Homologs in group_2920

Help

5 homologs were identified in 5 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_13785 FBDBKF_13785 100.0 Morganella morganii S1 cof Hydroxymethylpyrimidine pyrophosphatase and other HAD family phosphatases
EHELCC_11455 EHELCC_11455 100.0 Morganella morganii S2 cof Hydroxymethylpyrimidine pyrophosphatase and other HAD family phosphatases
NLDBIP_11800 NLDBIP_11800 100.0 Morganella morganii S4 cof Hydroxymethylpyrimidine pyrophosphatase and other HAD family phosphatases
LHKJJB_11660 LHKJJB_11660 100.0 Morganella morganii S3 cof Hydroxymethylpyrimidine pyrophosphatase and other HAD family phosphatases
F4V73_RS12655 F4V73_RS12655 69.1 Morganella psychrotolerans - Cof-type HAD-IIB family hydrolase

Distribution of the homologs in the orthogroup group_2920

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2920

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P54947 3.71e-31 119 29 2 260 3 yxeH Putative phosphatase YxeH Bacillus subtilis (strain 168)
P0A8Y7 6.71e-30 116 28 2 262 3 yidA Sugar phosphatase YidA Shigella flexneri
P0A8Y5 6.71e-30 116 28 2 262 1 yidA Sugar phosphatase YidA Escherichia coli (strain K12)
P0A8Y6 6.71e-30 116 28 2 262 3 yidA Sugar phosphatase YidA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q5XD45 1.05e-26 107 28 4 262 1 M6_Spy0533 Putative phosphatase M6_Spy0533 Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
P96741 3.27e-20 90 29 12 287 1 ywtE 5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YwtE Bacillus subtilis (strain 168)
A8GAR8 5.24e-18 84 27 8 275 3 cof HMP-PP phosphatase Serratia proteamaculans (strain 568)
P42962 1.59e-15 77 28 10 263 1 ycsE 5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YcsE Bacillus subtilis (strain 168)
A6T5I9 5.86e-15 76 26 7 265 3 cof HMP-PP phosphatase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B5Y0T3 1.8e-13 72 26 8 265 3 cof HMP-PP phosphatase Klebsiella pneumoniae (strain 342)
A4W7B7 2.97e-13 71 27 8 265 3 cof HMP-PP phosphatase Enterobacter sp. (strain 638)
Q8L5Z4 5.42e-12 68 28 12 280 1 YBEY Endoribonuclease YBEY, chloroplastic Arabidopsis thaliana
A9MM14 6.68e-12 67 26 8 262 3 cof HMP-PP phosphatase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
P75360 6.74e-12 67 25 9 272 3 MPN_427 Putative phosphatase MPN_427 Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
O27143 2.54e-11 65 43 0 78 3 MTH_1071 Phosphoglycolate phosphatase Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
P70947 4.72e-11 65 24 9 268 1 yitU 5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YitU Bacillus subtilis (strain 168)
B7LMD3 6.86e-11 64 26 9 265 3 cof HMP-PP phosphatase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q8FKA2 9.7e-11 64 26 9 265 3 cof HMP-PP phosphatase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
B7MQG2 1.02e-10 63 26 9 265 3 cof HMP-PP phosphatase Escherichia coli O81 (strain ED1a)
B4SWV0 1.55e-10 63 26 8 265 3 cof HMP-PP phosphatase Salmonella newport (strain SL254)
Q8ZRB6 1.86e-10 63 26 8 265 3 cof HMP-PP phosphatase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B5BD74 1.86e-10 63 26 8 265 3 cof HMP-PP phosphatase Salmonella paratyphi A (strain AKU_12601)
A9MWC0 1.86e-10 63 26 8 265 3 cof HMP-PP phosphatase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PFM4 1.86e-10 63 26 8 265 3 cof HMP-PP phosphatase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4T9F2 1.86e-10 63 26 8 265 3 cof HMP-PP phosphatase Salmonella heidelberg (strain SL476)
