Homologs in group_1414

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_08415 FBDBKF_08415 100.0 Morganella morganii S1 rsgA small ribosomal subunit biogenesis GTPase RsgA
EHELCC_13110 EHELCC_13110 100.0 Morganella morganii S2 rsgA small ribosomal subunit biogenesis GTPase RsgA
NLDBIP_13450 NLDBIP_13450 100.0 Morganella morganii S4 rsgA small ribosomal subunit biogenesis GTPase RsgA
LHKJJB_13105 LHKJJB_13105 100.0 Morganella morganii S3 rsgA small ribosomal subunit biogenesis GTPase RsgA
F4V73_RS09625 F4V73_RS09625 86.2 Morganella psychrotolerans rsgA small ribosomal subunit biogenesis GTPase RsgA
PMI_RS16690 PMI_RS16690 76.4 Proteus mirabilis HI4320 rsgA small ribosomal subunit biogenesis GTPase RsgA

Distribution of the homologs in the orthogroup group_1414

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1414

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q7MYS7 0.0 572 78 2 347 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
B4F1Z6 0.0 546 76 2 348 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Proteus mirabilis (strain HI4320)
A1JIQ7 0.0 544 76 1 349 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
B1JMP8 0.0 538 75 1 349 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66FC3 0.0 538 75 1 349 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TRP7 0.0 538 75 1 349 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Yersinia pestis (strain Pestoides F)
Q1CEE7 0.0 538 75 1 349 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Yersinia pestis bv. Antiqua (strain Nepal516)
A9QYN9 0.0 538 75 1 349 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Yersinia pestis bv. Antiqua (strain Angola)
Q8ZIX0 0.0 538 75 1 349 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Yersinia pestis
B2K1Z6 0.0 538 75 1 349 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C0Z2 0.0 538 75 1 349 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Yersinia pestis bv. Antiqua (strain Antiqua)
A7FMY8 0.0 538 75 1 349 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q8Z193 0.0 536 74 1 350 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Salmonella typhi
Q8ZKB0 0.0 535 74 1 350 1 rsgA Small ribosomal subunit biogenesis GTPase RsgA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A9N420 0.0 535 74 1 350 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4T2Q8 0.0 535 74 1 350 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Salmonella newport (strain SL254)
B4TF97 0.0 535 74 1 350 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Salmonella heidelberg (strain SL476)
B5F378 0.0 535 74 1 350 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Salmonella agona (strain SL483)
B7NG98 0.0 535 74 1 350 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q8FAL3 0.0 535 74 1 350 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
B7MSX6 0.0 535 74 1 350 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Escherichia coli O81 (strain ED1a)
B7NTM0 0.0 535 74 1 350 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7MKW8 0.0 535 74 1 350 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UPY1 0.0 535 74 1 350 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q83IK0 0.0 534 74 1 350 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Shigella flexneri
B1LQI4 0.0 534 74 1 350 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Escherichia coli (strain SMS-3-5 / SECEC)
B2TY39 0.0 533 74 1 350 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B6I268 0.0 533 74 1 350 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Escherichia coli (strain SE11)
A8A7Q8 0.0 533 74 1 350 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Escherichia coli O9:H4 (strain HS)
B5Z2H0 0.0 533 74 1 350 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8XDP1 0.0 533 74 1 350 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Escherichia coli O157:H7
B7LC22 0.0 533 74 1 350 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Escherichia coli (strain 55989 / EAEC)
A7ZV32 0.0 533 74 1 350 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Escherichia coli O139:H28 (strain E24377A / ETEC)
B4TSE3 0.0 533 74 1 350 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Salmonella schwarzengrund (strain CVM19633)
P39286 0.0 533 73 1 350 1 rsgA Small ribosomal subunit biogenesis GTPase RsgA Escherichia coli (strain K12)
