Homologs in group_1291

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_07175 FBDBKF_07175 100.0 Morganella morganii S1 msbA lipid A ABC transporter ATP-binding protein/permease MsbA
EHELCC_03795 EHELCC_03795 100.0 Morganella morganii S2 msbA lipid A ABC transporter ATP-binding protein/permease MsbA
NLDBIP_03795 NLDBIP_03795 100.0 Morganella morganii S4 msbA lipid A ABC transporter ATP-binding protein/permease MsbA
LHKJJB_09625 LHKJJB_09625 100.0 Morganella morganii S3 msbA lipid A ABC transporter ATP-binding protein/permease MsbA
F4V73_RS01360 F4V73_RS01360 93.6 Morganella psychrotolerans msbA lipid A ABC transporter ATP-binding protein/permease MsbA
PMI_RS03530 PMI_RS03530 79.7 Proteus mirabilis HI4320 msbA lipid A ABC transporter ATP-binding protein/permease MsbA

Distribution of the homologs in the orthogroup group_1291

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1291

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q32E34 0.0 943 77 0 580 3 msbA ATP-dependent lipid A-core flippase Shigella dysenteriae serotype 1 (strain Sd197)
Q31YT6 0.0 943 77 0 580 3 msbA ATP-dependent lipid A-core flippase Shigella boydii serotype 4 (strain Sb227)
P63359 0.0 943 77 0 580 1 msbA ATP-dependent lipid A-core flippase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P63360 0.0 943 77 0 580 3 msbA ATP-dependent lipid A-core flippase Salmonella typhi
Q57R14 0.0 943 77 0 580 3 msbA ATP-dependent lipid A-core flippase Salmonella choleraesuis (strain SC-B67)
P60752 0.0 943 77 0 580 1 msbA ATP-dependent lipid A-core flippase Escherichia coli (strain K12)
P60753 0.0 943 77 0 580 1 msbA ATP-dependent lipid A-core flippase Escherichia coli O157:H7
Q1RDU4 0.0 942 77 0 580 3 msbA ATP-dependent lipid A-core flippase Escherichia coli (strain UTI89 / UPEC)
Q8FJB1 0.0 942 77 0 580 1 msbA ATP-dependent lipid A-core flippase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TJD9 0.0 942 77 0 580 3 msbA ATP-dependent lipid A-core flippase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q83LP0 0.0 942 77 0 580 3 msbA ATP-dependent lipid A-core flippase Shigella flexneri
Q5PGH0 0.0 942 77 0 579 3 msbA ATP-dependent lipid A-core flippase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q3Z3K7 0.0 941 77 0 580 3 msbA ATP-dependent lipid A-core flippase Shigella sonnei (strain Ss046)
Q2NUA5 0.0 913 75 0 581 3 msbA ATP-dependent lipid A-core flippase Sodalis glossinidius (strain morsitans)
Q7N6C6 0.0 908 77 0 581 3 msbA ATP-dependent lipid A-core flippase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q66CI3 0.0 899 75 0 581 3 msbA ATP-dependent lipid A-core flippase Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CGH0 0.0 899 75 0 581 3 msbA ATP-dependent lipid A-core flippase Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZGA9 0.0 899 75 0 581 3 msbA ATP-dependent lipid A-core flippase Yersinia pestis
Q1CA68 0.0 899 75 0 581 3 msbA ATP-dependent lipid A-core flippase Yersinia pestis bv. Antiqua (strain Antiqua)
Q6D437 0.0 874 75 0 581 3 msbA ATP-dependent lipid A-core flippase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q0I4C5 0.0 838 70 1 582 3 msbA ATP-dependent lipid A-core flippase Histophilus somni (strain 129Pt)
Q9KQW9 0.0 834 69 0 576 1 msbA ATP-dependent lipid A-core flippase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q5E0F2 0.0 829 68 0 576 3 msbA ATP-dependent lipid A-core flippase Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q87R16 0.0 826 69 0 579 3 msbA ATP-dependent lipid A-core flippase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q9CMG7 0.0 825 67 1 582 3 msbA ATP-dependent lipid A-core flippase Pasteurella multocida (strain Pm70)
Q7MJ07 0.0 824 67 0 579 3 msbA ATP-dependent lipid A-core flippase Vibrio vulnificus (strain YJ016)
Q8DAV2 0.0 824 67 0 579 3 msbA ATP-dependent lipid A-core flippase Vibrio vulnificus (strain CMCP6)
Q6LPK6 0.0 814 67 1 577 3 msbA ATP-dependent lipid A-core flippase Photobacterium profundum (strain SS9)
Q4QPI4 0.0 811 66 1 580 3 msbA ATP-dependent lipid A-core flippase Haemophilus influenzae (strain 86-028NP)
Q65U21 0.0 795 67 1 580 3 msbA ATP-dependent lipid A-core flippase Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q492S9 0.0 792 67 0 573 3 msbA ATP-dependent lipid A-core flippase Blochmanniella pennsylvanica (strain BPEN)
P44407 0.0 791 65 1 580 3 msbA ATP-dependent lipid A-core flippase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q7VL52 0.0 775 63 1 582 3 msbA ATP-dependent lipid A-core flippase Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q8D2U8 0.0 741 62 0 575 3 msbA ATP-dependent lipid A-core flippase Wigglesworthia glossinidia brevipalpis
Q7VR44 0.0 729 62 0 575 3 msbA ATP-dependent lipid A-core flippase Blochmanniella floridana
Q080T2 0.0 659 53 2 588 3 msbA ATP-dependent lipid A-core flippase Shewanella frigidimarina (strain NCIMB 400)
Q0HTS8 0.0 657 53 2 588 3 msbA ATP-dependent lipid A-core flippase Shewanella sp. (strain MR-7)
Q0HHH4 0.0 657 53 2 588 3 msbA ATP-dependent lipid A-core flippase Shewanella sp. (strain MR-4)
Q8EDF0 0.0 654 53 2 588 3 msbA ATP-dependent lipid A-core flippase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q12M46 0.0 650 52 2 588 3 msbA ATP-dependent lipid A-core flippase Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q5QU36 0.0 645 54 0 577 3 msbA ATP-dependent lipid A-core flippase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q483B6 0.0 611 51 3 586 3 msbA1 ATP-dependent lipid A-core flippase 1 Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q3IGX5 0.0 605 50 1 578 3 msbA ATP-dependent lipid A-core flippase Pseudoalteromonas translucida (strain TAC 125)
Q15UY7 0.0 601 52 0 575 3 msbA ATP-dependent lipid A-core flippase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q3J7R8 0.0 542 45 0 570 3 msbA ATP-dependent lipid A-core flippase Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
Q480N3 1.35e-176 514 44 0 567 3 msbA2 ATP-dependent lipid A-core flippase 2 Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q3SFZ6 1.14e-172 504 45 0 573 3 msbA ATP-dependent lipid A-core flippase Thiobacillus denitrificans (strain ATCC 25259)
Q5ZUH9 5.5e-172 503 43 4 581 3 msbA ATP-dependent lipid A-core flippase Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q83D84 2.84e-171 501 43 2 571 3 msbA ATP-dependent lipid A-core flippase Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
Q21WN9 1.25e-170 499 45 1 578 3 msbA ATP-dependent lipid A-core flippase Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q5X498 6.61e-170 498 43 4 581 3 msbA ATP-dependent lipid A-core flippase Legionella pneumophila (strain Paris)
Q2SIN5 2.89e-168 493 46 0 515 3 msbA ATP-dependent lipid A-core flippase Hahella chejuensis (strain KCTC 2396)
Q5WVN2 3.75e-168 493 44 6 582 3 msbA ATP-dependent lipid A-core flippase Legionella pneumophila (strain Lens)
Q1GZI0 8.7e-166 487 43 1 573 3 msbA ATP-dependent lipid A-core flippase Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q60AA3 3.33e-165 486 42 0 570 3 msbA ATP-dependent lipid A-core flippase Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q1QX69 6.27e-165 485 41 2 568 3 msbA ATP-dependent lipid A-core flippase Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q47JR8 1.23e-162 479 44 2 576 3 msbA ATP-dependent lipid A-core flippase Dechloromonas aromatica (strain RCB)
Q31FG2 4.16e-162 478 42 1 571 3 msbA ATP-dependent lipid A-core flippase Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q7NZU6 5.76e-162 477 41 1 579 3 msbA ATP-dependent lipid A-core flippase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q0BKJ3 9.5e-162 478 42 3 575 3 msbA ATP-dependent lipid A-core flippase Francisella tularensis subsp. holarctica (strain OSU18)
Q2A1U9 9.5e-162 478 42 3 575 3 msbA ATP-dependent lipid A-core flippase Francisella tularensis subsp. holarctica (strain LVS)
Q0A4U4 9.14e-161 474 43 0 568 3 msbA ATP-dependent lipid A-core flippase Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q5NIG3 1.08e-160 475 42 3 575 3 msbA ATP-dependent lipid A-core flippase Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q14JW6 1.08e-160 475 42 3 575 1 msbA ATP-dependent lipid A-core flippase Francisella tularensis subsp. tularensis (strain FSC 198)
Q4FS42 1.72e-159 471 43 4 572 3 msbA ATP-dependent lipid A-core flippase Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q39E73 2.9e-159 471 41 2 580 3 msbA ATP-dependent lipid A-core flippase Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q1QBW0 2.25e-157 466 43 3 571 3 msbA ATP-dependent lipid A-core flippase Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q1BUV6 3.84e-157 465 41 2 580 3 msbA ATP-dependent lipid A-core flippase Burkholderia orbicola (strain AU 1054)
Q142P6 7.34e-157 465 42 4 575 3 msbA ATP-dependent lipid A-core flippase Paraburkholderia xenovorans (strain LB400)
Q3KJ31 4.93e-156 462 42 4 579 3 msbA ATP-dependent lipid A-core flippase Pseudomonas fluorescens (strain Pf0-1)
Q4KJB2 9.44e-156 462 45 1 519 3 msbA ATP-dependent lipid A-core flippase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q47908 1.71e-154 459 42 3 551 3 msbA ATP-dependent lipid A-core flippase Francisella novicida
Q8XXB6 3.86e-154 457 39 1 570 3 msbA ATP-dependent lipid A-core flippase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q3BTC8 4.22e-154 457 41 0 574 3 msbA ATP-dependent lipid A-core flippase Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q0VQP5 1.13e-153 456 42 7 573 3 msbA ATP-dependent lipid A-core flippase Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q8PKS5 1.3e-153 456 40 0 574 3 msbA ATP-dependent lipid A-core flippase Xanthomonas axonopodis pv. citri (strain 306)