B5R6V8 1.86e-10 63 26 8 265 3 cof HMP-PP phosphatase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5QU47 1.86e-10 63 26 8 265 3 cof HMP-PP phosphatase Salmonella enteritidis PT4 (strain P125109)
B5FKW1 1.86e-10 63 26 8 265 3 cof HMP-PP phosphatase Salmonella dublin (strain CT_02021853)
A8AK07 2.9e-10 62 25 8 265 3 cof HMP-PP phosphatase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q83M49 3.13e-10 62 25 9 266 3 cof HMP-PP phosphatase Shigella flexneri
Q0T7D7 3.13e-10 62 25 9 266 3 cof HMP-PP phosphatase Shigella flexneri serotype 5b (strain 8401)
Q3Z4V2 3.19e-10 62 26 9 265 3 cof HMP-PP phosphatase Shigella sonnei (strain Ss046)
B2U4Q1 3.19e-10 62 26 9 265 3 cof HMP-PP phosphatase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q1RF89 3.19e-10 62 26 9 265 3 cof HMP-PP phosphatase Escherichia coli (strain UTI89 / UPEC)
B1LJK3 3.19e-10 62 26 9 265 3 cof HMP-PP phosphatase Escherichia coli (strain SMS-3-5 / SECEC)
B6HZQ3 3.19e-10 62 26 9 265 3 cof HMP-PP phosphatase Escherichia coli (strain SE11)
Q0TKJ5 3.19e-10 62 26 9 265 3 cof HMP-PP phosphatase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1A8B5 3.19e-10 62 26 9 265 3 cof HMP-PP phosphatase Escherichia coli O1:K1 / APEC
A7ZXA4 3.19e-10 62 26 9 265 3 cof HMP-PP phosphatase Escherichia coli O9:H4 (strain HS)
B7NJ48 3.19e-10 62 26 9 265 3 cof HMP-PP phosphatase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7MDA5 3.19e-10 62 26 9 265 3 cof HMP-PP phosphatase Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UJR9 3.19e-10 62 26 9 265 3 cof HMP-PP phosphatase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A7ZIK4 3.19e-10 62 26 9 265 3 cof HMP-PP phosphatase Escherichia coli O139:H28 (strain E24377A / ETEC)
B4TMD5 3.31e-10 62 25 8 265 3 cof HMP-PP phosphatase Salmonella schwarzengrund (strain CVM19633)
P46891 3.75e-10 62 26 9 265 1 cof HMP-PP phosphatase Escherichia coli (strain K12)
B1XFN4 3.75e-10 62 26 9 265 3 cof HMP-PP phosphatase Escherichia coli (strain K12 / DH10B)
C4ZTK3 3.75e-10 62 26 9 265 3 cof HMP-PP phosphatase Escherichia coli (strain K12 / MC4100 / BW2952)
B5Z3V4 4.13e-10 62 25 9 265 3 cof HMP-PP phosphatase Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8XE50 4.13e-10 62 25 9 265 3 cof HMP-PP phosphatase Escherichia coli O157:H7
B7N900 4.33e-10 62 26 9 265 3 cof HMP-PP phosphatase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B7M3T9 4.33e-10 62 26 9 265 3 cof HMP-PP phosphatase Escherichia coli O8 (strain IAI1)
Q8Z8U7 4.41e-10 62 25 8 265 3 cof HMP-PP phosphatase Salmonella typhi
B5EXJ7 6.98e-10 61 25 8 265 3 cof HMP-PP phosphatase Salmonella agona (strain SL483)
Q325F5 8.65e-10 61 26 9 264 3 cof HMP-PP phosphatase Shigella boydii serotype 4 (strain Sb227)
Q57SA6 1e-09 61 25 8 265 3 cof HMP-PP phosphatase Salmonella choleraesuis (strain SC-B67)
B7L683 1.6e-09 60 26 10 266 3 cof HMP-PP phosphatase Escherichia coli (strain 55989 / EAEC)
A1JNL2 2.27e-09 60 25 8 272 3 cof HMP-PP phosphatase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
B2K6W6 5.33e-09 58 25 7 270 3 cof HMP-PP phosphatase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
B1JHR2 6.15e-09 58 25 7 270 3 cof HMP-PP phosphatase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
A7FLB5 6.15e-09 58 25 7 270 3 cof HMP-PP phosphatase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A4TPD3 8.32e-09 58 25 7 270 3 cof HMP-PP phosphatase Yersinia pestis (strain Pestoides F)
Q1CL56 8.32e-09 58 25 7 270 3 cof HMP-PP phosphatase Yersinia pestis bv. Antiqua (strain Nepal516)
A9QZP3 8.32e-09 58 25 7 270 3 cof HMP-PP phosphatase Yersinia pestis bv. Antiqua (strain Angola)
Q7CK25 8.32e-09 58 25 7 270 3 cof HMP-PP phosphatase Yersinia pestis