B1IT42 0.0 533 73 1 350 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
B1XDR5 0.0 533 73 1 350 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Escherichia coli (strain K12 / DH10B)
C5A1F5 0.0 533 73 1 350 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Escherichia coli (strain K12 / MC4100 / BW2952)
A8G8U1 0.0 533 75 3 347 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Serratia proteamaculans (strain 568)
B5R024 0.0 532 74 1 350 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Salmonella enteritidis PT4 (strain P125109)
B5FRL9 0.0 532 74 1 350 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Salmonella dublin (strain CT_02021853)
B7LLU5 0.0 532 73 1 350 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B7M8S4 0.0 531 73 1 350 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Escherichia coli O8 (strain IAI1)
Q9EV05 0.0 525 72 3 351 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Dickeya dadantii (strain 3937)
B5Y341 0.0 519 72 3 353 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Klebsiella pneumoniae (strain 342)
A6TH78 0.0 518 72 3 353 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B2VCV1 1.79e-180 506 72 4 352 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
C6DFN0 1.05e-176 496 72 3 347 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q2NW87 1.07e-173 489 69 3 347 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Sodalis glossinidius (strain morsitans)
Q6D036 1.48e-173 489 72 3 347 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q7MGZ6 7.53e-156 444 61 4 345 3 rsgA1 Small ribosomal subunit biogenesis GTPase RsgA 1 Vibrio vulnificus (strain YJ016)
Q8DCV7 7.53e-156 444 61 4 345 3 rsgA1 Small ribosomal subunit biogenesis GTPase RsgA 1 Vibrio vulnificus (strain CMCP6)
Q87L00 5.94e-154 439 61 4 346 3 rsgA1 Small ribosomal subunit biogenesis GTPase RsgA 1 Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q9KV18 9.86e-154 440 62 3 345 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P45339 6.1e-151 431 57 3 347 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A5UBG2 2.42e-150 430 57 3 347 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Haemophilus influenzae (strain PittEE)
Q4QJM9 1.25e-149 428 56 3 347 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Haemophilus influenzae (strain 86-028NP)
A5UFF1 1.91e-149 427 56 3 347 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Haemophilus influenzae (strain PittGG)
C4K3T8 3.58e-148 424 63 2 342 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Hamiltonella defensa subsp. Acyrthosiphon pisum (strain 5AT)
Q8EJ79 2.06e-145 417 56 3 354 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
B0BS35 4.96e-144 414 56 4 350 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
B3GZX2 4.96e-144 414 56 4 350 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
A3MYK2 4.96e-144 414 56 4 350 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Actinobacillus pleuropneumoniae serotype 5b (strain L20)
Q7VMF1 2.91e-142 409 55 3 344 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Haemophilus ducreyi (strain 35000HP / ATCC 700724)
A6VN14 3.09e-140 404 54 4 351 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
Q9CMD1 7.73e-137 395 52 3 351 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Pasteurella multocida (strain Pm70)
B0UT89 3.1e-134 389 52 3 352 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Histophilus somni (strain 2336)
Q0I447 5.66e-134 388 52 3 352 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Histophilus somni (strain 129Pt)
Q65SE2 3.33e-131 381 51 3 349 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q2SBB3 3.4e-105 315 47 5 347 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Hahella chejuensis (strain KCTC 2396)
B1JAE3 7.45e-105 314 48 5 347 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Pseudomonas putida (strain W619)
Q1I439 9.99e-105 313 47 5 347 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Pseudomonas entomophila (strain L48)
Q0VMD9 6.85e-104 312 45 5 346 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q48P11 1.33e-103 311 47 5 347 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
C3KDV4 1.44e-103 311 46 5 347 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Pseudomonas fluorescens (strain SBW25)