Q8P8W4 1.33e-153 456 41 0 574 3 msbA ATP-dependent lipid A-core flippase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q4UV65 1.33e-153 456 41 0 574 3 msbA ATP-dependent lipid A-core flippase Xanthomonas campestris pv. campestris (strain 8004)
Q5H0H0 5.2e-153 454 40 0 578 3 msbA ATP-dependent lipid A-core flippase Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q2P3E7 5.2e-153 454 40 0 578 3 msbA ATP-dependent lipid A-core flippase Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q9HUG8 1.71e-151 451 40 4 585 3 msbA ATP-dependent lipid A-core flippase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q1LQD3 2.67e-150 448 41 2 574 3 msbA ATP-dependent lipid A-core flippase Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q63VX7 3.39e-149 445 40 4 573 3 msbA ATP-dependent lipid A-core flippase Burkholderia pseudomallei (strain K96243)
Q3JUI6 3.39e-149 445 40 4 573 3 msbA ATP-dependent lipid A-core flippase Burkholderia pseudomallei (strain 1710b)
Q62IG3 3.39e-149 445 40 4 573 3 msbA ATP-dependent lipid A-core flippase Burkholderia mallei (strain ATCC 23344)
Q2SZW0 6.21e-149 444 40 4 573 3 msbA ATP-dependent lipid A-core flippase Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q5P2S7 6.96e-149 444 41 4 585 3 msbA ATP-dependent lipid A-core flippase Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
Q87VF3 2.69e-148 443 41 3 582 3 msbA ATP-dependent lipid A-core flippase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q48P40 3.46e-147 440 41 3 579 3 msbA ATP-dependent lipid A-core flippase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q87EF0 5.76e-147 439 40 0 570 3 msbA ATP-dependent lipid A-core flippase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q9PEE7 2e-146 438 40 0 570 3 msbA ATP-dependent lipid A-core flippase Xylella fastidiosa (strain 9a5c)
Q46Y89 8.79e-145 434 39 1 569 3 msbA ATP-dependent lipid A-core flippase Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q88D92 1.1e-144 434 40 3 583 3 msbA ATP-dependent lipid A-core flippase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q4ZZ16 5.75e-144 432 41 3 579 3 msbA ATP-dependent lipid A-core flippase Pseudomonas syringae pv. syringae (strain B728a)
Q7VWD8 6.26e-142 427 38 1 571 3 msbA ATP-dependent lipid A-core flippase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7W9N7 6.68e-142 427 38 1 571 3 msbA ATP-dependent lipid A-core flippase Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WH20 6.68e-142 427 38 1 571 3 msbA ATP-dependent lipid A-core flippase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q2KYS6 6.96e-140 421 37 1 571 3 msbA ATP-dependent lipid A-core flippase Bordetella avium (strain 197N)
Q21NS8 8.62e-140 421 40 5 580 3 msbA ATP-dependent lipid A-core flippase Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q6AJW3 5.7e-139 418 39 4 575 3 msbA ATP-dependent lipid A-core flippase Desulfotalea psychrophila (strain LSv54 / DSM 12343)
Q2LVL0 1.14e-133 405 37 4 571 3 msbA ATP-dependent lipid A-core flippase Syntrophus aciditrophicus (strain SB)
Q6F9X0 1.47e-130 397 39 5 573 3 msbA ATP-dependent lipid A-core flippase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q12C33 6.8e-125 382 36 2 573 3 msbA ATP-dependent lipid A-core flippase Polaromonas sp. (strain JS666 / ATCC BAA-500)
Q9JXR3 4.65e-123 379 35 3 599 3 msbA ATP-dependent lipid A-core flippase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q5F4X8 2.25e-122 377 35 3 597 3 msbA ATP-dependent lipid A-core flippase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q9JW59 5.27e-122 376 35 3 599 3 msbA ATP-dependent lipid A-core flippase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q9WYC4 5.89e-106 334 33 7 579 1 TM_0288 Uncharacterized ABC transporter ATP-binding protein TM_0288 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q2G2M9 8.71e-103 325 33 6 578 3 SAOUHSC_02003 Putative multidrug export ATP-binding/permease protein SAOUHSC_02003 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q6GFJ1 8.71e-103 325 33 6 578 3 SAR1956 Putative multidrug export ATP-binding/permease protein SAR1956 Staphylococcus aureus (strain MRSA252)
Q5HEQ8 8.71e-103 325 33 6 578 3 SACOL1924 Putative multidrug export ATP-binding/permease protein SACOL1924 Staphylococcus aureus (strain COL)
Q99T13 8.71e-103 325 33 6 578 1 SAV1866 Putative multidrug export ATP-binding/permease protein SAV1866 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q2FFM9 8.71e-103 325 33 6 578 3 SAUSA300_1847 Putative multidrug export ATP-binding/permease protein SAUSA300_1847 Staphylococcus aureus (strain USA300)
Q7A0J1 8.71e-103 325 33 6 578 3 MW1806 Putative multidrug export ATP-binding/permease protein MW1806 Staphylococcus aureus (strain MW2)
Q6G868 8.71e-103 325 33 6 578 3 SAS1788 Putative multidrug export ATP-binding/permease protein SAS1788 Staphylococcus aureus (strain MSSA476)
Q7A4T3 8.71e-103 325 33 6 578 1 SA1683 Putative multidrug export ATP-binding/permease protein SA1683 Staphylococcus aureus (strain N315)
P45861 9.12e-103 325 34 9 588 1 ywjA Uncharacterized ABC transporter ATP-binding protein YwjA Bacillus subtilis (strain 168)
P71082 9.3e-103 325 33 4 574 3 ygaD Putative multidrug export ATP-binding/permease protein YgaD Bacillus subtilis (strain 168)
Q2YU20 1.85e-100 319 33 6 578 3 SAB1799c Putative multidrug export ATP-binding/permease protein SAB1799c Staphylococcus aureus (strain bovine RF122 / ET3-1)
O31707 2.95e-99 316 32 2 572 3 yknU Uncharacterized ABC transporter ATP-binding protein YknU Bacillus subtilis (strain 168)
P55469 1.55e-96 309 34 3 506 3 NGR_a03510 Uncharacterized ABC transporter ATP-binding protein y4gM Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P54719 5.42e-94 303 32 7 582 3 yfiC Uncharacterized ABC transporter ATP-binding protein YfiC Bacillus subtilis (strain 168)
P22638 4.32e-91 295 34 9 554 2 hepA Heterocyst differentiation ATP-binding protein HepA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
O06967 2.16e-90 293 33 6 545 1 bmrA Multidrug resistance ABC transporter ATP-binding/permease protein BmrA Bacillus subtilis (strain 168)
Q9FNU2 5.3e-90 293 33 5 532 2 ABCB25 ABC transporter B family member 25 Oryza sativa subsp. japonica
P08183 1.92e-88 301 38 11 507 1 ABCB1 ATP-dependent translocase ABCB1 Homo sapiens
P08183 2e-75 264 32 9 540 1 ABCB1 ATP-dependent translocase ABCB1 Homo sapiens
O31708 1.08e-86 284 31 6 571 3 yknV Uncharacterized ABC transporter ATP-binding protein YknV Bacillus subtilis (strain 168)
P21440 5.71e-86 294 36 7 507 1 Abcb4 Phosphatidylcholine translocator ABCB4 Mus musculus
P21440 9.14e-78 271 30 14 582 1 Abcb4 Phosphatidylcholine translocator ABCB4 Mus musculus
P21447 6.06e-86 294 37 11 507 1 Abcb1a ATP-dependent translocase ABCB1 Mus musculus
P21447 1.17e-78 273 33 11 536 1 Abcb1a ATP-dependent translocase ABCB1 Mus musculus
O07549 6.23e-86 283 32 6 516 1 yheH Probable multidrug resistance ABC transporter ATP-binding/permease protein YheH Bacillus subtilis (strain 168)
Q9NRK6 6.3e-86 285 35 4 492 1 ABCB10 ATP-binding cassette sub-family B member 10, mitochondrial Homo sapiens
Q54BU4 6.43e-86 289 31 4 569 3 abcB1 ABC transporter B family member 1 Dictyostelium discoideum
Q9QYJ4 6.49e-86 286 32 6 577 1 Abcb9 ABC-type oligopeptide transporter ABCB9 Rattus norvegicus
Q9JJ59 9.75e-86 285 32 6 577 1 Abcb9 ABC-type oligopeptide transporter ABCB9 Mus musculus
Q9JI39 1.03e-85 284 32 5 534 1 Abcb10 ATP-binding cassette sub-family B member 10, mitochondrial Mus musculus
P21448 1.31e-85 293 37 11 505 1 ABCB1 ATP-dependent translocase ABCB1 Cricetulus griseus
P21448 5.86e-77 268 32 10 536 1 ABCB1 ATP-dependent translocase ABCB1 Cricetulus griseus
P43245 2.77e-85 292 38 12 505 2 Abcb1 ATP-dependent translocase ABCB1 Rattus norvegicus
P43245 5.26e-75 263 33 13 529 2 Abcb1 ATP-dependent translocase ABCB1 Rattus norvegicus
P21449 7.45e-85 291 37 12 506 2 PGY2 Multidrug resistance protein 2 Cricetulus griseus
P21449 4.34e-76 266 32 10 528 2 PGY2 Multidrug resistance protein 2 Cricetulus griseus
Q9CXJ4 1.24e-84 281 35 8 516 1 Abcb8 Mitochondrial potassium channel ATP-binding subunit Mus musculus
P21439 1.57e-84 290 36 7 507 1 ABCB4 Phosphatidylcholine translocator ABCB4 Homo sapiens
P21439 4.94e-72 254 31 12 586 1 ABCB4 Phosphatidylcholine translocator ABCB4 Homo sapiens
Q9NP78 2.1e-84 282 31 6 577 1 ABCB9 ABC-type oligopeptide transporter ABCB9 Homo sapiens
P06795 3.57e-84 289 37 12 505 1 Abcb1b ATP-dependent translocase ABCB1 Mus musculus
P06795 7.84e-76 265 32 11 527 1 Abcb1b ATP-dependent translocase ABCB1 Mus musculus
P23174 4.58e-84 288 35 7 507 2 ABCB4 Phosphatidylcholine translocator ABCB4 Cricetulus griseus
P23174 1.02e-76 268 30 13 581 2 ABCB4 Phosphatidylcholine translocator ABCB4 Cricetulus griseus
P9WQJ3 1.09e-83 276 34 2 481 1 Rv1272c Fatty acid ABC transporter ATP-binding/permease protein Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQJ2 1.09e-83 276 34 2 481 3 MT1310 Fatty acid ABC transporter ATP-binding/permease protein Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63398 1.09e-83 276 34 2 481 3 BQ2027_MB1303C Fatty acid ABC transporter ATP-binding/permease protein Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q9FWX7 1.13e-83 287 35 11 531 2 ABCB11 ABC transporter B family member 11 Arabidopsis thaliana
Q9FWX7 2.93e-74 261 32 12 567 2 ABCB11 ABC transporter B family member 11 Arabidopsis thaliana
Q0WML0 3.13e-83 276 34 5 506 1 ABCB27 ABC transporter B family member 27 Arabidopsis thaliana
Q08201 3.38e-83 286 36 7 494 1 Abcb4 Phosphatidylcholine translocator ABCB4 Rattus norvegicus
Q08201 8e-77 268 30 14 582 1 Abcb4 Phosphatidylcholine translocator ABCB4 Rattus norvegicus
Q9C7F2 5.54e-83 285 35 10 526 3 ABCB14 ABC transporter B family member 14 Arabidopsis thaliana