Q1C4L7 8.32e-09 58 25 7 270 3 cof HMP-PP phosphatase Yersinia pestis bv. Antiqua (strain Antiqua)
Q96YM5 1e-08 57 43 4 74 3 STK_21470 Phosphoglycolate phosphatase Sulfurisphaera tokodaii (strain DSM 16993 / JCM 10545 / NBRC 100140 / 7)
Q66DS5 1.55e-08 57 25 7 270 3 cof HMP-PP phosphatase Yersinia pseudotuberculosis serotype I (strain IP32953)
P44447 2.6e-08 57 37 0 79 1 HI_0003 Putative phosphatase HI_0003 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
O07539 2.83e-08 57 32 1 114 1 yhaX Stress response protein YhaX Bacillus subtilis (strain 168)
Q45494 3.21e-08 56 25 11 262 3 ykrA Putative phosphatase YkrA Bacillus subtilis (strain 168)
P75399 1.1e-07 55 26 8 227 3 MPN_383 Putative phosphatase MPN_383 Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
A7MFJ6 1.88e-07 54 23 6 271 3 cof HMP-PP phosphatase Cronobacter sakazakii (strain ATCC BAA-894)
Q32JB1 2.54e-07 52 26 1 119 5 cof Putative HMP-PP phosphatase Shigella dysenteriae serotype 1 (strain Sd197)
A5ULS3 3.39e-07 53 34 0 73 3 Msm_0946 Phosphoglycolate phosphatase Methanobrevibacter smithii (strain ATCC 35061 / DSM 861 / OCM 144 / PS)
P47507 3.56e-07 53 24 9 286 3 MG265 Putative phosphatase MG265 Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
B1IZE7 1.19e-06 52 26 1 119 3 cof HMP-PP phosphatase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
Q8TK72 1.22e-06 51 31 1 101 3 MA_3544 Phosphoglycolate phosphatase Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
P95931 2.35e-06 50 35 1 77 3 SSO2157 Phosphoglycolate phosphatase 2 Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q5JDB7 3.72e-06 50 25 11 271 3 TK2301 Phosphoglycolate phosphatase Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
Q5XAQ1 3.95e-06 51 31 1 96 1 M6_Spy1377 Putative bifunctional phosphatase/peptidyl-prolyl cis-trans isomerase Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
O94314 4.73e-06 50 24 11 265 3 SPBC215.10 Uncharacterized hydrolase C215.10 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O29805 7.09e-06 49 34 0 78 3 AF_0444 Phosphoglycolate phosphatase Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
B9LMX5 7.82e-06 49 34 0 83 3 Hlac_1119 Phosphoglycolate phosphatase Halorubrum lacusprofundi (strain ATCC 49239 / DSM 5036 / JCM 8891 / ACAM 34)
P21878 1.01e-05 46 30 0 76 3 None Uncharacterized protein in pdhA 5'region (Fragment) Geobacillus stearothermophilus
P94592 1.71e-05 48 37 0 82 1 ywpJ Phosphatase YwpJ Bacillus subtilis (strain 168)
Q8U111 2.17e-05 48 30 1 113 3 PF1419 Phosphoglycolate phosphatase Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q9HRF9 2.22e-05 48 35 0 82 3 VNG_0718C Phosphoglycolate phosphatase Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
B0R403 2.22e-05 48 35 0 82 3 OE_2060R Phosphoglycolate phosphatase Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
A3CWU5 2.53e-05 47 36 0 74 3 Memar_1919 Phosphoglycolate phosphatase Methanoculleus marisnigri (strain ATCC 35101 / DSM 1498 / JR1)
O50129 2.57e-05 47 32 0 77 1 PH1421 Phosphoglycolate phosphatase Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
A0B7J8 2.95e-05 47 35 0 76 3 Mthe_0884 Phosphoglycolate phosphatase Methanothrix thermoacetophila (strain DSM 6194 / JCM 14653 / NBRC 101360 / PT)
P75792 0.000129 46 32 0 73 1 ybiV Sugar phosphatase YbiV Escherichia coli (strain K12)
Q9V0Q4 0.000393 44 33 0 72 3 PYRAB07350 Phosphoglycolate phosphatase Pyrococcus abyssi (strain GE5 / Orsay)
Q9UTA6 0.0004 44 24 4 138 1 SPAC25B8.12c Uncharacterized hydrolase C25B8.12c Schizosaccharomyces pombe (strain 972 / ATCC 24843)

