 2.96e-16 82 26 14 349 2 At4g20460 Probable UDP-arabinose 4-epimerase 3 Arabidopsis thaliana
Q652A8 3.8e-16 82 26 12 359 2 UGE-3 UDP-glucose 4-epimerase 3 Oryza sativa subsp. japonica
Q9LPC1 4.32e-16 82 23 11 347 2 GAE2 UDP-glucuronate 4-epimerase 2 Arabidopsis thaliana
P56997 6.69e-16 81 24 15 363 3 galE UDP-glucose 4-epimerase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q8R059 7.9e-16 80 27 14 359 1 Gale UDP-glucose 4-epimerase Mus musculus
Q42605 8.02e-16 80 24 13 364 1 UGE1 Bifunctional UDP-glucose 4-epimerase and UDP-xylose 4-epimerase 1 Arabidopsis thaliana
Q9M0B6 8.5e-16 81 23 14 358 1 GAE1 UDP-glucuronate 4-epimerase 1 Arabidopsis thaliana
Q9Y7X5 1.15e-15 80 29 8 254 1 uge1 UDP-glucose 4-epimerase uge1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P40801 1.19e-15 81 24 10 373 2 GAL10 Bifunctional protein GAL10 Pachysolen tannophilus
Q56598 1.24e-15 80 27 8 251 3 gmd GDP-mannose 4,6-dehydratase Vibrio cholerae
Q9HDU3 2.57e-15 80 24 12 360 3 gal10 Bifunctional protein gal10 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q56093 2.63e-15 79 25 15 354 3 galE UDP-glucose 4-epimerase Salmonella typhi
Q56872 2.91e-15 79 27 8 252 3 gmd GDP-mannose 4,6-dehydratase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
P26503 3.34e-15 79 29 12 341 3 exoB UDP-glucose 4-epimerase Rhizobium meliloti (strain 1021)
O22141 3.42e-15 79 23 11 348 1 GAE4 UDP-glucuronate 4-epimerase 4 Arabidopsis thaliana
P22715 4.91e-15 78 25 15 354 3 galE UDP-glucose 4-epimerase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q9LIS3 6.25e-15 79 25 13 348 1 GAE6 UDP-glucuronate 4-epimerase 6 Arabidopsis thaliana
Q3T105 1.13e-14 77 27 17 360 2 GALE UDP-glucose 4-epimerase Bos taurus
Q8H0B6 1.14e-14 78 26 12 337 2 UEL-2 Probable UDP-arabinose 4-epimerase 2 Oryza sativa subsp. japonica
Q06952 1.92e-14 77 29 6 202 3 gmd GDP-mannose 4,6-dehydratase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9FI17 2.39e-14 77 27 13 341 3 At5g44480 Putative UDP-arabinose 4-epimerase 4 Arabidopsis thaliana
Q7BJX9 2.51e-14 76 25 11 342 1 wbgU UDP-N-acetylglucosamine 4-epimerase Plesiomonas shigelloides
Q67WR2 3.84e-14 75 22 14 349 2 Os06g0652400 Probable GDP-L-fucose synthase 1 Oryza sativa subsp. japonica
Q8H930 7.08e-14 75 27 16 370 2 UEL-1 Probable UDP-arabinose 4-epimerase 1 Oryza sativa subsp. japonica
P55353 7.14e-14 75 21 11 348 3 fcl GDP-L-fucose synthase Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q9SNY3 7.7e-14 75 24 9 347 1 GMD1 GDP-mannose 4,6 dehydratase 1 Arabidopsis thaliana
Q9HTB6 9.93e-14 74 24 12 336 1 rmd GDP-6-deoxy-D-mannose reductase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8LDN8 1.11e-13 74 23 13 358 1 UGE3 Bifunctional UDP-glucose 4-epimerase and UDP-xylose 4-epimerase 3 Arabidopsis thaliana
Q59678 1.44e-13 74 25 17 364 3 galE UDP-glucose 4-epimerase Mannheimia haemolytica
A0A1B4XBH2 2.7e-13 74 26 7 283 3 sdnI GDP-mannose 4,6-dehydratase sdnI Sordaria araneosa
Q14376 2.73e-13 73 28 13 297 1 GALE UDP-glucose 4-epimerase Homo sapiens