Q9C7F2 2.08e-71 252 32 8 506 3 ABCB14 ABC transporter B family member 14 Arabidopsis thaliana
Q5RKI8 2.92e-82 275 34 8 516 2 Abcb8 Mitochondrial potassium channel ATP-binding subunit Rattus norvegicus
Q9C7F8 9.82e-82 282 35 13 527 3 ABCB13 ABC transporter B family member 13 Arabidopsis thaliana
Q9C7F8 3.54e-75 263 32 5 500 3 ABCB13 ABC transporter B family member 13 Arabidopsis thaliana
Q56A55 1.56e-81 273 35 7 516 2 abcb8 Mitochondrial potassium channel ATP-binding subunit Danio rerio
O80725 1.63e-81 281 35 10 500 1 ABCB4 ABC transporter B family member 4 Arabidopsis thaliana
O80725 4.44e-77 269 32 15 568 1 ABCB4 ABC transporter B family member 4 Arabidopsis thaliana
Q9FHF1 3.16e-81 280 32 11 572 3 ABCB7 ABC transporter B family member 7 Arabidopsis thaliana
Q9FHF1 3.36e-72 254 32 13 589 3 ABCB7 ABC transporter B family member 7 Arabidopsis thaliana
Q9SYI3 4.27e-81 280 33 13 571 3 ABCB5 ABC transporter B family member 5 Arabidopsis thaliana
Q9SYI3 1.08e-75 265 33 11 524 3 ABCB5 ABC transporter B family member 5 Arabidopsis thaliana
Q5RFQ9 4.42e-81 272 34 7 514 2 ABCB8 Mitochondrial potassium channel ATP-binding subunit Pongo abelii
Q2ULH4 5.11e-81 271 34 7 496 3 atm1 Iron-sulfur clusters transporter atm1, mitochondrial Aspergillus oryzae (strain ATCC 42149 / RIB 40)
Q9M1Q9 1.24e-80 279 32 12 607 1 ABCB21 ABC transporter B family member 21 Arabidopsis thaliana
Q9M1Q9 2.18e-80 278 33 7 520 1 ABCB21 ABC transporter B family member 21 Arabidopsis thaliana
Q9NUT2 1.33e-80 271 34 7 514 1 ABCB8 Mitochondrial potassium channel ATP-binding subunit Homo sapiens
Q9FWX8 1.44e-80 278 34 14 582 2 ABCB12 ABC transporter B family member 12 Arabidopsis thaliana
Q9FWX8 1.06e-76 268 32 10 549 2 ABCB12 ABC transporter B family member 12 Arabidopsis thaliana
Q7RX59 2.8e-80 270 30 10 591 3 fes-4 Iron-sulfur clusters transporter atm1, mitochondrial Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
P47261 2.69e-79 264 33 8 496 3 MG015 Putative ABC transporter ATP-binding protein MG015 Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
B2GUP8 2.92e-79 266 35 9 518 2 abcb8 Mitochondrial potassium channel ATP-binding subunit Xenopus tropicalis
Q9SGY1 5.29e-79 274 34 9 510 1 ABCB10 ABC transporter B family member 10 Arabidopsis thaliana
Q9SGY1 2.53e-68 243 30 13 597 1 ABCB10 ABC transporter B family member 10 Arabidopsis thaliana
Q9DC29 1.11e-78 268 35 11 487 1 Abcb6 ATP-binding cassette sub-family B member 6 Mus musculus
G5EG61 1.43e-78 273 33 7 521 2 pgp-14 P-glycoprotein 14 Caenorhabditis elegans
G5EG61 4.88e-70 249 33 8 510 2 pgp-14 P-glycoprotein 14 Caenorhabditis elegans
Q54W24 2.55e-78 265 35 6 483 3 abcB4 ABC transporter B family member 4 Dictyostelium discoideum
P34712 2.57e-78 273 35 9 503 1 pgp-1 Multidrug resistance protein pgp-1 Caenorhabditis elegans
P34712 9.15e-76 265 33 12 546 1 pgp-1 Multidrug resistance protein pgp-1 Caenorhabditis elegans
P26760 2.82e-78 264 32 12 550 1 apxIB Toxin RTX-I translocation ATP-binding protein Actinobacillus pleuropneumoniae
Q2HIE9 4.03e-78 261 32 7 499 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Chaetomium globosum (strain ATCC 6205 / CBS 148.51 / DSM 1962 / NBRC 6347 / NRRL 1970)
Q46717 5e-78 263 33 11 512 3 hlyB Alpha-hemolysin translocation ATP-binding protein HlyB Escherichia coli O157:H7
P34713 6.57e-78 271 34 9 515 2 pgp-3 Multidrug resistance protein pgp-3 Caenorhabditis elegans
P34713 4.95e-72 254 32 16 602 2 pgp-3 Multidrug resistance protein pgp-3 Caenorhabditis elegans
P08716 1.4e-77 262 31 11 547 1 hlyB Alpha-hemolysin translocation ATP-binding protein HlyB Escherichia coli
Q9CHL8 3.22e-77 258 32 3 486 1 lmrA Multidrug resistance ABC transporter ATP-binding and permease protein Lactococcus lactis subsp. lactis (strain IL1403)
P10089 3.24e-77 261 31 11 547 3 hlyB Alpha-hemolysin translocation ATP-binding protein HlyB Escherichia coli
P16875 3.61e-77 269 33 9 512 3 MDR1 Multidrug resistance protein 1 Entamoeba histolytica (strain ATCC 30459 / HM-1:IMSS / ABRM)
P16875 4.61e-67 240 31 9 520 3 MDR1 Multidrug resistance protein 1 Entamoeba histolytica (strain ATCC 30459 / HM-1:IMSS / ABRM)
Q47258 5.06e-77 261 31 11 548 1 hlyB Alpha-hemolysin translocation ATP-binding protein HlyB Escherichia coli
Q4HVU7 5.21e-77 260 32 6 484 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
A0A125QXJ1 5.28e-77 263 36 12 486 2 ABCB6 ATP-binding cassette sub-family B member 6 Mesocricetus auratus
Q9M0M2 5.61e-77 268 32 12 575 3 ABCB9 ABC transporter B family member 9 Arabidopsis thaliana
Q9M0M2 9.26e-75 262 34 10 529 3 ABCB9 ABC transporter B family member 9 Arabidopsis thaliana
Q6C6N0 1.79e-76 259 31 6 492 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Yarrowia lipolytica (strain CLIB 122 / E 150)
Q8FDZ8 2.03e-76 259 31 11 548 1 hlyB Alpha-hemolysin translocation ATP-binding protein HlyB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q02592 2.27e-76 261 33 7 486 2 hmt1 Heavy metal tolerance protein Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q4WPP6 2.33e-76 261 35 10 517 2 mdr2 ABC multidrug transporter mdr2 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q933I3 2.74e-76 259 31 13 552 3 lktB Leukotoxin translocation ATP-binding protein LktB Mannheimia glucosida
Q9NP58 3.36e-76 261 35 12 491 1 ABCB6 ATP-binding cassette sub-family B member 6 Homo sapiens
P23702 4.07e-76 258 32 13 550 1 ltxB Leukotoxin export ATP-binding protein LtxB Aggregatibacter actinomycetemcomitans
P16876 4.3e-76 266 33 13 545 3 MDR3 Multidrug resistance protein 3 Entamoeba histolytica (strain ATCC 30459 / HM-1:IMSS / ABRM)
P16876 5.68e-70 248 31 8 514 3 MDR3 Multidrug resistance protein 3 Entamoeba histolytica (strain ATCC 30459 / HM-1:IMSS / ABRM)
Q8T9W4 4.39e-76 266 34 11 499 3 abcB3 ABC transporter B family member 3 Dictyostelium discoideum
Q8T9W4 1.58e-68 244 32 12 561 3 abcB3 ABC transporter B family member 3 Dictyostelium discoideum
Q93FH6 6.41e-76 258 31 13 552 3 lktB Leukotoxin translocation ATP-binding protein LktB Mannheimia haemolytica
Q93FH2 6.41e-76 258 31 13 552 3 lktB Leukotoxin translocation ATP-binding protein LktB Mannheimia haemolytica
P77265 6.73e-76 255 31 3 518 3 mdlA Multidrug resistance-like ATP-binding protein MdlA Escherichia coli (strain K12)
Q9LJX0 7.42e-76 265 34 8 518 1 ABCB19 ABC transporter B family member 19 Arabidopsis thaliana
Q9LJX0 3.89e-63 228 30 5 500 1 ABCB19 ABC transporter B family member 19 Arabidopsis thaliana
Q933E0 8.66e-76 258 31 13 552 3 lktB Leukotoxin translocation ATP-binding protein LktB Bibersteinia trehalosi
P0C086 9.03e-76 257 31 13 552 3 lktB Leukotoxin translocation ATP-binding protein LktB Mannheimia haemolytica
P0C087 9.03e-76 257 31 13 552 3 lktB Leukotoxin translocation ATP-binding protein LktB Mannheimia haemolytica
Q93FH0 9.51e-76 257 31 13 552 3 lktB Leukotoxin translocation ATP-binding protein LktB Mannheimia haemolytica
Q4WLN7 1.23e-75 258 34 8 502 3 atm1 Iron-sulfur clusters transporter atm1, mitochondrial Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
P35598 1.52e-75 254 30 7 520 3 exp8 Putative ABC transporter ATP-binding protein exp8 Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
P16532 1.79e-75 256 31 13 552 3 lktB Leukotoxin translocation ATP-binding protein LktB Mannheimia haemolytica
A0A1U8QG99 2.37e-75 264 33 10 541 2 atrC ABC multidrug transporter atrC Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
A0A1U8QG99 3.54e-52 196 30 16 581 2 atrC ABC multidrug transporter atrC Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q9SYI2 2.45e-75 263 32 11 524 3 ABCB3 ABC transporter B family member 3 Arabidopsis thaliana
Q9SYI2 1.24e-73 259 33 13 566 3 ABCB3 ABC transporter B family member 3 Arabidopsis thaliana
Q93FH3 2.47e-75 256 31 13 552 3 lktB Leukotoxin translocation ATP-binding protein LktB Mannheimia haemolytica
B5X0E4 3.43e-75 263 34 12 531 2 Abcb5 ATP-binding cassette sub-family B member 5 Mus musculus
B5X0E4 3.77e-71 251 30 7 517 2 Abcb5 ATP-binding cassette sub-family B member 5 Mus musculus
Q8LPK2 4.61e-75 263 33 10 513 1 ABCB2 ABC transporter B family member 2 Arabidopsis thaliana
Q8LPK2 3e-63 229 31 13 523 1 ABCB2 ABC transporter B family member 2 Arabidopsis thaliana
P0DKX6 5.61e-75 255 31 8 551 3 cyaB Cyclolysin secretion/processing ATP-binding protein CyaB Bordetella pertussis (strain ATCC 9797 / DSM 5571 / CCUG 30873 / LMG 14455 / NCTC 10739 / 18323)
Q54BT3 5.79e-75 263 30 9 581 3 abcB2 ABC transporter B family member 2 Dictyostelium discoideum
Q54BT3 2.41e-65 235 30 8 557 3 abcB2 ABC transporter B family member 2 Dictyostelium discoideum
Q9ZR72 6.17e-75 263 33 12 542 1 ABCB1 ABC transporter B family member 1 Arabidopsis thaliana
Q9ZR72 8.8e-67 239 34 12 496 1 ABCB1 ABC transporter B family member 1 Arabidopsis thaliana
Q4WTT9 7.35e-75 263 34 11 523 2 mdr1 ABC multidrug transporter mdr1 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WTT9 8.69e-71 251 32 13 550 2 mdr1 ABC multidrug transporter mdr1 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q6BXD7 7.83e-75 254 30 13 586 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
P55122 9.09e-75 254 31 12 551 3 lktB Leukotoxin translocation ATP-binding protein LktB Pasteurella haemolytica-like sp. (strain 5943B)
P97046 9.79e-75 252 32 3 486 3 lmrA Multidrug resistance ABC transporter ATP-binding and permease protein Lactococcus lactis subsp. cremoris (strain MG1363)
O70595 1e-74 257 36 13 488 1 Abcb6 ATP-binding cassette sub-family B member 6 Rattus norvegicus
Q9FUT3 1.12e-74 254 33 7 500 1 ABCB23 ABC transporter B family member 23, mitochondrial Arabidopsis thaliana
Q4WA92 1.21e-74 262 35 11 520 2 abcE ABC multidrug transporter E Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WA92 1.16e-53 201 28 17 596 2 abcE ABC multidrug transporter E Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