  • Number of RefSeq hits:

General

Source Morganella morganii S5
Locus tag HKOGLL_10270
Feature type CDS
Gene cof
Product Hydroxymethylpyrimidine pyrophosphatase and other HAD family phosphatases
Location 135888 - 136697 (strand: 1)
Length 810 (nucleotides) / 269 (amino acids)

Contig

Accession ZDB_687
Length 188522 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2920
Orthogroup size 6
N. genomes 6

Actions

Genomic region

Domains

PF08282 haloacid dehalogenase-like hydrolase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0561 Coenzyme transport and metabolism (H)
General function prediction only (R)		 HR Hydroxymethylpyrimidine pyrophosphatase and other HAD family phosphatases

Protein Sequence

MTTLAIDLDGTLLHPDNRISEGNRRALLALPPETDIVICSARPLRAILSLTDGAGLLPVIRAIGACNGAVIYDCRTQSVLSRATLSPAVLSALQNMLTTGWHAFGEDALLCPPGKISEYTIHEAELFGLPIQTLAADDIFSRTDIIKITLCGEAEALRQRAENLRPQLPAKVSAFFTDQHYFELVPASVSKGSTLQILAERGILRPGTIMAIGDQENDLSLFAASDLRVAMGNAVPALKQAAGYITADCREDGVAAALHHYRAAFRNDT

Flanking regions ( +/- flanking 50bp)

CAACTGACTGAATTTCCAATGCGGGGGCACTGCTCCCGCTGAGGCTTTTTATGACCACACTGGCTATCGATCTCGACGGCACGCTTTTACATCCGGATAACCGTATTTCAGAGGGCAACCGCCGGGCACTGCTGGCGCTGCCGCCGGAAACGGATATTGTGATCTGCTCTGCCCGCCCGCTGCGGGCGATTTTGTCTCTGACGGACGGCGCCGGGCTGCTTCCGGTGATCCGCGCTATCGGCGCCTGTAACGGTGCGGTGATTTATGACTGCCGCACACAATCCGTTCTCAGCCGGGCAACCCTCTCTCCGGCCGTGTTATCCGCACTGCAAAACATGCTCACCACCGGCTGGCATGCTTTCGGTGAGGATGCTCTGCTCTGTCCGCCGGGGAAAATATCAGAATACACAATTCATGAAGCTGAATTATTCGGCCTGCCAATACAGACACTCGCGGCAGACGATATTTTCAGCCGGACAGATATCATTAAAATCACCCTGTGCGGGGAAGCGGAAGCCCTGCGGCAACGGGCTGAAAACCTTCGCCCGCAGTTACCGGCAAAGGTCAGCGCATTCTTTACCGACCAGCACTATTTTGAACTGGTTCCGGCATCCGTGAGCAAAGGCAGTACCCTGCAAATACTGGCGGAGCGCGGTATTCTGCGGCCGGGAACCATCATGGCCATCGGGGATCAGGAAAACGATCTCTCTTTATTTGCCGCATCGGATCTGCGCGTGGCAATGGGCAATGCCGTACCGGCACTGAAGCAGGCCGCCGGGTATATTACGGCTGACTGCCGGGAGGATGGCGTTGCTGCCGCACTTCATCATTACAGAGCGGCATTCCGCAACGACACATAATGCGCTAATATTGTTCATGTTTACGAGTGTGATGAGAACGGTCATGAATC