Homologs in group_396

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_20020 FBDBKF_20020 100.0 Morganella morganii S1 - Molecular chaperone
EHELCC_03510 EHELCC_03510 100.0 Morganella morganii S2 - Molecular chaperone
NLDBIP_03510 NLDBIP_03510 100.0 Morganella morganii S4 - Molecular chaperone
LHKJJB_09340 LHKJJB_09340 100.0 Morganella morganii S3 - Molecular chaperone
F4V73_RS01040 F4V73_RS01040 41.7 Morganella psychrotolerans - fimbria/pilus periplasmic chaperone
PMI_RS07100 PMI_RS07100 51.1 Proteus mirabilis HI4320 - fimbria/pilus periplasmic chaperone

Distribution of the homologs in the orthogroup group_396

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_396

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P37923 7.58e-80 242 52 2 221 3 fimC Chaperone protein FimC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P77249 1.74e-71 220 49 1 227 2 sfmC Probable fimbrial chaperone SfmC Escherichia coli (strain K12)
P62609 8.06e-66 206 48 4 217 1 focC Chaperone protein FocC Escherichia coli
P62610 8.06e-66 206 48 4 217 3 focC Chaperone protein FocC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P59590 1.24e-64 203 46 4 224 3 fimC Chaperone protein FimC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P31697 1.08e-63 201 45 4 224 1 fimC Chaperone protein FimC Escherichia coli (strain K12)
P75856 2.17e-48 162 39 2 209 2 elfD Probable fimbrial chaperone protein ElfD Escherichia coli (strain K12)
Q8X5E4 2.39e-48 161 39 2 209 2 elfD Probable fimbrial chaperone protein ElfD Escherichia coli O157:H7
Q8X5K6 8.43e-48 160 39 3 228 2 lpfB Probable fimbrial chaperone LpfB Escherichia coli O157:H7
P43661 3.67e-47 158 41 4 219 3 lpfB Chaperone protein LpfB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P42914 8.32e-41 142 35 4 225 2 yraI Probable fimbrial chaperone YraI Escherichia coli (strain K12)
P15319 2.64e-31 118 33 10 232 1 papD Chaperone protein PapD Escherichia coli
P45991 8.1e-31 117 34 8 231 3 hifB Chaperone protein HifB Haemophilus influenzae
P35757 9.1e-31 116 34 8 231 3 hifB Chaperone protein HifB Haemophilus influenzae
P21646 1.07e-29 113 32 8 232 3 mrkB Chaperone protein MrkB Klebsiella pneumoniae
P33128 3.64e-28 110 31 9 236 1 yadV Probable fimbrial chaperone YadV Escherichia coli (strain K12)
P33342 1.31e-27 108 33 6 225 2 yehC Probable fimbrial chaperone YehC Escherichia coli (strain K12)
P75749 4.48e-26 104 30 5 197 3 ybgP Uncharacterized fimbrial chaperone YbgP Escherichia coli (strain K12)
P46004 1.03e-25 103 29 4 227 3 aggD Chaperone protein AggD Escherichia coli
P33409 2.86e-25 102 30 7 229 3 fimB Chaperone protein FimB/FhaD Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
P40876 2.98e-25 102 29 6 225 2 ycbF Uncharacterized fimbrial chaperone YcbF Escherichia coli (strain K12)
P53516 1.65e-24 100 32 4 184 3 afaB Chaperone protein AfaB Escherichia coli
P26926 3.71e-24 99 32 7 216 1 caf1M Chaperone protein caf1M Yersinia pestis
P33407 6.37e-24 99 31 9 254 3 myfB Chaperone protein MyfB Yersinia enterocolitica
P53520 4.93e-23 96 30 8 234 3 pmfD Chaperone protein PmfD Proteus mirabilis (strain HI4320)
P25401 3.73e-22 94 28 7 224 1 faeE Chaperone protein FaeE Escherichia coli
Q05433 5.2e-22 94 28 7 224 3 clpE Chaperone protein ClpE Escherichia coli
P25402 6.02e-22 93 30 9 226 3 fanE Chaperone protein FanE Escherichia coli
P46738 1.71e-21 92 30 4 184 3 nfaE Chaperone protein NfaE Escherichia coli
P77616 1.55e-20 90 31 9 221 3 yqiH Uncharacterized fimbrial chaperone YqiH Escherichia coli (strain K12)
P15483 1.89e-19 87 30 5 205 3 None Chaperone protein CS3-1 Escherichia coli
P69966 5.05e-18 83 28 6 220 3 psaB Chaperone protein PsaB Yersinia pseudotuberculosis serotype I (strain IP32953)
P69965 5.05e-18 83 28 6 220 3 psaB Chaperone protein PsaB Yersinia pestis
P77599 1.71e-16 79 31 9 207 2 yfcS Probable fimbrial chaperone YfcS Escherichia coli (strain K12)
P53519 3.07e-15 75 25 4 228 3 cssC Chaperone protein CssC Escherichia coli
P53518 7.72e-14 71 24 4 228 3 cssC Chaperone protein CssC Escherichia coli
P33387 2.52e-12 67 26 9 245 3 sefB Chaperone protein SefB Salmonella enteritidis
P42183 1.67e-11 62 36 6 106 3 prsD Chaperone protein PrsD (Fragment) Escherichia coli