P0DKX5 1.47e-74 254 31 8 551 3 cyaB Cyclolysin secretion/processing ATP-binding protein CyaB Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q93FG6 1.84e-74 254 31 13 552 3 lktB Leukotoxin translocation ATP-binding protein LktB Mannheimia haemolytica
P16877 1.86e-74 261 32 9 517 3 MDR4 Multidrug resistance protein 4 Entamoeba histolytica (strain ATCC 30459 / HM-1:IMSS / ABRM)
P16877 2.66e-69 246 31 8 531 3 MDR4 Multidrug resistance protein 4 Entamoeba histolytica (strain ATCC 30459 / HM-1:IMSS / ABRM)
Q9Y8G2 2.64e-74 261 33 10 541 2 atrC ABC multidrug transporter atrC Emericella nidulans
Q9Y8G2 3.47e-52 196 30 16 581 2 atrC ABC multidrug transporter atrC Emericella nidulans
Q8K985 3.01e-74 250 29 3 489 3 mdlA Multidrug resistance-like ATP-binding protein MdlA Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q8T9W2 3.04e-74 253 34 9 480 3 abcB5 ABC transporter B family member 5 Dictyostelium discoideum
Q5B1Q2 3.51e-74 253 33 8 497 3 atm1 Iron-sulfur clusters transporter atm1, mitochondrial Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q6YUU5 4.78e-74 260 32 12 592 3 Os02g0190300 Putative multidrug resistance protein Oryza sativa subsp. japonica
Q6YUU5 4.99e-72 254 35 11 512 3 Os02g0190300 Putative multidrug resistance protein Oryza sativa subsp. japonica
Q00449 1.04e-73 259 33 12 499 2 Mdr49 Multidrug resistance protein homolog 49 Drosophila melanogaster
Q00449 6.74e-69 245 31 13 602 2 Mdr49 Multidrug resistance protein homolog 49 Drosophila melanogaster
P36619 1.12e-73 259 34 10 505 3 pmd1 Leptomycin B resistance protein pmd1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P36619 1.39e-61 224 29 8 532 3 pmd1 Leptomycin B resistance protein pmd1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9LSJ2 1.3e-73 258 34 7 525 3 ABCB22 ABC transporter B family member 22 Arabidopsis thaliana
Q9LSJ2 2.59e-69 246 31 13 568 3 ABCB22 ABC transporter B family member 22 Arabidopsis thaliana
Q9RCG7 3.16e-73 251 31 12 547 3 paxB Exotoxin translocation ATP-binding protein PaxB Pasteurella aerogenes
Q57180 3.98e-73 248 31 15 597 3 HI_1051 Uncharacterized ABC transporter ATP-binding protein HI_1051 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
B8K1W2 4.27e-73 258 34 9 516 1 Abcb11e Bile salt export pump Canis lupus familiaris
B8K1W2 3.17e-64 232 29 11 596 1 Abcb11e Bile salt export pump Canis lupus familiaris
P54718 1.68e-72 245 30 10 567 3 yfiB Uncharacterized ABC transporter ATP-binding protein YfiB Bacillus subtilis (strain 168)
Q2M3G0 1.91e-72 255 31 7 525 1 ABCB5 ATP-binding cassette sub-family B member 5 Homo sapiens
Q2M3G0 2.11e-68 244 30 14 577 1 ABCB5 ATP-binding cassette sub-family B member 5 Homo sapiens
P75094 2.12e-72 247 33 12 502 3 MPN_019 Putative ABC transporter ATP-binding protein MG015 homolog Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
H2LNR5 2.33e-72 249 34 11 503 1 abcb7 Iron-sulfur clusters transporter ABCB7, mitochondrial Oryzias latipes
F2SQT8 5.59e-72 254 32 9 516 1 MDR5 ABC multidrug transporter MDR5 Trichophyton rubrum (strain ATCC MYA-4607 / CBS 118892)
F2SQT8 1.52e-56 209 29 13 535 1 MDR5 ABC multidrug transporter MDR5 Trichophyton rubrum (strain ATCC MYA-4607 / CBS 118892)
Q9Y8G1 8.04e-72 254 33 15 612 1 atrD ABC multidrug transporter atrD Emericella nidulans
Q9Y8G1 1.39e-68 244 32 13 549 1 atrD ABC multidrug transporter atrD Emericella nidulans
J9VF33 1.19e-71 253 34 13 521 1 MDR1 ABC multidrug transporter MDR1 Cryptococcus neoformans var. grubii serotype A (strain H99 / ATCC 208821 / CBS 10515 / FGSC 9487)
J9VF33 2.61e-62 226 33 12 501 1 MDR1 ABC multidrug transporter MDR1 Cryptococcus neoformans var. grubii serotype A (strain H99 / ATCC 208821 / CBS 10515 / FGSC 9487)
Q9M0G9 1.22e-71 246 32 8 503 1 ABCB24 ABC transporter B family member 24, mitochondrial Arabidopsis thaliana
Q89UT8 1.48e-71 244 34 12 492 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q9LSJ5 2.3e-71 252 34 13 535 3 ABCB18 ABC transporter B family member 18 Arabidopsis thaliana
Q9LSJ5 2.67e-68 243 31 13 570 3 ABCB18 ABC transporter B family member 18 Arabidopsis thaliana
Q20Z38 2.88e-71 243 33 13 531 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Rhodopseudomonas palustris (strain BisB18)
Q5BAY0 3.82e-71 252 35 13 527 1 atrD ABC multidrug transporter atrD Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5BAY0 1.38e-68 244 32 13 549 1 atrD ABC multidrug transporter atrD Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
O07550 5.33e-71 242 31 6 486 1 yheI Probable multidrug resistance ABC transporter ATP-binding/permease protein YheI Bacillus subtilis (strain 168)
O95342 6.12e-71 251 33 9 512 1 ABCB11 Bile salt export pump Homo sapiens
O95342 3.15e-65 234 29 14 603 1 ABCB11 Bile salt export pump Homo sapiens
Q9LSJ6 6.51e-71 251 32 11 534 3 ABCB17 ABC transporter B family member 17 Arabidopsis thaliana
Q9LSJ6 1.44e-70 250 32 17 582 3 ABCB17 ABC transporter B family member 17 Arabidopsis thaliana
O70127 8.39e-71 251 34 10 525 1 Abcb11 Bile salt export pump Rattus norvegicus
O70127 1.95e-64 232 31 15 586 1 Abcb11 Bile salt export pump Rattus norvegicus
Q71ED1 9.55e-71 241 33 3 475 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Agrobacterium vitis
E7F6F7 1.18e-70 244 34 11 500 3 abcb7 Iron-sulfur clusters transporter ABCB7, mitochondrial Danio rerio
P11599 1.31e-70 243 31 11 550 3 hlyB Alpha-hemolysin translocation ATP-binding protein HlyB Proteus vulgaris
P33311 1.46e-70 244 33 6 496 1 MDL2 ATP-dependent permease MDL2, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9LHD1 1.81e-70 249 33 9 527 3 ABCB15 ABC transporter B family member 15 Arabidopsis thaliana
Q9LHD1 1.1e-63 230 32 11 512 3 ABCB15 ABC transporter B family member 15 Arabidopsis thaliana
Q4PH16 2.44e-70 244 30 9 520 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Ustilago maydis (strain 521 / FGSC 9021)
Q6N1Y7 2.44e-70 240 35 7 489 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
H6TB12 2.57e-70 249 31 10 522 1 mdr Sophorolipid transporter Starmerella bombicola
H6TB12 1.57e-68 244 33 9 502 1 mdr Sophorolipid transporter Starmerella bombicola
Q9Y7M7 4.01e-70 243 32 11 571 3 mdl1 ATP-dependent permease MDL1, mitochondrial Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q8RY46 4.14e-70 242 29 10 587 1 ABCB26 ABC transporter B family member 26, chloroplastic Arabidopsis thaliana
Q9GTN7 6.12e-70 249 31 9 526 1 tagA Serine protease/ABC transporter B family protein tagA Dictyostelium discoideum
Q2UPC0 7.51e-70 243 33 5 431 3 aclQ ABC transporter aclQ Aspergillus oryzae (strain ATCC 42149 / RIB 40)
O75027 1.8e-69 241 29 14 608 1 ABCB7 Iron-sulfur clusters transporter ABCB7, mitochondrial Homo sapiens
Q04473 1.96e-69 240 30 12 547 3 apxIIIB Toxin RTX-III translocation ATP-binding protein Actinobacillus pleuropneumoniae
Q07QX6 1.99e-69 238 34 10 491 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Rhodopseudomonas palustris (strain BisA53)
F2T1C4 2.04e-69 247 32 9 531 1 MDR2 ABC multidrug transporter MDR2 Trichophyton rubrum (strain ATCC MYA-4607 / CBS 118892)
F2T1C4 3.8e-67 240 32 10 516 1 MDR2 ABC multidrug transporter MDR2 Trichophyton rubrum (strain ATCC MYA-4607 / CBS 118892)
P59852 2.27e-69 240 29 5 529 1 lagD Lactococcin-G-processing and transport ATP-binding protein LagD Lactococcus lactis subsp. lactis
F2RP52 2.64e-69 246 31 10 538 2 MDR2 ABC multidrug transporter MDR2 Trichophyton tonsurans (strain CBS 112818)
F2RP52 5.56e-68 243 32 10 522 2 MDR2 ABC multidrug transporter MDR2 Trichophyton tonsurans (strain CBS 112818)
F2PRR1 2.64e-69 246 31 10 538 2 MDR2 ABC multidrug transporter MDR2 Trichophyton equinum (strain ATCC MYA-4606 / CBS 127.97)
F2PRR1 5.56e-68 243 32 10 522 2 MDR2 ABC multidrug transporter MDR2 Trichophyton equinum (strain ATCC MYA-4606 / CBS 127.97)
Q2G506 3.09e-69 238 34 6 429 1 atm1 ATM1-type heavy metal exporter Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
Q9QY30 4.1e-69 246 33 9 514 1 Abcb11 Bile salt export pump Mus musculus
Q9QY30 4.18e-61 223 30 11 576 1 Abcb11 Bile salt export pump Mus musculus
A0A059JJ46 4.9e-69 246 31 10 538 2 MDR2 ABC multidrug transporter MDR2 Trichophyton interdigitale (strain MR816)
A0A059JJ46 6.12e-68 243 32 10 522 2 MDR2 ABC multidrug transporter MDR2 Trichophyton interdigitale (strain MR816)
G5EFD4 5.21e-69 241 33 9 484 2 hmt-1 Heavy metal tolerance factor 1 Caenorhabditis elegans
A0A095C325 6.43e-69 246 34 12 530 1 MDR1 ABC multidrug transporter MDR1 Cryptococcus deuterogattii (strain R265)
A0A095C325 3.17e-61 223 33 11 500 1 MDR1 ABC multidrug transporter MDR1 Cryptococcus deuterogattii (strain R265)
Q9LVM1 1.05e-68 239 32 8 502 1 ABCB25 ABC transporter B family member 25, mitochondrial Arabidopsis thaliana
Q54RU1 1.35e-68 238 40 6 345 3 abcB6 ABC transporter B family member 6 Dictyostelium discoideum
J9VWU3 1.72e-68 238 30 7 495 2 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Cryptococcus neoformans var. grubii serotype A (strain H99 / ATCC 208821 / CBS 10515 / FGSC 9487)
Q6Q876 2.16e-68 244 31 11 557 2 sirA Multidrug resistance protein sirA Leptosphaeria maculans
Q6Q876 1.62e-64 233 30 7 509 2 sirA Multidrug resistance protein sirA Leptosphaeria maculans
Q704E8 3.66e-68 238 29 12 603 1 Abcb7 Iron-sulfur clusters transporter ABCB7, mitochondrial Rattus norvegicus
P0CL93 3.95e-68 237 30 7 495 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Cryptococcus neoformans var. neoformans serotype D (strain B-3501A)
P0CL92 4.89e-68 237 30 7 495 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565)
Q8LPT1 6.62e-68 243 30 9 532 1 ABCB6 ABC transporter B family member 6 Arabidopsis thaliana