Q4ZYY9 1.75e-103 310 46 5 347 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Pseudomonas syringae pv. syringae (strain B728a)
Q88DC4 2.15e-103 310 48 5 347 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A5W9T9 2.15e-103 310 48 5 347 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q87VI5 2.53e-103 310 46 4 347 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q3KIZ8 8.01e-103 309 46 5 347 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Pseudomonas fluorescens (strain Pf0-1)
B0KL04 2.74e-102 307 47 5 347 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Pseudomonas putida (strain GB-1)
C1DLP4 3.44e-102 307 46 5 347 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
A1U4D3 5.66e-102 307 46 6 353 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q4KJ82 7.78e-102 306 47 5 345 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q02F66 1.49e-98 298 47 3 343 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Pseudomonas aeruginosa (strain UCBPP-PA14)
B7V341 1.49e-98 298 47 3 343 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Pseudomonas aeruginosa (strain LESB58)
Q9HUL3 1.51e-98 298 47 3 343 1 rsgA Small ribosomal subunit biogenesis GTPase RsgA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q21H92 4.27e-98 297 43 5 348 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
A4XPX8 3.02e-95 290 46 5 347 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Pseudomonas mendocina (strain ymp)
Q1QY34 7.53e-93 283 47 6 345 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q82Y12 1.68e-73 233 40 5 306 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
P67678 1.76e-65 212 40 7 305 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
P67680 1.76e-65 212 40 7 305 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
P67679 1.76e-65 212 40 7 305 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q2YB53 2.35e-63 207 37 8 314 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
B2U8L7 5.13e-61 201 38 6 308 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Ralstonia pickettii (strain 12J)
Q8Y0V3 1.36e-60 200 39 6 309 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
A1V6I6 6.66e-59 195 36 6 306 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Burkholderia mallei (strain SAVP1)
Q62M59 6.66e-59 195 36 6 306 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Burkholderia mallei (strain ATCC 23344)
A2S4N1 6.66e-59 195 36 6 306 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Burkholderia mallei (strain NCTC 10229)
A3MHS6 6.66e-59 195 36 6 306 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Burkholderia mallei (strain NCTC 10247)
Q63S39 2.6e-58 194 36 6 306 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Burkholderia pseudomallei (strain K96243)
Q5L0R8 3.24e-58 193 37 6 306 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Geobacillus kaustophilus (strain HTA426)
A4IM52 7.48e-58 192 36 6 306 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Geobacillus thermodenitrificans (strain NG80-2)
Q3JQ14 9.62e-58 192 36 6 306 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Burkholderia pseudomallei (strain 1710b)
A3NBZ8 1.15e-57 192 36 6 306 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Burkholderia pseudomallei (strain 668)
A3NXT4 1.15e-57 192 36 6 306 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Burkholderia pseudomallei (strain 1106a)
B2JF36 1.26e-57 192 37 7 302 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
A5EV96 1.81e-56 189 35 7 328 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Dichelobacter nodosus (strain VCS1703A)
A5FML2 9.23e-56 187 32 6 304 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Flavobacterium johnsoniae (strain ATCC 17061 / DSM 2064 / JCM 8514 / BCRC 14874 / CCUG 350202 / NBRC 14942 / NCIMB 11054 / UW101)
Q13VF6 2.5e-55 186 36 7 306 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Paraburkholderia xenovorans (strain LB400)
Q9K9Z1 7.13e-55 184 38 7 307 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
B2T600 1.13e-54 184 36 7 306 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
C5D8S1 1.55e-54 183 36 6 306 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Geobacillus sp. (strain WCH70)
B3QL20 1.5e-53 181 37 7 316 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Chlorobaculum parvum (strain DSM 263 / NCIMB 8327)