Q9VMW9 3.16e-13 73 24 12 341 1 Gmd GDP-mannose 4,6 dehydratase Drosophila melanogaster
P47364 3.82e-13 73 24 11 285 3 galE UDP-glucose 4-epimerase Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q5R8D0 4.91e-13 72 26 15 358 2 GALE UDP-glucose 4-epimerase Pongo abelii
P93031 1.35e-12 71 25 9 278 1 MUR1 GDP-mannose 4,6 dehydratase 2 Arabidopsis thaliana
P55354 1.47e-12 71 28 6 203 3 gmd GDP-mannose 4,6-dehydratase Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P18645 2.05e-12 70 26 15 356 2 Gale UDP-glucose 4-epimerase Rattus norvegicus
Q9STI6 2.49e-12 71 23 10 348 2 GAE5 UDP-glucuronate 4-epimerase 5 Arabidopsis thaliana
E8MF10 3.27e-12 70 26 16 367 1 lnpD UDP-glucose 4-epimerase Bifidobacterium longum subsp. longum (strain ATCC 15707 / DSM 20219 / JCM 1217 / NCTC 11818 / E194b)
Q9JRN7 3.96e-12 69 24 8 267 1 tld GDP-6-deoxy-D-talose 4-dehydrogenase Aggregatibacter actinomycetemcomitans
O85713 9.31e-12 68 28 6 203 3 gmd GDP-mannose 4,6-dehydratase Rhizobium fredii (strain HH103)
Q8K3X3 3.13e-11 67 23 9 288 2 GMDS GDP-mannose 4,6 dehydratase Cricetulus griseus
Q9SA77 3.97e-11 67 25 18 366 1 MUR4 UDP-arabinose 4-epimerase 1 Arabidopsis thaliana
Q9JRN5 4.05e-11 67 23 13 349 1 gmd GDP-mannose 4,6-dehydratase Aggregatibacter actinomycetemcomitans
Q8H0B2 4.07e-11 67 26 15 345 2 UEL-3 Probable UDP-arabinose 4-epimerase 3 Oryza sativa subsp. japonica
Q8K0C9 4.24e-11 67 23 9 288 1 Gmds GDP-mannose 4,6 dehydratase Mus musculus
Q51366 6.68e-11 66 24 9 281 1 gmd GDP-mannose 4,6-dehydratase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q18801 6.93e-11 66 25 12 298 1 bre-1 GDP-mannose 4,6 dehydratase 1 Caenorhabditis elegans
Q67WR5 9.32e-11 65 23 10 347 3 Os06g0652300 Putative GDP-L-fucose synthase 2 Oryza sativa subsp. japonica
O60547 9.37e-11 66 23 9 287 1 GMDS GDP-mannose 4,6 dehydratase Homo sapiens
A0A0U3AP28 1.1e-10 65 23 9 262 1 HS5.17 CDP-6-D-glucitol synthase Campylobacter jejuni
Q9LMU0 1.44e-10 65 22 15 351 1 GER2 Putative GDP-L-fucose synthase 2 Arabidopsis thaliana
O45583 1.58e-10 65 27 6 190 1 gmd-2 GDP-mannose 4,6 dehydratase 2 Caenorhabditis elegans
O64749 1.65e-10 65 29 6 177 2 At2g34850 Putative UDP-arabinose 4-epimerase 2 Arabidopsis thaliana
A8Y0L5 1.81e-10 65 27 6 196 3 CBG21737 GDP-mannose 4,6 dehydratase 1 Caenorhabditis briggsae
Q84KI6 3.12e-10 64 25 13 298 1 SQD1 UDP-sulfoquinovose synthase, chloroplastic Spinacia oleracea
P26397 3.33e-10 64 24 14 351 1 rfbG CDP-glucose 4,6-dehydratase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q05026 4.3e-10 63 26 9 250 3 galE UDP-glucose 4-epimerase Neisseria gonorrhoeae
O49213 1.97e-09 61 22 15 349 1 GER1 GDP-L-fucose synthase 1 Arabidopsis thaliana
Q1ZXF7 2.79e-09 61 25 6 205 1 gmd GDP-mannose 4,6 dehydratase Dictyostelium discoideum
P32055 4.23e-09 60 21 11 351 1 fcl GDP-L-fucose synthase Escherichia coli (strain K12)
O48917 4.96e-09 61 25 13 298 1 SQD1 UDP-sulfoquinovose synthase, chloroplastic Arabidopsis thaliana
A9ADU8 5.13e-09 60 25 14 353 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Burkholderia multivorans (strain ATCC 17616 / 249)