Q8LPT1 2.62e-56 208 30 10 523 1 ABCB6 ABC transporter B family member 6 Arabidopsis thaliana
P0AAG5 8.59e-68 233 29 13 589 1 mdlB Multidrug resistance-like ATP-binding protein MdlB Escherichia coli (strain K12)
P0AAG6 8.59e-68 233 29 13 589 3 mdlB Multidrug resistance-like ATP-binding protein MdlB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AAG7 8.59e-68 233 29 13 589 3 mdlB Multidrug resistance-like ATP-binding protein MdlB Escherichia coli O157:H7
Q3SP57 1.07e-67 233 35 10 490 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
Q1QH37 1.79e-67 233 32 14 552 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
Q2J0F4 2.03e-67 233 34 10 490 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Rhodopseudomonas palustris (strain HaA2)
Q9LSJ8 2.96e-67 240 32 9 527 2 ABCB16 ABC transporter B family member 16 Arabidopsis thaliana
Q9LSJ8 3.93e-66 237 31 11 564 2 ABCB16 ABC transporter B family member 16 Arabidopsis thaliana
Q13BH6 3.04e-67 232 34 9 490 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Rhodopseudomonas palustris (strain BisB5)
Q8LPQ6 3.29e-67 234 32 13 560 2 ABCB28 ABC transporter B family member 28 Arabidopsis thaliana
Q6CX96 3.32e-67 234 29 15 603 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
Q9LHK4 4.17e-67 240 29 10 577 5 ABCB8 Putative ABC transporter B family member 8 Arabidopsis thaliana
Q9LHK4 6.41e-60 219 33 16 537 5 ABCB8 Putative ABC transporter B family member 8 Arabidopsis thaliana
P40416 7.21e-67 233 30 14 591 1 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q1RJ91 7.44e-67 230 29 7 506 3 RBE_0492 Putative export ATP-binding/permease protein RBE_0492 Rickettsia bellii (strain RML369-C)
Q00748 8.08e-67 239 32 10 541 1 Mdr65 Multidrug resistance protein homolog 65 Drosophila melanogaster
Q00748 5.33e-65 234 33 12 524 1 Mdr65 Multidrug resistance protein homolog 65 Drosophila melanogaster
Q61102 8.7e-67 234 29 13 606 1 Abcb7 Iron-sulfur clusters transporter ABCB7, mitochondrial Mus musculus
P97998 2.98e-66 231 32 14 519 3 MDL1 ATP-dependent permease MDL1 Candida albicans
Q2K342 6.5e-66 228 31 5 477 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q6FZF2 8.86e-66 228 31 9 480 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Bartonella quintana (strain Toulouse)
Q08D64 1.23e-65 233 32 10 486 2 abcb6 ATP-binding cassette sub-family B member 6 Xenopus tropicalis
A0A1U9YI12 2.42e-65 235 29 7 517 2 verA ABC-type transmembrane transporter verA Clonostachys rogersoniana
A0A1U9YI12 4.24e-48 184 40 2 242 2 verA ABC-type transmembrane transporter verA Clonostachys rogersoniana
Q6G2Z5 2.46e-65 227 31 8 479 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
O14286 3.42e-65 229 30 9 499 3 atm1 Iron-sulfur clusters transporter atm1, mitochondrial Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q1MAB5 3.58e-65 226 48 2 251 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q751N2 4.14e-65 228 31 10 492 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
Q9ZCM8 9.97e-65 225 29 10 577 3 RP696 Putative export ATP-binding/permease protein RP696 Rickettsia prowazekii (strain Madrid E)
A1USS5 1.88e-64 224 31 12 527 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Bartonella bacilliformis (strain ATCC 35685 / KC583 / Herrer 020/F12,63)
P70864 2.04e-64 224 31 12 527 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Bartonella bacilliformis
Q9M3B9 8.62e-64 231 29 8 529 1 ABCB20 ABC transporter B family member 20 Arabidopsis thaliana
Q9M3B9 9.19e-55 204 30 13 534 1 ABCB20 ABC transporter B family member 20 Arabidopsis thaliana
Q59R09 1.63e-63 225 31 10 509 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Candida albicans (strain SC5314 / ATCC MYA-2876)
Q89A96 2.98e-63 221 26 10 584 3 mdlB Multidrug resistance-like ATP-binding protein MdlB Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q9N0V3 3.69e-63 229 28 9 592 2 ABCB11 Bile salt export pump Oryctolagus cuniculus
Q9N0V3 7.56e-61 222 32 8 512 2 ABCB11 Bile salt export pump Oryctolagus cuniculus
Q68W42 4.79e-63 220 28 11 589 3 RT0691 Putative export ATP-binding/permease protein RT0691 Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q03519 6.12e-63 222 29 6 482 1 TAP2 Antigen peptide transporter 2 Homo sapiens
A0A348AXX9 9.11e-63 228 29 10 529 2 kk1G ABC-type transporter kk1G Curvularia clavata
A0A348AXX9 2.6e-57 211 30 19 585 2 kk1G ABC-type transporter kk1G Curvularia clavata
P0CU83 9.48e-63 228 30 16 574 2 MDR4 ABC multidrug transporter MDR2 Trichophyton rubrum (strain ATCC MYA-4607 / CBS 118892)
P0CU83 1.69e-54 203 29 12 537 2 MDR4 ABC multidrug transporter MDR2 Trichophyton rubrum (strain ATCC MYA-4607 / CBS 118892)
Q4WD46 1.01e-62 227 30 8 519 2 fsqE ABC-type transporter fsqE Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WD46 4.03e-55 205 32 10 517 2 fsqE ABC-type transporter fsqE Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
F2Q5G0 1.22e-62 227 30 16 581 2 MDR4 ABC multidrug transporter MDR2 Trichophyton equinum (strain ATCC MYA-4606 / CBS 127.97)
F2Q5G0 1.55e-54 203 28 12 552 2 MDR4 ABC multidrug transporter MDR2 Trichophyton equinum (strain ATCC MYA-4606 / CBS 127.97)
A0A059JK44 1.28e-62 227 30 16 581 2 MDR4 ABC multidrug transporter MDR2 Trichophyton interdigitale (strain MR816)
A0A059JK44 1.37e-54 203 28 12 552 2 MDR4 ABC multidrug transporter MDR2 Trichophyton interdigitale (strain MR816)
F2RPA4 1.63e-62 227 30 16 581 2 MDR4 ABC multidrug transporter MDR2 Trichophyton tonsurans (strain CBS 112818)
F2RPA4 7.45e-51 192 44 3 254 2 MDR4 ABC multidrug transporter MDR2 Trichophyton tonsurans (strain CBS 112818)
P57551 2.05e-62 219 26 5 523 3 mdlA Multidrug resistance-like ATP-binding protein MdlA Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
P33310 2.5e-62 221 29 6 506 1 MDL1 ATP-dependent permease MDL1, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q4UMZ3 1.25e-61 216 30 9 511 3 RF_0214 Putative export ATP-binding/permease protein RF_0214 Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q6FIK3 5.07e-61 218 30 10 489 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
P59653 1.3e-60 216 26 5 553 1 comA Transport/processing ATP-binding protein ComA Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
A0A0D1BUH6 1.78e-60 221 31 16 571 2 atr1 ABC-type transporter atr1 Ustilago maydis (strain 521 / FGSC 9021)
A0A0D1BUH6 2.09e-60 221 31 8 534 2 atr1 ABC-type transporter atr1 Ustilago maydis (strain 521 / FGSC 9021)
Q8G0T8 1.99e-60 214 37 3 329 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Brucella suis biovar 1 (strain 1330)
P36372 2.06e-60 216 30 8 508 1 Tap2 Antigen peptide transporter 2 Rattus norvegicus
A0R6H8 3.79e-60 217 30 17 584 1 irtA Mycobactin import ATP-binding/permease protein IrtA Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q9LZB8 3.92e-60 214 33 7 503 1 ABCB29 ABC transporter B family member 29, chloroplastic Arabidopsis thaliana
Q8K984 4.55e-60 212 29 6 490 3 mdlB Multidrug resistance-like ATP-binding protein MdlB Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q28433 8.51e-60 215 29 5 520 2 TAP1 Antigen peptide transporter 1 Gorilla gorilla gorilla
Q8YH20 8.79e-60 212 37 3 329 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q03727 9.61e-60 214 26 5 553 3 comA Transport/processing ATP-binding protein ComA Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
S0EGU4 1.12e-59 218 30 11 515 2 BEA3 ABC transporter BEA3 Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
S0EGU4 7.39e-51 192 30 7 560 2 BEA3 ABC transporter BEA3 Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
P0C529 1.27e-59 211 37 3 329 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Brucella abortus biovar 1 (strain 9-941)
Q2YQ73 1.27e-59 211 37 3 329 1 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Brucella abortus (strain 2308)
P21958 2.02e-59 213 30 5 478 1 Tap1 Antigen peptide transporter 1 Mus musculus
Q4WSI1 2.07e-59 218 29 6 512 2 mdr4 ABC multidrug transporter mdr4 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WSI1 2.46e-53 199 29 11 520 2 mdr4 ABC multidrug transporter mdr4 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
P36370 5.02e-59 212 30 4 498 1 Tap1 Antigen peptide transporter 1 Rattus norvegicus
Q06034 5.26e-59 216 29 9 562 3 MDR1 Multidrug resistance protein 1 Leishmania enriettii
Q06034 2.17e-42 167 40 5 260 3 MDR1 Multidrug resistance protein 1 Leishmania enriettii
Q03518 5.39e-59 213 28 5 520 1 TAP1 Antigen peptide transporter 1 Homo sapiens
P0A2V1 5.7e-59 209 45 3 265 1 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Rhizobium radiobacter
P0A2V0 5.7e-59 209 45 3 265 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Agrobacterium fabrum (strain C58 / ATCC 33970)
A1KF14 3.39e-58 214 28 4 500 1 BCG_0231 Multidrug efflux ATP-binding/permease protein BCG_0231 Mycobacterium bovis (strain BCG / Pasteur 1173P2)
A1KF14 4.9e-53 199 31 3 382 1 BCG_0231 Multidrug efflux ATP-binding/permease protein BCG_0231 Mycobacterium bovis (strain BCG / Pasteur 1173P2)
K3VYH8 3.39e-58 214 30 16 548 3 FPSE_09185 ABC transporter FPSE_09185 Fusarium pseudograminearum (strain CS3096)
K3VYH8 5.7e-56 207 29 10 582 3 FPSE_09185 ABC transporter FPSE_09185 Fusarium pseudograminearum (strain CS3096)
O53645 4.17e-58 214 28 4 500 1 Rv0194 Multidrug efflux ATP-binding/permease protein Rv0194 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
O53645 3.99e-53 199 31 3 382 1 Rv0194 Multidrug efflux ATP-binding/permease protein Rv0194 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P12866 6.12e-58 213 31 8 490 1 STE6 Alpha-factor-transporting ATPase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P12866 2.26e-46 179 25 8 559 1 STE6 Alpha-factor-transporting ATPase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P57552 7.6e-58 206 28 4 482 3 mdlB Multidrug resistance-like ATP-binding protein MdlB Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q92GP9 9.97e-58 206 29 8 509 3 RC1073 Putative export ATP-binding/permease protein RC1073 Rickettsia conorii (strain ATCC VR-613 / Malish 7)