  • Number of RefSeq hits:

General

Source Morganella morganii S5
Locus tag HKOGLL_09635
Feature type CDS
Gene -
Product Molecular chaperone
Location 178582 - 179283 (strand: 1)
Length 702 (nucleotides) / 233 (amino acids)
In genomic island -

Contig

Accession ZDB_686
Length 191111 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_396
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00345 Pili and flagellar-assembly chaperone, PapD N-terminal domain
PF02753 Pili assembly chaperone PapD, C-terminal domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG3121 Extracellular structures (W) W P pilus assembly protein, chaperone PapD

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K07353 fimbrial chaperone protein - -

Protein Sequence

MYRSAFTMRKILFSFIIAFLFPAVASAGGIALGATRIIYPMEAKQVSLAVTNTDEKNRFLIQSWIDDASDKKTKVFTVTPPLFVSKPKSENTIKIINTGAELPKDRESLFWLNSKAIPSVEREQVADKNVLQIAVLARIKMFVRPAGLPVKAGDAYKMLKFNRISGGINVTNPSPYYLTVVNMMIGNQKIESFMVAPFAEKIVNTAQPAAGGISYQTINDYGANTPVINVNSY

Flanking regions ( +/- flanking 50bp)

TCATTTAACATATAAATAATAATTAAATATTCTCTGCGGGGATTTAAATAATGTACAGGTCAGCATTTACTATGAGAAAAATACTATTTTCTTTTATCATCGCATTCCTTTTTCCGGCTGTGGCATCGGCAGGCGGAATTGCTCTGGGTGCAACCCGTATTATTTATCCGATGGAGGCAAAACAGGTGTCTCTGGCGGTAACGAATACAGATGAAAAAAATCGCTTTCTGATTCAGTCCTGGATAGATGATGCTTCTGATAAAAAAACAAAAGTATTCACAGTGACTCCGCCTTTGTTTGTCAGTAAACCAAAGAGTGAAAATACAATAAAAATCATTAATACAGGTGCTGAGTTACCCAAAGACAGAGAGAGTTTATTCTGGCTGAACAGTAAAGCGATCCCGTCCGTTGAGCGTGAACAGGTTGCAGATAAAAACGTCCTGCAAATTGCCGTTCTGGCCAGGATCAAAATGTTTGTCCGCCCGGCCGGTTTACCGGTGAAAGCAGGTGATGCTTATAAAATGCTGAAGTTCAACAGAATCAGCGGCGGAATAAATGTGACTAACCCGTCACCTTATTACCTGACCGTTGTTAATATGATGATTGGCAATCAGAAAATTGAAAGTTTCATGGTCGCACCATTTGCTGAAAAAATAGTTAATACAGCACAACCAGCTGCCGGCGGAATATCATATCAGACAATTAATGACTATGGTGCCAATACGCCGGTAATTAACGTTAATTCATATTAACTACTGTTATCTTATTTTATACGGAGCGCATTTTATGCAGAAATTAACTC