C4K8I6 8.45e-09 59 26 19 341 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Hamiltonella defensa subsp. Acyrthosiphon pisum (strain 5AT)
A4JCI2 9.71e-09 59 25 14 352 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Burkholderia vietnamiensis (strain G4 / LMG 22486)
Q56623 1.07e-08 59 23 12 342 3 galE UDP-glucose 4-epimerase Vibrio cholerae
Q72ET7 1.08e-08 59 27 11 272 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
B2JF12 1.14e-08 59 24 13 352 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
Q6E7F2 1.71e-08 58 23 12 331 1 fcf1 dTDP-4-dehydro-6-deoxyglucose reductase Escherichia coli
Q2SY18 1.87e-08 58 24 13 352 1 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q0BH85 2.12e-08 58 24 14 352 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q0P9D4 2.26e-08 59 29 3 140 1 pglF UDP-N-acetyl-alpha-D-glucosamine C6 dehydratase Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q1BY20 2.48e-08 58 24 14 353 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Burkholderia orbicola (strain AU 1054)
B1JXS7 2.48e-08 58 24 14 353 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Burkholderia orbicola (strain MC0-3)
A0K5M9 2.48e-08 58 24 14 353 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Burkholderia cenocepacia (strain HI2424)
B1YV41 2.57e-08 58 24 14 352 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Burkholderia ambifaria (strain MC40-6)
Q39IF3 2.89e-08 58 24 14 353 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
B4EB34 2.97e-08 58 24 14 353 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
A1VGB0 4.21e-08 57 26 11 272 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Nitratidesulfovibrio vulgaris (strain DP4)
I1WGR6 4.39e-08 57 24 13 352 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Burkholderia pseudomallei (strain 1026b)
A3NC24 1.17e-07 56 24 13 352 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Burkholderia pseudomallei (strain 668)
Q3JPY8 1.17e-07 56 24 13 352 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Burkholderia pseudomallei (strain 1710b)
A3NXW3 1.17e-07 56 24 13 352 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Burkholderia pseudomallei (strain 1106a)
A1V6L4 1.17e-07 56 24 13 352 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Burkholderia mallei (strain SAVP1)
Q62M34 1.17e-07 56 24 13 352 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Burkholderia mallei (strain ATCC 23344)
A2S4R1 1.17e-07 56 24 13 352 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Burkholderia mallei (strain NCTC 10229)
A3MHP7 1.17e-07 56 24 13 352 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Burkholderia mallei (strain NCTC 10247)
Q5SFA6 1.73e-07 55 21 11 342 1 chmD dTDP-4-dehydro-6-deoxy-D-allose reductase Streptomyces bikiniensis
A3QJB2 1.78e-07 55 24 7 265 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Shewanella loihica (strain ATCC BAA-1088 / PV-4)
Q331Q7 1.79e-07 55 21 11 342 1 gerKI dTDP-4-dehydro-6-deoxy-D-allose reductase Streptomyces sp.