G7CBF5 9.8e-57 208 30 12 546 1 irtA Mycobactin import ATP-binding/permease protein IrtA Mycolicibacterium thermoresistibile (strain ATCC 19527 / DSM 44167 / CIP 105390 / JCM 6362 / NCTC 10409 / 316)
Q10418 1.88e-56 205 27 11 526 3 mesD Mesentericin-Y105 transport/processing ATP-binding protein MesD Leuconostoc mesenteroides
Q9ZNB0 2.27e-56 202 28 7 574 3 SCO0742 Uncharacterized ABC transporter ATP-binding protein SCO0742 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P18767 3.51e-56 202 31 6 477 1 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Rhizobium meliloti (strain 1021)
B2KWH4 9.12e-56 207 27 11 566 2 ABC1 ABC transporter 1 Ajellomyces capsulatus
B2KWH4 4.38e-53 199 29 13 539 2 ABC1 ABC transporter 1 Ajellomyces capsulatus
P9WQJ9 1.91e-55 204 45 3 245 1 irtA Mycobactin import ATP-binding/permease protein IrtA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQJ8 1.91e-55 204 45 3 245 3 irtA Mycobactin import ATP-binding/permease protein IrtA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63392 1.91e-55 204 45 3 245 3 irtA Mycobactin import ATP-binding/permease protein IrtA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P36371 1.41e-54 199 29 5 483 1 Tap2 Antigen peptide transporter 2 Mus musculus
Q983H5 9.75e-54 195 36 3 329 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q89A97 2.43e-53 194 26 7 500 3 mdlA Multidrug resistance-like ATP-binding protein MdlA Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
P9WQJ0 3.43e-53 194 26 10 544 3 MT1311 Uncharacterized ABC transporter ATP-binding protein MT1311 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A4W5 3.91e-53 193 26 10 544 3 BQ2027_MB1304C Uncharacterized ABC transporter ATP-binding protein Mb1304c Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WQJ1 3.91e-53 193 26 10 544 1 Rv1273c Uncharacterized ABC transporter ATP-binding protein Rv1273c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q00564 1.01e-52 195 26 11 557 3 lcnC Lactococcin-A transport/processing ATP-binding protein LcnC Lactococcus lactis subsp. lactis
P36497 1.45e-52 194 24 9 582 3 pedD Pediocin PA-1 transport/processing ATP-binding protein PedD Pediococcus acidilactici
P13568 2.18e-52 197 25 20 676 3 MDR1 Multidrug resistance protein Plasmodium falciparum (isolate FC27 / Papua New Guinea)
P13568 2.03e-51 194 28 18 595 3 MDR1 Multidrug resistance protein Plasmodium falciparum (isolate FC27 / Papua New Guinea)
Q9CJB8 3.48e-52 193 25 9 556 3 lcnC Lactococcin transport/processing ATP-binding protein LcnC-like Lactococcus lactis subsp. lactis (strain IL1403)
Q23868 6.61e-52 196 41 3 247 2 tagC Serine protease/ABC transporter B family protein tagC Dictyostelium discoideum
Q23868 2.53e-08 60 19 5 263 2 tagC Serine protease/ABC transporter B family protein tagC Dictyostelium discoideum
P54683 5.92e-50 190 41 4 246 3 tagB Serine protease/ABC transporter B family protein tagB Dictyostelium discoideum
P54683 3.5e-05 50 19 3 246 3 tagB Serine protease/ABC transporter B family protein tagB Dictyostelium discoideum
Q8CG09 1.69e-49 188 29 14 535 1 Abcc1 Multidrug resistance-associated protein 1 Rattus norvegicus
Q8CG09 2.2e-30 130 29 11 358 1 Abcc1 Multidrug resistance-associated protein 1 Rattus norvegicus
P9WQJ7 5.22e-49 182 39 1 238 1 irtB Mycobactin import ATP-binding/permease protein IrtB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQJ6 5.22e-49 182 39 1 238 3 irtB Mycobactin import ATP-binding/permease protein IrtB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63394 5.22e-49 182 39 1 238 3 irtB Mycobactin import ATP-binding/permease protein IrtB Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P33527 2.28e-48 185 27 14 558 1 ABCC1 Multidrug resistance-associated protein 1 Homo sapiens
P33527 1.95e-29 127 28 10 353 1 ABCC1 Multidrug resistance-associated protein 1 Homo sapiens
O35379 4.97e-48 184 29 14 535 1 Abcc1 Multidrug resistance-associated protein 1 Mus musculus
O35379 6.42e-29 126 28 9 338 1 Abcc1 Multidrug resistance-associated protein 1 Mus musculus
P23886 5.08e-48 179 27 10 497 1 cydC Glutathione/L-cysteine transport system ATP-binding/permease protein CydC Escherichia coli (strain K12)
P71355 5.26e-48 179 27 6 523 3 HI_0663 Uncharacterized ABC transporter ATP-binding protein HI_0663 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q864R9 1.72e-47 182 27 13 541 1 ABCC1 Multidrug resistance-associated protein 1 Macaca fascicularis
Q864R9 2.66e-28 124 27 10 353 1 ABCC1 Multidrug resistance-associated protein 1 Macaca fascicularis
Q57538 3.89e-47 176 28 15 561 1 HI_0664 Probable ABC transporter ATP-binding/permease protein HI_0664 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P94367 1.34e-46 175 26 14 555 3 cydD Glutathione/L-cysteine transport system ATP-binding/permease protein CydD Bacillus subtilis (strain 168)
Q5F364 2.8e-46 179 28 10 515 2 ABCC1 Multidrug resistance-associated protein 1 Gallus gallus
Q5F364 1.99e-31 134 27 6 325 2 ABCC1 Multidrug resistance-associated protein 1 Gallus gallus
Q8T9W1 3.31e-46 179 39 4 245 3 tagD Serine protease/ABC transporter B family protein tagD Dictyostelium discoideum
Q8T9W1 9.44e-08 59 22 10 332 3 tagD Serine protease/ABC transporter B family protein tagD Dictyostelium discoideum
Q6UR05 4.85e-46 178 28 12 532 1 ABCC1 Multidrug resistance-associated protein 1 Canis lupus familiaris
Q6UR05 1.02e-29 129 27 9 351 1 ABCC1 Multidrug resistance-associated protein 1 Canis lupus familiaris
Q8HXQ5 5.73e-46 178 28 13 535 1 ABCC1 Multidrug resistance-associated protein 1 Bos taurus
Q8HXQ5 1.21e-28 125 30 7 287 1 ABCC1 Multidrug resistance-associated protein 1 Bos taurus
A0R6H7 8.2e-46 173 33 6 330 1 irtB Mycobactin import ATP-binding/permease protein IrtB Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q9QYM0 1.04e-45 177 28 15 572 2 Abcc5 ATP-binding cassette sub-family C member 5 Rattus norvegicus
Q9QYM0 6.5e-25 114 33 3 220 2 Abcc5 ATP-binding cassette sub-family C member 5 Rattus norvegicus
Q9R1X5 6.58e-45 174 28 15 572 1 Abcc5 ATP-binding cassette sub-family C member 5 Mus musculus
Q9R1X5 4.1e-25 114 33 3 220 1 Abcc5 ATP-binding cassette sub-family C member 5 Mus musculus
Q63120 6.62e-45 174 25 10 535 1 Abcc2 ATP-binding cassette sub-family C member 2 Rattus norvegicus
Q63120 7.94e-26 116 22 18 611 1 Abcc2 ATP-binding cassette sub-family C member 2 Rattus norvegicus
Q28689 1.84e-44 173 25 8 528 1 ABCC2 ATP-binding cassette sub-family C member 2 Oryctolagus cuniculus
Q28689 2.81e-27 121 31 3 244 1 ABCC2 ATP-binding cassette sub-family C member 2 Oryctolagus cuniculus
Q92887 2.51e-44 173 26 13 531 1 ABCC2 ATP-binding cassette sub-family C member 2 Homo sapiens
Q92887 3.79e-24 111 29 4 243 1 ABCC2 ATP-binding cassette sub-family C member 2 Homo sapiens
Q5A762 2.87e-44 172 26 16 587 1 MLT1 Multiple drug resistance-associated protein-like transporter 1 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q5A762 1.31e-18 94 22 12 489 1 MLT1 Multiple drug resistance-associated protein-like transporter 1 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q54NL1 7.29e-44 171 26 16 576 3 abcC9 ABC transporter C family member 9 Dictyostelium discoideum
Q54NL1 1.38e-20 100 30 7 220 3 abcC9 ABC transporter C family member 9 Dictyostelium discoideum
Q9SKX0 4.44e-43 169 26 10 555 2 ABCC13 ABC transporter C family member 13 Arabidopsis thaliana
Q9SKX0 7.54e-17 88 30 4 214 2 ABCC13 ABC transporter C family member 13 Arabidopsis thaliana
G7CBF6 5.08e-43 165 39 3 233 1 irtB Mycobactin import ATP-binding/permease protein IrtB Mycolicibacterium thermoresistibile (strain ATCC 19527 / DSM 44167 / CIP 105390 / JCM 6362 / NCTC 10409 / 316)
P45081 5.23e-43 165 34 1 235 3 cydC Glutathione/L-cysteine transport system ATP-binding/permease protein CydC Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
O15440 6.84e-43 169 29 14 511 1 ABCC5 ATP-binding cassette sub-family C member 5 Homo sapiens
O15440 5.54e-25 114 33 3 220 1 ABCC5 ATP-binding cassette sub-family C member 5 Homo sapiens
Q0P9C4 8.33e-43 164 38 2 214 1 pglK Protein glycosylation K Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q9P5N0 1.35e-42 167 26 11 519 1 abc3 Vacuolar heme ABC transmembrane exporter abc3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9P5N0 1.53e-15 84 22 7 316 1 abc3 Vacuolar heme ABC transmembrane exporter abc3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9VL32 9.41e-42 165 37 2 233 1 Sur ATP-binding cassette sub-family C member Sur Drosophila melanogaster
Q9VL32 3.4e-19 95 31 6 213 1 Sur ATP-binding cassette sub-family C member Sur Drosophila melanogaster
Q52402 1.43e-41 161 27 8 428 3 aarD Transport ATP-binding protein AarD Providencia stuartii
A7KVC2 1.21e-40 162 26 7 489 2 MRP4 ABC transporter C family MRP4 Zea mays
A7KVC2 1.9e-16 87 23 14 474 2 MRP4 ABC transporter C family MRP4 Zea mays
Q9M1C7 1.44e-40 161 27 13 493 2 ABCC9 ABC transporter C family member 9 Arabidopsis thaliana
Q9M1C7 6.12e-22 104 29 6 294 2 ABCC9 ABC transporter C family member 9 Arabidopsis thaliana
P47260 1.52e-40 159 27 10 529 3 MG014 Putative ABC transporter ATP-binding protein MG014 Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q7FB56 1.83e-40 161 27 14 497 5 ABCC15 Putative ABC transporter C family member 15 Arabidopsis thaliana
Q7FB56 6.4e-26 116 29 6 294 5 ABCC15 Putative ABC transporter C family member 15 Arabidopsis thaliana
B2RX12 2.21e-40 161 26 14 527 1 Abcc3 ATP-binding cassette sub-family C member 3 Mus musculus