C1ABL6 2.95e-52 178 39 6 268 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Gemmatimonas aurantiaca (strain DSM 14586 / JCM 11422 / NBRC 100505 / T-27)
A5ILF8 1.6e-51 176 37 8 275 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Thermotoga petrophila (strain ATCC BAA-488 / DSM 13995 / JCM 10881 / RKU-1)
B9K7Z8 1.66e-51 176 36 7 278 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Thermotoga neapolitana (strain ATCC 49049 / DSM 4359 / NBRC 107923 / NS-E)
Q732K9 2.28e-51 175 35 8 306 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Bacillus cereus (strain ATCC 10987 / NRS 248)
Q9X242 3.28e-51 175 37 8 275 1 rsgA Small ribosomal subunit biogenesis GTPase RsgA Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q5LHL3 3.61e-51 175 30 6 317 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
Q8KC52 3.83e-51 175 36 7 318 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
Q81WH7 4.01e-51 174 35 8 306 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Bacillus anthracis
A6GW90 6.33e-51 175 31 7 304 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Flavobacterium psychrophilum (strain ATCC 49511 / DSM 21280 / CIP 103535 / JIP02/86)
Q7UUZ6 2.32e-50 173 33 7 314 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
A7GRJ1 4.88e-50 172 35 7 306 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
O66555 6.56e-50 172 38 8 302 1 rsgA Small ribosomal subunit biogenesis GTPase RsgA Aquifex aeolicus (strain VF5)
Q64YJ1 7.69e-50 172 30 6 317 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Bacteroides fragilis (strain YCH46)
Q819U6 8.14e-50 171 34 7 306 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
A7Z4J8 1.5e-49 171 34 10 309 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
Q8A5I9 1.94e-49 171 31 6 317 3 rsgA2 Small ribosomal subunit biogenesis GTPase RsgA 2 Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q11RI7 2.11e-49 171 37 2 216 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Cytophaga hutchinsonii (strain ATCC 33406 / DSM 1761 / CIP 103989 / NBRC 15051 / NCIMB 9469 / D465)
Q9K1A4 6.79e-49 169 34 7 298 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
A1KRU2 1.71e-48 168 34 7 298 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
A6L1H7 2.69e-48 167 31 6 317 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Phocaeicola vulgatus (strain ATCC 8482 / DSM 1447 / JCM 5826 / CCUG 4940 / NBRC 14291 / NCTC 11154)
A6LHB6 3.19e-48 167 33 8 315 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Parabacteroides distasonis (strain ATCC 8503 / DSM 20701 / CIP 104284 / JCM 5825 / NCTC 11152)
A8FD43 3.88e-48 167 36 10 311 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Bacillus pumilus (strain SAFR-032)
Q71YJ7 1.52e-47 165 33 9 309 3 rsgA1 Small ribosomal subunit biogenesis GTPase RsgA 1 Listeria monocytogenes serotype 4b (strain F2365)
P59946 2.12e-47 166 33 7 309 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Porphyromonas gingivalis (strain ATCC BAA-308 / W83)
B4RPG3 2.37e-47 165 35 8 298 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Neisseria gonorrhoeae (strain NCCP11945)
Q03W20 2.46e-47 165 33 9 308 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
Q9JSM2 2.5e-47 165 34 7 298 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q92AI9 2.65e-47 164 33 9 309 3 rsgA2 Small ribosomal subunit biogenesis GTPase RsgA 2 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q5F633 2.75e-47 165 35 8 298 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q8Y680 9.49e-47 163 33 9 309 3 rsgA2 Small ribosomal subunit biogenesis GTPase RsgA 2 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
B2RLV5 1.17e-46 164 33 7 309 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Porphyromonas gingivalis (strain ATCC 33277 / DSM 20709 / CIP 103683 / JCM 12257 / NCTC 11834 / 2561)
A9M3C0 1.22e-46 163 35 6 285 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Neisseria meningitidis serogroup C (strain 053442)
Q5WFL1 1.81e-46 162 35 8 292 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Shouchella clausii (strain KSM-K16)
Q2RK09 2.73e-46 162 37 9 313 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
O34530 4.84e-46 161 33 7 293 1 rsgA Small ribosomal subunit biogenesis GTPase RsgA Bacillus subtilis (strain 168)