P0DMK5 2.39e-07 55 24 13 351 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Burkholderia pseudomallei (strain K96243)
P56600 2.49e-07 53 30 4 139 3 GAL10 Bifunctional protein GAL10 (Fragment) Candida maltosa
G4WJD3 2.57e-07 55 20 15 350 1 colC GDP-L-colitose synthase Yersinia pseudotuberculosis
Q47GJ3 2.66e-07 55 25 15 356 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Dechloromonas aromatica (strain RCB)
Q13VD0 1.44e-06 53 23 10 309 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Paraburkholderia xenovorans (strain LB400)
A2Z7B3 2.14e-06 52 22 13 345 2 OsI_032456 GDP-mannose 3,5-epimerase 1 Oryza sativa subsp. indica
P45602 2.77e-06 49 28 5 141 3 galE UDP-glucose 4-epimerase (Fragment) Klebsiella pneumoniae
Q3A8K5 3.2e-06 52 27 11 263 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
Q7N3Q7 3.25e-06 52 23 14 358 3 arnA Bifunctional polymyxin resistance protein ArnA Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A3C4S4 3.46e-06 52 22 13 345 1 GME-1 GDP-mannose 3,5-epimerase 1 Oryza sativa subsp. japonica
P0A1P4 3.81e-06 51 19 10 336 1 rfbJ CDP-abequose synthase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
O66251 3.82e-06 51 22 6 254 1 rmlD dTDP-4-dehydrorhamnose reductase Aggregatibacter actinomycetemcomitans
Q13630 3.92e-06 51 22 11 352 1 GFUS GDP-L-fucose synthase Homo sapiens
B2T625 4.4e-06 51 23 11 309 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
P39631 4.41e-06 51 24 7 204 3 spsK Spore coat polysaccharide biosynthesis protein SpsK Bacillus subtilis (strain 168)
Q49VA1 4.81e-06 51 25 6 199 3 SSP2164 Uncharacterized epimerase/dehydratase SSP2164 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
A1JPN5 5.89e-06 52 22 14 356 3 arnA Bifunctional polymyxin resistance protein ArnA Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
C0QZ84 6.03e-06 51 22 8 273 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Brachyspira hyodysenteriae (strain ATCC 49526 / WA1)
Q6D2F1 6.5e-06 51 24 10 276 3 arnA Bifunctional polymyxin resistance protein ArnA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
C6DAW5 6.79e-06 51 24 10 276 3 arnA Bifunctional polymyxin resistance protein ArnA Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q8K3X2 9.32e-06 50 23 13 357 2 GFUS GDP-L-fucose synthase Cricetulus griseus
Q58461 9.97e-06 50 30 5 142 3 MJ1061 Uncharacterized membrane protein MJ1061 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P39853 1.49e-05 50 22 13 351 3 capD Capsular polysaccharide biosynthesis protein CapD Staphylococcus aureus
Q5HIC2 1.88e-05 49 23 11 286 3 SACOL0599 Uncharacterized epimerase/dehydratase SACOL0599 Staphylococcus aureus (strain COL)
Q99W56 1.88e-05 49 23 11 286 3 SAV0553 Uncharacterized epimerase/dehydratase SAV0553 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q2FJ87 1.88e-05 49 23 11 286 3 SAUSA300_0538 Uncharacterized epimerase/dehydratase SAUSA300_0538 Staphylococcus aureus (strain USA300)
Q2G0M5 1.88e-05 49 23 11 286 3 SAOUHSC_00535 Uncharacterized epimerase/dehydratase SAOUHSC_00535 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q6GBT4 1.88e-05 49 23 11 286 3 SAS0511 Uncharacterized epimerase/dehydratase SAS0511 Staphylococcus aureus (strain MSSA476)
Q7A788 1.88e-05 49 23 11 286 1 SA0511 Uncharacterized epimerase/dehydratase SA0511 Staphylococcus aureus (strain N315)