B2RX12 5.86e-23 107 29 3 237 1 Abcc3 ATP-binding cassette sub-family C member 3 Mus musculus
O15438 3.38e-40 160 28 12 494 1 ABCC3 ATP-binding cassette sub-family C member 3 Homo sapiens
O15438 2.26e-22 105 30 4 233 1 ABCC3 ATP-binding cassette sub-family C member 3 Homo sapiens
Q8ST87 4.12e-40 160 26 13 513 3 abcC10 ABC transporter C family member 10 Dictyostelium discoideum
Q8ST87 2.53e-24 112 29 9 348 3 abcC10 ABC transporter C family member 10 Dictyostelium discoideum
Q54P13 4.65e-40 160 25 9 505 3 abcC8 ABC transporter C family member 8 Dictyostelium discoideum
Q54P13 1.48e-25 115 30 4 238 3 abcC8 ABC transporter C family member 8 Dictyostelium discoideum
Q63563 6.16e-40 160 26 11 537 1 Abcc9 ATP-binding cassette sub-family C member 9 Rattus norvegicus
Q63563 2.04e-22 105 33 6 212 1 Abcc9 ATP-binding cassette sub-family C member 9 Rattus norvegicus
Q10RX7 7.25e-40 159 26 7 480 2 ABCC13 ABC transporter C family member 13 Oryza sativa subsp. japonica
Q10RX7 2.45e-17 90 23 14 474 2 ABCC13 ABC transporter C family member 13 Oryza sativa subsp. japonica
A2XCD4 7.25e-40 159 26 7 480 3 ABCC13 ABC transporter C family member 13 Oryza sativa subsp. indica
A2XCD4 2.45e-17 90 23 14 474 3 ABCC13 ABC transporter C family member 13 Oryza sativa subsp. indica
P39109 7.47e-40 159 25 6 465 1 YCF1 Metal resistance protein YCF1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P39109 6.99e-25 114 24 14 464 1 YCF1 Metal resistance protein YCF1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P70170 8.81e-40 159 25 11 537 1 Abcc9 ATP-binding cassette sub-family C member 9 Mus musculus
P70170 1.85e-22 106 33 6 212 1 Abcc9 ATP-binding cassette sub-family C member 9 Mus musculus
P53706 9.72e-40 159 27 12 491 3 HST6 Alpha-factor-transporting ATPase Candida albicans (strain WO-1)
P53706 2.43e-17 90 21 14 640 3 HST6 Alpha-factor-transporting ATPase Candida albicans (strain WO-1)
P33116 1.36e-39 156 26 12 463 3 spaT Subtilin transport ATP-binding protein SpaT Bacillus subtilis
Q54VJ0 2.96e-39 157 27 10 475 3 abcC2 ABC transporter C family member 2 Dictyostelium discoideum
Q54VJ0 1.53e-22 106 32 11 252 3 abcC2 ABC transporter C family member 2 Dictyostelium discoideum
P82451 3.21e-39 157 25 11 537 2 ABCC9 ATP-binding cassette sub-family C member 9 Oryctolagus cuniculus
P82451 2.39e-20 99 31 7 230 2 ABCC9 ATP-binding cassette sub-family C member 9 Oryctolagus cuniculus
O88563 3.46e-39 157 26 14 544 1 Abcc3 ATP-binding cassette sub-family C member 3 Rattus norvegicus
O88563 5.61e-25 114 29 3 237 1 Abcc3 ATP-binding cassette sub-family C member 3 Rattus norvegicus
P29018 8.23e-39 154 26 5 427 1 cydD Glutathione/L-cysteine transport system ATP-binding/permease protein CydD Escherichia coli (strain K12)
Q6Y306 1.81e-38 155 27 14 498 2 Abcc12 ATP-binding cassette sub-family C member 12 Rattus norvegicus
Q6Y306 1.89e-30 130 31 3 227 2 Abcc12 ATP-binding cassette sub-family C member 12 Rattus norvegicus
Q8VI47 2.19e-38 155 27 10 490 1 Abcc2 ATP-binding cassette sub-family C member 2 Mus musculus
Q8VI47 2.33e-26 118 29 3 244 1 Abcc2 ATP-binding cassette sub-family C member 2 Mus musculus
O60706 4.21e-38 154 25 11 537 1 ABCC9 ATP-binding cassette sub-family C member 9 Homo sapiens
O60706 1.58e-21 103 32 5 210 1 ABCC9 ATP-binding cassette sub-family C member 9 Homo sapiens
Q54U44 4.64e-38 154 26 16 512 3 abcC12 ABC transporter C family member 12 Dictyostelium discoideum
Q54U44 1.94e-23 109 27 6 318 3 abcC12 ABC transporter C family member 12 Dictyostelium discoideum
P53049 6.45e-38 154 27 11 502 1 YOR1 Oligomycin resistance ATP-dependent permease YOR1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P53049 7.07e-17 88 27 6 234 1 YOR1 Oligomycin resistance ATP-dependent permease YOR1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P45082 6.51e-38 151 25 18 594 3 cydD Glutathione/L-cysteine transport system ATP-binding/permease protein CydD Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q7GB25 9.06e-38 153 25 7 489 2 ABCC5 ABC transporter C family member 5 Arabidopsis thaliana
Q7GB25 1.33e-19 97 23 13 423 2 ABCC5 ABC transporter C family member 5 Arabidopsis thaliana
Q96J66 1.04e-37 153 26 10 528 1 ABCC11 ATP-binding cassette sub-family C member 11 Homo sapiens
Q96J66 2.59e-22 105 29 4 220 1 ABCC11 ATP-binding cassette sub-family C member 11 Homo sapiens
Q80WJ6 1.27e-37 152 36 1 232 1 Abcc12 ATP-binding cassette sub-family C member 12 Mus musculus
Q80WJ6 9.48e-31 132 31 3 224 1 Abcc12 ATP-binding cassette sub-family C member 12 Mus musculus
Q10185 2.88e-37 152 25 14 530 1 abc2 ATP-binding cassette transporter abc2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q10185 7.16e-16 85 26 4 230 1 abc2 ATP-binding cassette transporter abc2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q8R4P9 3.27e-37 151 37 2 231 1 Abcc10 ATP-binding cassette sub-family C member 10 Mus musculus
Q8R4P9 1.43e-14 81 27 4 204 1 Abcc10 ATP-binding cassette sub-family C member 10 Mus musculus
Q9LK64 3.76e-37 151 27 13 509 1 ABCC3 ABC transporter C family member 3 Arabidopsis thaliana
Q9LK64 2.91e-17 89 26 5 292 1 ABCC3 ABC transporter C family member 3 Arabidopsis thaliana
G5EE72 6.81e-37 150 35 1 230 2 mrp-5 Multidrug resistance-associated protein 5 Caenorhabditis elegans
G5EE72 5.83e-18 92 24 15 443 2 mrp-5 Multidrug resistance-associated protein 5 Caenorhabditis elegans
Q54VC1 1.05e-36 150 24 6 478 3 abcC15 ABC transporter C family member 15 Dictyostelium discoideum
Q54VC1 8.1e-13 75 30 7 213 3 abcC15 ABC transporter C family member 15 Dictyostelium discoideum
P91660 1.2e-36 150 24 11 556 2 l(2)03659 Probable multidrug resistance-associated protein lethal(2)03659 Drosophila melanogaster
P91660 1.27e-16 87 27 5 212 2 l(2)03659 Probable multidrug resistance-associated protein lethal(2)03659 Drosophila melanogaster
Q54JR2 1.63e-36 149 28 13 499 3 abcC3 ABC transporter C family member 3 Dictyostelium discoideum
Q54JR2 3.68e-22 105 23 15 528 3 abcC3 ABC transporter C family member 3 Dictyostelium discoideum
Q8VZZ4 2.02e-36 149 25 7 478 2 ABCC6 ABC transporter C family member 6 Arabidopsis thaliana
Q8VZZ4 5.07e-17 89 24 13 453 2 ABCC6 ABC transporter C family member 6 Arabidopsis thaliana
Q96J65 2.89e-36 148 35 1 232 1 ABCC12 ATP-binding cassette sub-family C member 12 Homo sapiens
Q96J65 2.49e-28 124 30 4 223 1 ABCC12 ATP-binding cassette sub-family C member 12 Homo sapiens
P38735 3.31e-36 148 27 19 580 2 VMR1 ABC transporter ATP-binding protein/permease VMR1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P38735 3.18e-27 121 24 20 592 2 VMR1 ABC transporter ATP-binding protein/permease VMR1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P75095 3.31e-36 146 27 9 537 3 MPN_018 Putative ABC transporter ATP-binding protein MG014 homolog Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
P78966 3.63e-36 148 27 18 517 3 mam1 Mating factor M secretion protein mam1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P78966 1.38e-35 146 27 8 418 3 mam1 Mating factor M secretion protein mam1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q54K24 3.91e-36 148 36 2 233 3 abcC14 ABC transporter C family member 14 Dictyostelium discoideum
Q54K24 2.37e-13 77 32 6 159 3 abcC14 ABC transporter C family member 14 Dictyostelium discoideum
Q8T6H3 4.38e-36 148 36 2 233 3 abcC6 ABC transporter C family member 6 Dictyostelium discoideum
Q8T6H3 1.01e-20 100 29 10 284 3 abcC6 ABC transporter C family member 6 Dictyostelium discoideum
Q9U2G5 6.2e-36 147 26 9 499 2 mrp-7 Multidrug resistance protein mrp-7 Caenorhabditis elegans
Q9U2G5 7.79e-22 104 29 4 237 2 mrp-7 Multidrug resistance protein mrp-7 Caenorhabditis elegans
Q9C8H1 6.67e-36 147 26 9 476 2 ABCC11 ABC transporter C family member 11 Arabidopsis thaliana
Q9C8H1 2.3e-25 115 25 13 419 2 ABCC11 ABC transporter C family member 11 Arabidopsis thaliana
Q42093 8.44e-36 147 39 1 233 1 ABCC2 ABC transporter C family member 2 Arabidopsis thaliana
Q42093 3.14e-28 124 25 12 419 1 ABCC2 ABC transporter C family member 2 Arabidopsis thaliana
A0A1U8QTJ9 1.24e-35 147 26 11 490 1 cicA ABC-type transporter cicA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
A0A1U8QTJ9 1.83e-21 103 23 12 446 1 cicA ABC-type transporter cicA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
E9Q236 1.32e-35 146 26 9 479 1 Abcc4 ATP-binding cassette sub-family C member 4 Mus musculus
E9Q236 5.71e-26 117 30 6 252 1 Abcc4 ATP-binding cassette sub-family C member 4 Mus musculus
Q54V86 1.75e-35 146 26 5 466 3 abcC13 ABC transporter C family member 13 Dictyostelium discoideum
Q54V86 1.86e-20 99 33 9 216 3 abcC13 ABC transporter C family member 13 Dictyostelium discoideum
Q9LK62 2.06e-35 146 25 11 517 1 ABCC7 ABC transporter C family member 7 Arabidopsis thaliana
Q9LK62 2.73e-19 96 25 15 462 1 ABCC7 ABC transporter C family member 7 Arabidopsis thaliana
Q4WT65 2.86e-35 145 26 15 494 2 abcB ABC multidrug transporter B Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WT65 2.02e-15 84 28 5 237 2 abcB ABC multidrug transporter B Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
P94366 3.14e-35 143 36 1 204 3 cydC Glutathione/L-cysteine transport system ATP-binding/permease protein CydC Bacillus subtilis (strain 168)
S3D778 5.95e-35 144 25 10 483 3 gloK ABC transporter gloK Glarea lozoyensis (strain ATCC 20868 / MF5171)
S3D778 2.63e-15 83 30 7 236 3 gloK ABC transporter gloK Glarea lozoyensis (strain ATCC 20868 / MF5171)
J9VQH1 6.94e-35 144 26 11 530 3 YOR1 ATP-dependent permease YOR1 Cryptococcus neoformans var. grubii serotype A (strain H99 / ATCC 208821 / CBS 10515 / FGSC 9487)
J9VQH1 1.12e-21 103 30 6 251 3 YOR1 ATP-dependent permease YOR1 Cryptococcus neoformans var. grubii serotype A (strain H99 / ATCC 208821 / CBS 10515 / FGSC 9487)