Q3AC25 8.08e-46 160 33 8 304 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q8DVW1 1.5e-45 160 33 11 301 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q38XT2 2.44e-45 160 31 7 307 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Latilactobacillus sakei subsp. sakei (strain 23K)
Q8ER21 3.91e-45 159 37 6 253 3 rsgA2 Small ribosomal subunit biogenesis GTPase RsgA 2 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
B6YS07 2.3e-44 157 30 7 321 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Azobacteroides pseudotrichonymphae genomovar. CFP2
B1MXU5 2.62e-44 157 33 10 317 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Leuconostoc citreum (strain KM20)
P67685 4.1e-44 156 33 12 308 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P67684 4.1e-44 156 33 12 308 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
A0LY86 5.17e-44 157 28 6 307 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Christiangramia forsetii (strain DSM 17595 / CGMCC 1.15422 / KT0803)
Q8R9T7 6.09e-44 156 34 5 250 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q9A1H9 1.02e-43 155 32 11 307 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Streptococcus pyogenes serotype M1
Q8P2N7 1.05e-43 155 32 11 307 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q5XDX3 1.05e-43 155 32 11 307 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
B9DPK4 2.35e-43 154 33 7 278 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Staphylococcus carnosus (strain TM300)
Q82ZE1 8.76e-43 153 33 7 280 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Enterococcus faecalis (strain ATCC 700802 / V583)
P0DF43 1.8e-42 152 32 11 307 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Streptococcus pyogenes serotype M3 (strain SSI-1)
P0DF42 1.8e-42 152 32 11 307 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q03FX9 3.77e-42 152 30 8 306 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Pediococcus pentosaceus (strain ATCC 25745 / CCUG 21536 / LMG 10740 / 183-1w)
Q88WK9 1.97e-41 149 33 8 304 3 rsgA1 Small ribosomal subunit biogenesis GTPase RsgA 1 Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q8E3D9 3.33e-41 149 32 12 308 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Streptococcus agalactiae serotype III (strain NEM316)
Q49X02 4.01e-41 148 29 5 277 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q8PTZ6 5.04e-41 150 34 9 307 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
B7J132 5.35e-41 149 37 5 225 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Borreliella burgdorferi (strain ZS7)
O51126 5.35e-41 149 37 5 225 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
Q82LC4 1.08e-40 149 37 4 220 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q662R3 1.3e-40 147 37 5 225 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Borrelia garinii subsp. bavariensis (strain ATCC BAA-2496 / DSM 23469 / PBi)
Q8DXR9 2.25e-40 146 32 12 308 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
B2V4B8 2.56e-40 146 32 9 273 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Clostridium botulinum (strain Alaska E43 / Type E3)
Q0SP65 3.01e-40 146 37 5 225 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Borreliella afzelii (strain PKo)
B8I262 3.15e-40 146 33 6 283 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Ruminiclostridium cellulolyticum (strain ATCC 35319 / DSM 5812 / JCM 6584 / H10)
Q8TKG2 4.68e-40 147 35 9 278 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
B2THS4 6.97e-40 145 32 9 273 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Clostridium botulinum (strain Eklund 17B / Type B)
Q8XJL9 7.66e-40 145 34 8 269 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Clostridium perfringens (strain 13 / Type A)
C5CSN3 8.78e-40 145 32 7 309 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Variovorax paradoxus (strain S110)
B2GD51 1.13e-39 145 33 8 283 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Limosilactobacillus fermentum (strain NBRC 3956 / LMG 18251)
Q0SS84 1.34e-39 144 34 8 269 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Clostridium perfringens (strain SM101 / Type A)
Q0TPL7 2.6e-39 144 34 8 269 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q9CEB7 3.38e-39 144 30 10 317 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Lactococcus lactis subsp. lactis (strain IL1403)
A6TRW0 5.83e-39 143 28 5 281 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Alkaliphilus metalliredigens (strain QYMF)