Q7A1Q7 1.88e-05 49 23 11 286 3 MW0508 Uncharacterized epimerase/dehydratase MW0508 Staphylococcus aureus (strain MW2)
Q0A4T8 2.14e-05 49 26 8 263 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
B5XTK9 2.3e-05 50 21 12 355 3 arnA Bifunctional polymyxin resistance protein ArnA Klebsiella pneumoniae (strain 342)
P55579 2.3e-05 49 22 14 362 3 NGR_a02350 Uncharacterized protein y4nG Sinorhizobium fredii (strain NBRC 101917 / NGR234)
A8FRR2 2.76e-05 49 23 11 298 3 arnA Bifunctional polymyxin resistance protein ArnA Shewanella sediminis (strain HAW-EB3)
Q7CRQ0 3e-05 48 28 10 197 1 udh Uronate dehydrogenase Agrobacterium fabrum (strain C58 / ATCC 33970)
Q4KC82 3.05e-05 49 23 14 357 3 arnA Bifunctional polymyxin resistance protein ArnA Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
C0Q069 5.15e-05 48 21 10 357 3 arnA Bifunctional polymyxin resistance protein ArnA Salmonella paratyphi C (strain RKS4594)
B5FNT9 5.38e-05 48 21 10 357 3 arnA Bifunctional polymyxin resistance protein ArnA Salmonella dublin (strain CT_02021853)
B4SYX1 5.43e-05 48 21 10 357 3 arnA Bifunctional polymyxin resistance protein ArnA Salmonella newport (strain SL254)
Q2YSA8 5.88e-05 48 25 8 195 3 SAB0504 Uncharacterized epimerase/dehydratase SAB0504 Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q6GJB5 6.09e-05 48 25 8 197 3 SAR0558 Uncharacterized epimerase/dehydratase SAR0558 Staphylococcus aureus (strain MRSA252)
B4TBG6 6.31e-05 48 21 10 357 3 arnA Bifunctional polymyxin resistance protein ArnA Salmonella heidelberg (strain SL476)
Q4L3L8 6.31e-05 48 25 8 197 3 SH2450 Uncharacterized epimerase/dehydratase SH2450 Staphylococcus haemolyticus (strain JCSC1435)
O52325 6.42e-05 48 21 10 357 1 arnA Bifunctional polymyxin resistance protein ArnA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A9N5B2 6.65e-05 48 21 10 357 3 arnA Bifunctional polymyxin resistance protein ArnA Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B8CVJ3 7.07e-05 47 22 7 268 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Shewanella piezotolerans (strain WP3 / JCM 13877)
B5R272 7.13e-05 48 21 10 357 3 arnA Bifunctional polymyxin resistance protein ArnA Salmonella enteritidis PT4 (strain P125109)
B5EZH8 7.58e-05 48 21 10 357 3 arnA Bifunctional polymyxin resistance protein ArnA Salmonella agona (strain SL483)
Q02R25 7.86e-05 48 23 14 366 3 arnA Bifunctional polymyxin resistance protein ArnA Pseudomonas aeruginosa (strain UCBPP-PA14)
Q12CM2 8.1e-05 47 27 11 247 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Polaromonas sp. (strain JS666 / ATCC BAA-500)
P23591 0.000105 47 22 11 352 1 Gfus GDP-L-fucose synthase Mus musculus
B1JJ30 0.000114 47 21 14 356 3 arnA Bifunctional polymyxin resistance protein ArnA Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q93PD8 0.000114 47 21 14 356 2 arnA Bifunctional polymyxin resistance protein ArnA Yersinia pseudotuberculosis serotype I (strain IP32953)
B2K5L3 0.000114 47 21 14 356 3 arnA Bifunctional polymyxin resistance protein ArnA Yersinia pseudotuberculosis serotype IB (strain PB1/+)
A7FHH4 0.000114 47 21 14 356 3 arnA Bifunctional polymyxin resistance protein ArnA Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
I1S4E7 0.000114 47 27 8 176 3 ERG26 Sterol-4-alpha-carboxylate 3-dehydrogenase ERG26, decarboxylating Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
