Homologs in group_3126

Help

5 homologs were identified in 5 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_20015 FBDBKF_20015 100.0 Morganella morganii S1 - Type-1A pilin
EHELCC_03515 EHELCC_03515 100.0 Morganella morganii S2 - Type-1A pilin
NLDBIP_03515 NLDBIP_03515 100.0 Morganella morganii S4 - Type-1A pilin
LHKJJB_09345 LHKJJB_09345 100.0 Morganella morganii S3 - Type-1A pilin
PMI_RS07105 PMI_RS07105 35.8 Proteus mirabilis HI4320 - fimbrial protein

Distribution of the homologs in the orthogroup group_3126

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_3126

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P39264 9.12e-36 125 33 1 174 1 fimI Fimbrin-like protein FimI Escherichia coli (strain K12)
P37922 7.31e-34 120 36 1 155 3 fimI Fimbrin-like protein FimI Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q08456 5.29e-33 119 36 1 155 5 fimI Putative fimbrin-like protein FimI Salmonella typhi
P37921 1.9e-32 117 33 3 183 1 fimA Type-1 fimbrial protein, A chain Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P55223 8.74e-29 108 33 3 183 3 None Fimbrial subunit type 1 Salmonella typhimurium
P37920 1.54e-28 107 32 4 183 3 fimA Type-1 fimbrial protein, A chain Salmonella typhi
P0ABW5 5.52e-24 95 34 3 167 2 sfmA Uncharacterized fimbrial-like protein SfmA Escherichia coli (strain K12)
P0ABW6 5.52e-24 95 34 3 167 3 sfmA Uncharacterized fimbrial-like protein SfmA Escherichia coli O157:H7
P43660 2.97e-21 88 30 2 180 3 lpfA Long polar fimbria protein A Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P08189 3.95e-21 88 31 6 177 1 fimF Protein FimF Escherichia coli (strain K12)
P62605 2.06e-19 84 30 2 156 3 pilC Type-1 fimbrial protein, C chain Escherichia coli
P62606 2.06e-19 84 30 2 156 3 pilC Type-1 fimbrial protein, C chain Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q47223 2.72e-18 80 29 3 147 1 fimA Type-1 fimbrial protein, A chain Escherichia coli
Q8X5K5 3.77e-18 80 31 1 150 2 lpfA Probable major fimbrial subunit LpfA Escherichia coli O157:H7
P12730 3.63e-17 78 30 3 157 1 sfaA S-fimbrial protein subunit SfaA Escherichia coli O6:K15:H31 (strain 536 / UPEC)
P77789 1.88e-16 75 28 3 152 3 ydeS Uncharacterized fimbrial-like protein YdeS Escherichia coli (strain K12)
P75859 2.69e-15 73 29 3 153 2 ycbU Uncharacterized fimbrial-like protein YcbU Escherichia coli (strain K12)
P75860 2.04e-14 70 30 4 179 2 ycbV Uncharacterized fimbrial-like protein YcbV Escherichia coli (strain K12)
P12266 4.35e-14 70 29 3 135 1 None Fimbrial subunit type 1 Klebsiella pneumoniae
P04128 1.22e-13 68 29 3 133 1 fimA Type-1 fimbrial protein, A chain Escherichia coli (strain K12)
P13429 2.45e-13 67 28 5 177 1 sfaG S-fimbrial protein subunit SfaG Escherichia coli O6:K15:H31 (strain 536 / UPEC)
P12903 3.16e-13 67 27 3 135 1 fim Fimbrial subunit type 1 Klebsiella pneumoniae
P22595 1.4e-10 60 26 4 160 3 fimA Type-1 fimbrial protein subunit Serratia marcescens
P38052 8.64e-08 52 25 8 182 2 sfmF Uncharacterized fimbrial-like protein SfmF Escherichia coli (strain K12)
P45988 1.31e-06 50 25 7 212 3 hifA Major fimbrial subunit Haemophilus influenzae
Q03011 1.72e-06 49 26 7 183 1 mrpA Major MR/P fimbria protein Proteus mirabilis (strain HI4320)
P43664 1.98e-06 49 28 7 185 3 lpfE Protein LpfE Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P37909 5.82e-06 48 24 4 161 1 ybgD Uncharacterized fimbrial-like protein YbgD Escherichia coli (strain K12)
Q04681 1.62e-05 46 24 6 191 1 pmfA Major fimbrial subunit Proteus mirabilis (strain HI4320)
P53521 2.29e-05 46 25 6 187 3 pmfF Putative minor fimbrial subunit PmfF Proteus mirabilis (strain HI4320)
Q03846 3.4e-05 46 25 7 220 3 hifA Major fimbrial subunit Haemophilus influenzae
P04127 0.00012 44 27 6 169 1 papA Pap fimbrial major pilin protein Escherichia coli
Q8X5L0 0.00015 43 25 8 185 2 lpfE Probable fimbrial subunit LpfE Escherichia coli O157:H7

  • Number of RefSeq hits:

General

Source Morganella morganii S5
Locus tag HKOGLL_09630
Feature type CDS
Gene -
Product Type-1A pilin
Location 178008 - 178550 (strand: 1)
Length 543 (nucleotides) / 180 (amino acids)

Contig

Accession ZDB_686
Length 191111 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_3126
Orthogroup size 6
N. genomes 6

Actions

Genomic region

Domains

PF00419 Fimbrial protein

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG3539 Cell motility (N) N Pilin (type 1 fimbrial protein)

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K07351 fimbrial protein - -

Protein Sequence

MHKLISTVFLLCGISAGAYAGNKTHTIIDGGMVHLRGGLVEAGCTLSTNSENDVIDMGEFRTNQFKGTGSYSGNIPFKLVITNCSTAVSSKVGLSVFGYINEKDPQIIKLEDSDEAAKGVGIAILDSDGDIIIPDNIPSKWINFHEGENVLHFNARYRATDMQVTGGKANASVWFHLTYK

Flanking regions ( +/- flanking 50bp)

TTATCAGTGGCCCGGGTGACCGGGTCACTGTTTGCCGATTGGAGTAAAAAATGCATAAATTAATCAGCACGGTATTTTTATTGTGCGGTATTTCTGCCGGTGCTTATGCCGGAAATAAAACGCATACCATTATTGACGGGGGTATGGTGCATTTAAGAGGCGGGCTGGTGGAAGCCGGATGTACCCTTTCAACAAACAGCGAAAATGATGTTATTGATATGGGGGAATTCAGAACAAATCAGTTTAAGGGAACCGGCAGTTATTCAGGAAATATTCCGTTTAAGCTGGTAATAACCAATTGCAGTACAGCGGTAAGCAGCAAAGTCGGGCTTTCTGTCTTTGGCTATATTAATGAGAAAGATCCGCAAATAATTAAACTTGAAGACAGTGATGAAGCCGCAAAGGGTGTGGGAATAGCTATTCTGGATAGTGATGGCGATATTATTATTCCTGACAATATACCCTCAAAATGGATCAACTTTCACGAAGGTGAAAATGTATTACATTTTAATGCCAGATACAGAGCAACGGATATGCAGGTAACCGGCGGAAAAGCCAATGCATCAGTATGGTTTCATTTAACATATAAATAATAATTAAATATTCTCTGCGGGGATTTAAATAATGTACAGGTCAGCATTTA