Q97IC1 1.53e-38 141 31 7 252 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q4L5S2 2.05e-38 141 29 6 277 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Staphylococcus haemolyticus (strain JCSC1435)
Q9ZBT9 2.21e-38 143 36 4 220 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
A7GG89 4.58e-38 140 28 5 250 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
B1IIL4 4.58e-38 140 28 5 250 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Clostridium botulinum (strain Okra / Type B1)
Q8CSV8 4.61e-38 140 32 8 278 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
C1FSS3 6.08e-38 140 28 5 250 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Clostridium botulinum (strain Kyoto / Type A2)
A5I4T1 6.08e-38 140 28 5 250 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
A7FW69 6.08e-38 140 28 5 250 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Clostridium botulinum (strain ATCC 19397 / Type A)
B1KX53 6.28e-38 140 28 5 250 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Clostridium botulinum (strain Loch Maree / Type A3)
B2G835 1.07e-37 139 34 8 281 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Limosilactobacillus reuteri subsp. reuteri (strain JCM 1112)
A5VKQ1 1.07e-37 139 34 8 281 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Limosilactobacillus reuteri (strain DSM 20016)
A6LSK4 1.24e-37 139 33 11 299 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
C3L0K4 1.6e-37 139 28 5 250 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Clostridium botulinum (strain 657 / Type Ba4)
Q5HPX0 2.67e-37 138 31 8 278 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
C4ZEV1 4e-37 138 33 9 287 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Agathobacter rectalis (strain ATCC 33656 / DSM 3377 / JCM 17463 / KCTC 5835 / VPI 0990)
Q88WF3 5.26e-37 139 34 9 268 3 rsgA2 Small ribosomal subunit biogenesis GTPase RsgA 2 Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q8YUA3 8.92e-37 139 33 9 276 3 rsgA1 Small ribosomal subunit biogenesis GTPase RsgA 1 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q895P5 1.28e-36 136 27 9 299 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Clostridium tetani (strain Massachusetts / E88)
A0Q109 5.17e-36 135 30 6 277 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Clostridium novyi (strain NT)
Q3MG79 7.3e-36 136 33 9 276 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Trichormus variabilis (strain ATCC 29413 / PCC 7937)
A5N7Y7 2.18e-35 133 29 5 250 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
B9E1E8 2.18e-35 133 29 5 250 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Clostridium kluyveri (strain NBRC 12016)
B0JW21 4.05e-35 134 35 9 280 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
Q9KX08 9.29e-35 132 32 9 278 1 rsgA Small ribosomal subunit biogenesis GTPase RsgA Staphylococcus aureus (strain COL)
Q6GHL4 1.34e-34 131 32 9 278 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Staphylococcus aureus (strain MRSA252)
Q8D4Q0 2.3e-34 132 33 6 239 3 rsgA2 Small ribosomal subunit biogenesis GTPase RsgA 2 Vibrio vulnificus (strain CMCP6)
B5RQS6 5.08e-34 130 34 5 223 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Borrelia recurrentis (strain A1)
B5RLH3 5.08e-34 130 34 5 223 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Borrelia duttonii (strain Ly)
P67683 5.2e-34 130 31 9 278 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Staphylococcus aureus (strain MW2)
Q6G9Z2 5.2e-34 130 31 9 278 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Staphylococcus aureus (strain MSSA476)
P67682 5.2e-34 130 31 9 278 1 rsgA Small ribosomal subunit biogenesis GTPase RsgA Staphylococcus aureus (strain N315)
P67681 5.2e-34 130 31 9 278 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IY02 1.43e-33 128 28 6 243 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Mycoplasmopsis agalactiae (strain NCTC 10123 / CIP 59.7 / PG2)
Q7MGA2 3.99e-33 129 32 6 234 3 rsgA2 Small ribosomal subunit biogenesis GTPase RsgA 2 Vibrio vulnificus (strain YJ016)
Q87FP9 5.39e-33 129 35 6 223 3 rsgA2 Small ribosomal subunit biogenesis GTPase RsgA 2 Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q74IN3 6.73e-33 127 30 10 303 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q8ETB7 1.07e-32 127 30 4 229 3 rsgA1 Small ribosomal subunit biogenesis GTPase RsgA 1 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