Q9CL97 0.000127 47 25 9 272 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Pasteurella multocida (strain Pm70)
B4ETL7 0.000128 47 22 14 358 3 arnA Bifunctional polymyxin resistance protein ArnA Proteus mirabilis (strain HI4320)
A6TF98 0.000128 47 21 12 355 3 arnA Bifunctional polymyxin resistance protein ArnA Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
P0C0R6 0.000131 47 21 10 357 3 arnA Bifunctional polymyxin resistance protein ArnA Salmonella choleraesuis (strain SC-B67)
A6V291 0.000145 47 25 10 297 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Pseudomonas aeruginosa (strain PA7)
Q9ZUY6 0.000152 47 22 16 374 1 AXS1 UDP-D-apiose/UDP-D-xylose synthase 1 Arabidopsis thaliana
Q5RBE5 0.000158 46 22 11 352 2 GFUS GDP-L-fucose synthase Pongo abelii
A1KBH4 0.000161 46 26 10 271 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Azoarcus sp. (strain BH72)
Q8PDW5 0.000163 46 28 7 176 1 oleD 2-alkyl-3-oxoalkanoate reductase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
A4TIM4 0.000185 47 21 14 356 3 arnA Bifunctional polymyxin resistance protein ArnA Yersinia pestis (strain Pestoides F)
Q1CIH7 0.000185 47 21 14 356 3 arnA Bifunctional polymyxin resistance protein ArnA Yersinia pestis bv. Antiqua (strain Nepal516)
A9R093 0.000185 47 21 14 356 3 arnA Bifunctional polymyxin resistance protein ArnA Yersinia pestis bv. Antiqua (strain Angola)
Q8ZDX8 0.000185 47 21 14 356 3 arnA Bifunctional polymyxin resistance protein ArnA Yersinia pestis
Q1C742 0.000185 47 21 14 356 3 arnA Bifunctional polymyxin resistance protein ArnA Yersinia pestis bv. Antiqua (strain Antiqua)
Q55C77 0.000204 46 21 16 362 1 ger GDP-L-fucose synthase Dictyostelium discoideum
D4GU71 0.000208 46 32 8 168 3 agl14 Probable low-salt glycan biosynthesis reductase Agl14 Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
Q2NRV7 0.000212 47 21 12 356 3 arnA Bifunctional polymyxin resistance protein ArnA Sodalis glossinidius (strain morsitans)
A8GDR7 0.000223 47 21 14 356 3 arnA Bifunctional polymyxin resistance protein ArnA Serratia proteamaculans (strain 568)
A4WAM3 0.000229 46 21 12 355 3 arnA Bifunctional polymyxin resistance protein ArnA Enterobacter sp. (strain 638)
C3KAD2 0.000244 46 23 15 356 3 arnA Bifunctional polymyxin resistance protein ArnA Pseudomonas fluorescens (strain SBW25)
Q8CQ79 0.00027 45 24 7 194 3 SE_0317 Uncharacterized epimerase/dehydratase SE_0317 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HRJ9 0.00027 45 24 7 194 3 SERP0194 Uncharacterized epimerase/dehydratase SERP0194 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P71052 0.000278 46 28 1 114 3 epsC Probable polysaccharide biosynthesis protein EpsC Bacillus subtilis (strain 168)
B5RCC4 0.000317 46 21 10 357 3 arnA Bifunctional polymyxin resistance protein ArnA Salmonella gallinarum (strain 287/91 / NCTC 13346)
B7MXT6 0.000331 46 21 11 352 3 arnA Bifunctional polymyxin resistance protein ArnA Escherichia coli O81 (strain ED1a)
Q1LQG2 0.000341 45 23 15 355 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q1R9G0 0.000349 46 21 11 352 3 arnA Bifunctional polymyxin resistance protein ArnA Escherichia coli (strain UTI89 / UPEC)
A1ADA7 0.000349 46 21 11 352 3 arnA Bifunctional polymyxin resistance protein ArnA Escherichia coli O1:K1 / APEC