B3R0A1 1.51e-32 126 27 7 268 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Phytoplasma mali (strain AT)
Q8YK41 2.23e-32 127 33 5 221 3 rsgA2 Small ribosomal subunit biogenesis GTPase RsgA 2 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q8EZ61 2.65e-32 127 31 8 310 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72MK0 2.9e-32 127 31 8 310 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q044G6 3.1e-32 125 28 9 302 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
Q5FJH9 4.01e-32 125 29 8 293 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
Q2NIT9 8.96e-32 124 30 6 236 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Aster yellows witches'-broom phytoplasma (strain AYWB)
Q7VEJ4 2.05e-31 123 30 8 278 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
B1ZUH7 2.27e-31 124 32 5 241 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Opitutus terrae (strain DSM 11246 / JCM 15787 / PB90-1)
Q8EUL6 2.52e-31 122 28 7 245 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Malacoplasma penetrans (strain HF-2)
Q3A0G9 5.2e-31 123 34 4 212 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
P52640 6.53e-31 123 35 9 251 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q6YR36 7.85e-31 121 30 6 243 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Onion yellows phytoplasma (strain OY-M)
Q8Y7F0 1.06e-30 122 31 6 248 3 rsgA1 Small ribosomal subunit biogenesis GTPase RsgA 1 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q71ZZ0 1.19e-30 122 31 6 248 3 rsgA2 Small ribosomal subunit biogenesis GTPase RsgA 2 Listeria monocytogenes serotype 4b (strain F2365)
Q8A8H7 1.33e-30 122 31 11 313 3 rsgA1 Small ribosomal subunit biogenesis GTPase RsgA 1 Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q92C22 1.87e-30 121 30 7 255 3 rsgA1 Small ribosomal subunit biogenesis GTPase RsgA 1 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
A8YVV8 4.05e-30 119 29 8 293 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Lactobacillus helveticus (strain DPC 4571)
Q46I43 1.69e-29 118 33 9 249 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Prochlorococcus marinus (strain NATL2A)
Q8DK79 2.05e-29 119 31 9 285 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
A2BZC2 3.03e-29 117 33 9 249 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Prochlorococcus marinus (strain NATL1A)
A2C5M0 4.03e-29 117 35 10 267 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Prochlorococcus marinus (strain MIT 9303)
P59945 5.5e-29 116 34 11 237 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Mycoplasmoides gallisepticum (strain R(low / passage 15 / clone 2))
Q8R685 7.79e-29 115 28 8 290 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
B5ZB25 1.08e-28 115 31 7 224 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Ureaplasma urealyticum serovar 10 (strain ATCC 33699 / Western)
Q8P5H9 5.42e-28 115 34 7 218 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
B0RNZ3 5.42e-28 115 34 7 218 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Xanthomonas campestris pv. campestris (strain B100)
Q4UYJ6 5.42e-28 115 34 7 218 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Xanthomonas campestris pv. campestris (strain 8004)
Q3BPG1 8.81e-28 114 34 7 218 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q8PGW9 1.03e-27 114 34 7 218 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Xanthomonas axonopodis pv. citri (strain 306)
Q9PFV1 1.49e-27 113 33 4 215 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Xylella fastidiosa (strain 9a5c)
Q4AAI2 1.77e-27 112 26 6 242 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Mesomycoplasma hyopneumoniae (strain J / ATCC 25934 / NCTC 10110)
B1AIK5 1.79e-27 112 28 7 243 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Ureaplasma parvum serovar 3 (strain ATCC 27815 / 27 / NCTC 11736)
Q7V9C6 1.84e-27 113 35 11 271 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Prochlorococcus marinus (strain MIT 9313)
Q601H2 1.85e-27 112 26 6 242 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Mesomycoplasma hyopneumoniae (strain 232)
B0U466 4.11e-27 112 33 5 218 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Xylella fastidiosa (strain M12)