B7MG22 0.000349 46 21 11 352 3 arnA Bifunctional polymyxin resistance protein ArnA Escherichia coli O45:K1 (strain S88 / ExPEC)
B7N5M0 0.000442 45 21 12 355 3 arnA Bifunctional polymyxin resistance protein ArnA Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q8FFM1 0.000442 45 21 11 352 3 arnA Bifunctional polymyxin resistance protein ArnA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q3KCC1 0.000464 45 23 15 357 3 arnA Bifunctional polymyxin resistance protein ArnA Pseudomonas fluorescens (strain Pf0-1)
B2TW38 0.000469 45 22 9 296 5 arnA Putative bifunctional polymyxin resistance protein ArnA Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q5P2S1 0.000475 45 25 8 262 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
B7NNT4 0.000504 45 22 8 293 3 arnA Bifunctional polymyxin resistance protein ArnA Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7LM76 0.00055 45 21 12 355 3 arnA Bifunctional polymyxin resistance protein ArnA Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
A4SQW9 0.000551 45 22 15 366 3 arnA Bifunctional polymyxin resistance protein ArnA Aeromonas salmonicida (strain A449)
Q32DT3 0.000555 45 21 12 355 3 arnA Bifunctional polymyxin resistance protein ArnA Shigella dysenteriae serotype 1 (strain Sd197)
Q3YZV1 0.00056 45 21 11 352 3 arnA Bifunctional polymyxin resistance protein ArnA Shigella sonnei (strain Ss046)
P77398 0.00058 45 21 11 352 1 arnA Bifunctional polymyxin resistance protein ArnA Escherichia coli (strain K12)
B1IXT2 0.00058 45 21 11 352 3 arnA Bifunctional polymyxin resistance protein ArnA Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
B1X8W8 0.00058 45 21 11 352 3 arnA Bifunctional polymyxin resistance protein ArnA Escherichia coli (strain K12 / DH10B)
C4ZU97 0.00058 45 21 11 352 3 arnA Bifunctional polymyxin resistance protein ArnA Escherichia coli (strain K12 / MC4100 / BW2952)
B4TPI2 0.00059 45 21 10 357 3 arnA Bifunctional polymyxin resistance protein ArnA Salmonella schwarzengrund (strain CVM19633)
B1LLK9 0.00059 45 21 12 355 3 arnA Bifunctional polymyxin resistance protein ArnA Escherichia coli (strain SMS-3-5 / SECEC)
B7UFR7 0.000601 45 22 8 293 3 arnA Bifunctional polymyxin resistance protein ArnA Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q5R4E0 0.000641 45 25 4 170 2 MAT2B Methionine adenosyltransferase 2 subunit beta Pongo abelii
Q9NZL9 0.000641 45 25 4 170 1 MAT2B Methionine adenosyltransferase 2 subunit beta Homo sapiens
B6I7J8 0.000644 45 22 8 293 3 arnA Bifunctional polymyxin resistance protein ArnA Escherichia coli (strain SE11)
B7M5T7 0.000644 45 22 8 293 3 arnA Bifunctional polymyxin resistance protein ArnA Escherichia coli O8 (strain IAI1)
B7LAS0 0.000644 45 22 8 293 3 arnA Bifunctional polymyxin resistance protein ArnA Escherichia coli (strain 55989 / EAEC)
A7ZP73 0.000644 45 22 8 293 3 arnA Bifunctional polymyxin resistance protein ArnA Escherichia coli O139:H28 (strain E24377A / ETEC)
Q31YK2 0.000662 45 21 11 352 3 arnA Bifunctional polymyxin resistance protein ArnA Shigella boydii serotype 4 (strain Sb227)
A8A2C2 0.000673 45 21 11 352 3 arnA Bifunctional polymyxin resistance protein ArnA Escherichia coli O9:H4 (strain HS)
Q8Z540 0.000685 45 21 10 357 3 arnA Bifunctional polymyxin resistance protein ArnA Salmonella typhi
B5BCP6 0.000685 45 21 10 357 3 arnA Bifunctional polymyxin resistance protein ArnA Salmonella paratyphi A (strain AKU_12601)
Q5PNA6 0.000685 45 21 10 357 3 arnA Bifunctional polymyxin resistance protein ArnA Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B5YXP8 0.000691 45 22 8 293 3 arnA Bifunctional polymyxin resistance protein ArnA Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8XDZ3 0.000691 45 22 8 293 3 arnA Bifunctional polymyxin resistance protein ArnA Escherichia coli O157:H7
Q0T2M8 0.000722 45 21 12 355 3 arnA Bifunctional polymyxin resistance protein ArnA Shigella flexneri serotype 5b (strain 8401)
Q9NAR7 0.000763 44 23 1 101 2 ADH Alcohol dehydrogenase Bactrocera oleae
A1TYR6 0.000842 44 24 8 276 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q83QT8 0.000853 45 21 12 355 3 arnA Bifunctional polymyxin resistance protein ArnA Shigella flexneri
B2VBI9 0.001 45 22 15 358 3 arnA Bifunctional polymyxin resistance protein ArnA Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)

  • Number of RefSeq hits:

General

Source Morganella morganii S5
Locus tag HKOGLL_12100
Feature type CDS
Gene rffG
Product dTDP-glucose 4,6-dehydratase
Location 136258 - 137331 (strand: -1)
Length 1074 (nucleotides) / 357 (amino acids)

Contig

Accession ZDB_689
Length 162442 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1332
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF16363 GDP-mannose 4,6 dehydratase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1088 Cell wall/membrane/envelope biogenesis (M) M dTDP-D-glucose 4,6-dehydratase

Kegg Ortholog Annotation(s)

Virulence factor Annotation(s)

VF gene ID Protein VF ID Category
VFG007659 dTDP-glucose 4,6-dehydratase VF0624 Immune modulation

Protein Sequence

MKRILVTGGAGFIGSAVVRHIIRDTADSVVVVDKLTYAGNLESLAPVAADPRYAFEQVDICDRAALDRVFAQYQPDAVMHLAAESHVDRSIDGPAAFIETNIVGTYTLLEAARHYWTALDAEKKSAFRFHHISTDEVYGDLEGPDGFFTETTPYAPSSPYSASKASSDHLVRAWQRTYGFPSVITNCSNNYGPYHFPEKLIPLVILNAISGKPLPVYGKGEQIRDWLFVDDHARALYTVVTQANIGETYNIGGHNERKNIQVVETICELLEELHPQKPAGVAQYRDLITYVTDRPGHDLRYAIDADKIERDLGWRPQETFESGIRKTVEWYLNNETWWRRVQDGSYAGQRLGLGQDK

Flanking regions ( +/- flanking 50bp)

GGCAGCCAGATCCCGCAGAAATGGATCATCGATACCAAAGGAGTATGGCGTTGAAACGTATTTTAGTGACAGGCGGAGCCGGTTTTATCGGCTCTGCGGTTGTTCGTCATATTATCCGTGATACTGCTGACAGTGTGGTGGTGGTGGATAAACTGACCTACGCCGGTAACCTCGAATCACTGGCACCGGTGGCGGCTGACCCGCGCTATGCCTTTGAACAGGTAGATATCTGTGACCGCGCGGCGCTTGACCGCGTGTTCGCACAGTATCAGCCGGATGCAGTGATGCATCTGGCGGCGGAAAGTCATGTTGATCGCTCCATCGACGGCCCGGCGGCGTTTATCGAAACCAACATTGTGGGCACTTACACACTGCTGGAAGCTGCGCGCCATTACTGGACGGCACTGGATGCGGAGAAAAAATCCGCATTCCGTTTCCACCATATTTCCACCGACGAAGTTTACGGTGACCTCGAAGGGCCTGACGGCTTTTTCACAGAAACCACACCGTATGCACCGAGCAGCCCGTACTCTGCCTCCAAAGCCTCCAGTGACCATCTGGTACGCGCCTGGCAGCGGACTTACGGCTTCCCGTCTGTGATCACCAATTGCTCAAATAACTACGGGCCGTACCACTTCCCGGAAAAACTGATCCCGCTGGTGATTCTCAATGCGATTTCCGGCAAACCACTGCCGGTTTACGGTAAAGGTGAGCAGATCCGCGACTGGCTGTTTGTCGATGACCATGCCCGCGCCCTGTATACCGTGGTGACACAGGCAAATATCGGTGAAACCTACAATATCGGCGGCCATAACGAGCGCAAAAATATTCAGGTGGTGGAAACTATCTGTGAGTTGCTCGAAGAGCTGCATCCGCAGAAACCGGCCGGTGTCGCGCAATACCGTGACCTTATCACCTATGTGACAGACCGCCCGGGCCATGATCTGCGTTATGCGATTGATGCGGACAAAATTGAGCGCGACCTGGGCTGGCGCCCGCAGGAAACGTTTGAGTCCGGTATCCGCAAAACTGTGGAATGGTATCTGAATAATGAAACCTGGTGGCGCCGGGTGCAGGACGGCTCGTATGCCGGACAGCGTCTGGGACTGGGTCAGGATAAGTAAGAGGCTGGTATGAAAGGAATTATTCTGGCGGGCGGCTCCGGAACCCGGTT