B2I7R5 5.68e-27 112 33 4 215 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Xylella fastidiosa (strain M23)
Q87B73 8.86e-27 111 33 4 215 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q9PQS5 2.07e-26 109 28 8 243 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Ureaplasma parvum serovar 3 (strain ATCC 700970)
B2SLQ8 2.91e-26 110 33 7 218 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Xanthomonas oryzae pv. oryzae (strain PXO99A)
Q5H3X2 4.05e-26 110 33 7 218 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q2P6S9 4.05e-26 110 33 7 218 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
B1V9R1 5.68e-25 105 29 6 247 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Phytoplasma australiense
Q0IE58 5.95e-25 105 29 9 310 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Synechococcus sp. (strain CC9311)
Q4A8L3 7.05e-25 105 26 6 242 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Mesomycoplasma hyopneumoniae (strain 7448)
Q3ANM7 4.63e-24 103 30 13 319 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Synechococcus sp. (strain CC9605)
Q98PN8 1e-23 101 26 12 305 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Mycoplasmopsis pulmonis (strain UAB CTIP)
Q98JM4 3.28e-22 99 30 7 227 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q4V399 3.55e-21 97 25 8 308 2 rsgA Small ribosomal subunit biogenesis GTPase RsgA 1, mitochondrial Arabidopsis thaliana
Q7UA74 8.32e-21 94 30 10 287 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Parasynechococcus marenigrum (strain WH8102)
P75523 3.72e-18 86 24 11 301 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
P47356 3.72e-18 86 27 10 243 3 rsgA Small ribosomal subunit biogenesis GTPase RsgA Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q44557 4.24e-13 66 48 0 56 4 None Uncharacterized protein in rhdA 5'region (Fragment) Azotobacter vinelandii
F4HTL8 1.07e-08 59 27 4 169 2 At1g67460 Small ribosomal subunit biogenesis GTPase RsgA 2, mitochondrial Arabidopsis thaliana

  • Number of RefSeq hits:

General

Source Morganella morganii S5
Locus tag HKOGLL_11925
Feature type CDS
Gene rsgA
Product small ribosomal subunit biogenesis GTPase RsgA
Location 99994 - 101043 (strand: 1)
Length 1050 (nucleotides) / 349 (amino acids)
In genomic island -

Contig

Accession ZDB_689
Length 162442 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1414
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF03193 RsgA GTPase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1162 Translation, ribosomal structure and biogenesis (J) J Ribosome biogenesis GTPase RsgA

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K06949 ribosome biogenesis GTPase / thiamine phosphate phosphatase [EC:3.6.1.- 3.1.3.100] Thiamine metabolism
Metabolic pathways
-

Protein Sequence

MAKQKLSKGQVRRVQANQQRKLRKENRPEPEDSLFGEAQEGQVISRFGQHADIEAADGSVQRCNLRRTIKSLVTGDRVVWRAALQNNEEGRVNGIVEAVHERESVLTRPDFYDGIKPIAANINQIVIVSAILPELSLNIIDRYLVACETLGVEPLIVLNKIDLLNDESRDQVNDLMNIYRNIGYRVLEVSGHTNEGIDALTAALAGRISIFAGQSGVGKSSLLNTLLPENADILVNNVSDVSGLGQHTTTASRLYHFPHGGDVIDSPGVREFGLWHLTPEQVTQGYTEFRDYLGGCKFRDCKHGDDPGCALREAVENGEISAERFENYHRILESMAQVKPRRNFTAGED

Flanking regions ( +/- flanking 50bp)

CCCGGCGGGCACTTTCTTCTTTACGTGGTGTCAAAACAGACGAGGTTTCGTTGGCTAAACAAAAACTTTCCAAAGGTCAGGTACGGCGTGTTCAGGCAAACCAGCAGCGCAAACTGCGCAAAGAGAACCGCCCGGAGCCTGAGGACAGCCTGTTCGGTGAGGCTCAGGAAGGACAGGTAATCAGCCGTTTCGGGCAGCATGCGGATATTGAAGCCGCAGACGGCTCGGTACAGCGCTGCAACCTGCGCCGCACCATAAAGTCACTGGTCACCGGTGACCGCGTGGTCTGGCGTGCGGCGTTGCAGAATAACGAAGAAGGCCGTGTTAACGGGATTGTTGAGGCAGTGCATGAACGTGAATCGGTACTGACCCGTCCTGATTTTTATGACGGTATTAAACCGATCGCCGCCAATATCAACCAGATCGTGATTGTTTCCGCGATTTTACCGGAATTATCACTCAATATTATTGACCGCTATCTGGTCGCCTGCGAAACACTCGGTGTGGAACCACTGATTGTGCTCAACAAAATTGACCTGCTGAATGACGAAAGCCGCGACCAGGTCAATGATTTAATGAATATCTATCGTAATATCGGATACCGTGTGCTGGAAGTATCCGGCCACACCAACGAGGGGATTGATGCACTGACGGCAGCACTTGCCGGACGGATTTCCATCTTCGCCGGACAATCCGGTGTCGGAAAATCCAGCCTGCTCAATACATTGCTGCCGGAAAACGCGGATATCCTGGTCAATAACGTTTCTGATGTTTCCGGGCTGGGTCAGCACACCACCACCGCCTCACGGCTGTATCATTTCCCGCACGGCGGGGATGTGATCGACTCACCGGGAGTGCGTGAATTCGGGTTGTGGCACCTGACACCGGAACAGGTCACTCAGGGATATACGGAATTCCGCGATTATCTCGGCGGCTGTAAATTCCGTGACTGCAAACACGGGGATGACCCGGGCTGTGCGCTGCGCGAAGCTGTGGAGAACGGCGAAATCAGTGCGGAACGCTTTGAAAATTATCACCGTATTCTGGAAAGTATGGCACAGGTGAAACCACGCCGTAATTTTACGGCCGGTGAAGACTGACAAGCGCAATAAGCACAGGTACAATAGCCCCCTTTTGTTCAGAATTCGCC