P14772 9.84e-35 144 26 10 519 1 BPT1 Bile pigment transporter 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P14772 5.46e-19 95 24 19 502 1 BPT1 Bile pigment transporter 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9EXN5 1.03e-34 142 25 9 533 3 mchF Probable microcin-H47 secretion/processing ATP-binding protein MchF Escherichia coli
Q8T6H8 1.32e-34 143 25 11 537 3 abcC1 ABC transporter C family member 1 Dictyostelium discoideum
Q8T6H8 8.71e-21 100 33 9 217 3 abcC1 ABC transporter C family member 1 Dictyostelium discoideum
Q6FWS5 1.47e-34 143 25 13 547 2 YBT1 Pleiotropic ABC efflux transporter of multiple drugs YBT1 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
Q6FWS5 1.44e-28 125 30 10 299 2 YBT1 Pleiotropic ABC efflux transporter of multiple drugs YBT1 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
F1M3J4 1.82e-34 143 25 9 479 1 Abcc4 ATP-binding cassette subfamily C member 4 Rattus norvegicus
F1M3J4 1.69e-24 112 30 7 252 1 Abcc4 ATP-binding cassette subfamily C member 4 Rattus norvegicus
Q9C8G9 3.25e-34 142 39 1 229 1 ABCC1 ABC transporter C family member 1 Arabidopsis thaliana
Q9C8G9 1.6e-26 119 24 12 419 1 ABCC1 ABC transporter C family member 1 Arabidopsis thaliana
O88039 3.42e-34 140 34 5 247 2 ramA ABC transporter ATP-binding protein RamA Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
O15439 3.69e-34 142 25 7 471 1 ABCC4 ATP-binding cassette sub-family C member 4 Homo sapiens
O15439 3.4e-27 120 30 6 251 1 ABCC4 ATP-binding cassette sub-family C member 4 Homo sapiens
P22520 4.31e-34 140 24 12 551 3 cvaB Colicin V secretion/processing ATP-binding protein CvaB Escherichia coli
Q09427 4.89e-34 142 25 11 520 1 ABCC8 ATP-binding cassette sub-family C member 8 Cricetus cricetus
Q09427 1.33e-25 115 32 7 238 1 ABCC8 ATP-binding cassette sub-family C member 8 Cricetus cricetus
P32386 7.29e-34 141 26 11 494 1 YBT1 ATP-dependent bile acid permease Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P32386 4.67e-23 108 26 14 366 1 YBT1 ATP-dependent bile acid permease Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q09429 7.49e-34 141 25 10 507 1 Abcc8 ATP-binding cassette sub-family C member 8 Rattus norvegicus
Q09429 2.5e-24 112 32 7 232 1 Abcc8 ATP-binding cassette sub-family C member 8 Rattus norvegicus
Q9C8H0 9.09e-34 141 38 1 229 2 ABCC12 ABC transporter C family member 12 Arabidopsis thaliana
Q9C8H0 4.62e-24 111 28 8 291 2 ABCC12 ABC transporter C family member 12 Arabidopsis thaliana
Q9R1S7 2.67e-33 139 25 7 486 1 Abcc6 ATP-binding cassette sub-family C member 6 Mus musculus
Q9R1S7 1.17e-22 106 27 4 238 1 Abcc6 ATP-binding cassette sub-family C member 6 Mus musculus
Q54LE6 3.17e-33 139 25 15 507 3 abcC5 ABC transporter C family member 5 Dictyostelium discoideum
Q54LE6 2.43e-14 80 28 6 214 3 abcC5 ABC transporter C family member 5 Dictyostelium discoideum
Q09428 5.15e-33 139 25 11 520 1 ABCC8 ATP-binding cassette sub-family C member 8 Homo sapiens
Q09428 1.83e-24 112 32 7 237 1 ABCC8 ATP-binding cassette sub-family C member 8 Homo sapiens
Q9LYS2 5.2e-33 139 23 10 550 2 ABCC10 ABC transporter C family member 10 Arabidopsis thaliana
Q9LYS2 3.3e-24 111 25 16 464 2 ABCC10 ABC transporter C family member 10 Arabidopsis thaliana
C8ZCR2 9.56e-33 138 31 6 321 3 NFT1 ABC transporter NFT1 Saccharomyces cerevisiae (strain Lalvin EC1118 / Prise de mousse)
C8ZCR2 1e-17 91 28 5 242 3 NFT1 ABC transporter NFT1 Saccharomyces cerevisiae (strain Lalvin EC1118 / Prise de mousse)
P0CE70 1.04e-32 138 31 6 321 3 NFT1 ABC transporter NFT1 Saccharomyces cerevisiae
P0CE70 6.15e-18 92 28 5 242 3 NFT1 ABC transporter NFT1 Saccharomyces cerevisiae
O88269 1.35e-32 137 25 8 518 1 Abcc6 ATP-binding cassette sub-family C member 6 Rattus norvegicus
O88269 1.98e-22 106 27 6 254 1 Abcc6 ATP-binding cassette sub-family C member 6 Rattus norvegicus
Q92337 1.46e-32 137 36 2 235 3 abc1 ATP-binding cassette transporter abc1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q92337 8.06e-21 100 26 12 364 3 abc1 ATP-binding cassette transporter abc1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
A7A063 2.54e-32 136 31 5 316 3 NFT1 ABC transporter NFT1 Saccharomyces cerevisiae (strain YJM789)
A7A063 5.99e-18 92 28 5 242 3 NFT1 ABC transporter NFT1 Saccharomyces cerevisiae (strain YJM789)
Q03024 2.88e-32 134 33 4 272 3 aprD Alkaline protease secretion ATP-binding protein AprD Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q5T3U5 3.54e-32 136 35 4 252 1 ABCC10 ATP-binding cassette sub-family C member 10 Homo sapiens
Q5T3U5 3.78e-15 82 28 4 204 1 ABCC10 ATP-binding cassette sub-family C member 10 Homo sapiens
Q81J16 3.96e-32 128 34 6 239 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
I1RF50 1.17e-31 134 26 14 495 3 FG02316 ABC-type transporter FG02316 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
I1RF50 2.35e-17 90 30 8 253 3 FG02316 ABC-type transporter FG02316 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
Q55DA7 1.31e-31 134 25 17 545 3 abcB7 ABC transporter B family member 7 Dictyostelium discoideum
Q7DM58 1.84e-31 134 24 6 516 1 ABCC4 ABC transporter C family member 4 Arabidopsis thaliana
Q7DM58 5.33e-27 120 27 10 356 1 ABCC4 ABC transporter C family member 4 Arabidopsis thaliana
A0A0D1CZ63 2.05e-31 134 26 9 500 2 fer6 Multidrug resistance protein fer6 Ustilago maydis (strain 521 / FGSC 9021)
A0A0D1CZ63 1.37e-22 106 25 12 380 2 fer6 Multidrug resistance protein fer6 Ustilago maydis (strain 521 / FGSC 9021)
Q5AV01 2.49e-31 134 32 6 270 2 atnG ABC transporter atnG Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5AV01 5.65e-08 59 24 8 242 2 atnG ABC transporter atnG Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q54EK2 2.6e-31 133 25 12 528 3 abcC7 ABC transporter C family member 7 Dictyostelium discoideum
Q54EK2 2.99e-21 102 34 7 214 3 abcC7 ABC transporter C family member 7 Dictyostelium discoideum
Q8LGU1 2.6e-31 133 25 8 483 2 ABCC8 ABC transporter C family member 8 Arabidopsis thaliana
Q8LGU1 5.13e-26 117 29 7 305 2 ABCC8 ABC transporter C family member 8 Arabidopsis thaliana
Q7ANN4 3.87e-31 131 33 4 264 1 prsD Type I secretion system ATP-binding protein PrsD Rhizobium meliloti (strain 1021)
I1R9B3 3.92e-31 133 25 14 492 3 FGRAMPH1_01T00151 ABC-type transporter FGSG_00046 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
I1R9B3 9.83e-05 49 42 0 61 3 FGRAMPH1_01T00151 ABC-type transporter FGSG_00046 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
A0A0U1LQE1 1.15e-30 131 31 8 311 3 cctS ABC-type transporter cctS Talaromyces islandicus
A0A0U1LQE1 2.85e-16 86 28 4 221 3 cctS ABC-type transporter cctS Talaromyces islandicus
Q73F67 1.61e-30 124 34 6 233 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q9P7V2 2.2e-30 130 25 13 536 3 abc4 ATP-binding cassette transporter abc4 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9P7V2 3.23e-17 89 28 8 227 3 abc4 ATP-binding cassette transporter abc4 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q50294 2.25e-30 123 34 6 226 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
O95255 2.52e-30 130 25 12 511 1 ABCC6 ATP-binding cassette sub-family C member 6 Homo sapiens
O95255 2.3e-24 112 26 9 329 1 ABCC6 ATP-binding cassette sub-family C member 6 Homo sapiens
A0A0H2ZLL3 3.38e-30 122 36 7 235 3 egtUA Probable ergothioneine transport ATP-binding protein EgtUA Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q6HPN0 3.43e-30 123 34 6 233 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q81VQ2 3.43e-30 123 34 6 233 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus anthracis
A0R8K8 3.43e-30 123 34 6 233 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus thuringiensis (strain Al Hakam)
Q9LZJ5 4.13e-30 130 35 2 237 1 ABCC14 ABC transporter C family member 14 Arabidopsis thaliana
Q9LZJ5 8.4e-25 113 27 10 329 1 ABCC14 ABC transporter C family member 14 Arabidopsis thaliana
Q88RL5 4.81e-30 124 35 7 239 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q8DRR9 4.99e-30 122 32 5 234 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
K0E4D9 5.72e-30 129 25 12 517 1 ecdL ABC transporter ecdL Aspergillus rugulosus
K0E4D9 7.82e-14 78 29 7 235 1 ecdL ABC transporter ecdL Aspergillus rugulosus
Q03P57 8.7e-30 124 35 7 232 3 metN Methionine import ATP-binding protein MetN Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
Q6GEL3 1.27e-29 121 34 6 238 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Staphylococcus aureus (strain MRSA252)
Q6KHL1 1.56e-29 121 33 5 231 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Mycoplasma mobile (strain ATCC 43663 / 163K / NCTC 11711)

  • Number of RefSeq hits:

General

Source Morganella morganii S5
Locus tag HKOGLL_09350
Feature type CDS
Gene msbA
Product lipid A ABC transporter ATP-binding protein/permease MsbA
Location 113917 - 115662 (strand: 1)
Length 1746 (nucleotides) / 581 (amino acids)
In genomic island -

Contig

Accession ZDB_686
Length 191111 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1291
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00005 ABC transporter
PF00664 ABC transporter transmembrane region

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1132 Defense mechanisms (V) V ABC-type multidrug transport system, ATPase and permease component

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K11085 ATP-binding cassette, subfamily B, bacterial MsbA [EC:7.5.2.6] ABC transporters -

Virulence factor Annotation(s)

VF gene ID Protein VF ID Category
VFG013253 lipid transporter ATP-binding/permease VF0044 Immune modulation

Protein Sequence

MKDIDISTRQTFRRLWPTIAPFKTGIIVAAIALVINAGGDAFMLSLLKPLLDEGFGTADNDFLRIMPLIILGLMLLRGISSFVSGYCLSWVSGKVVMTMRRNLFRHMMGMPVSFFDQQSTGTLLSRITYDSEQVASSSSGALVTVVREGAYIIALFGLMFYNSWQLSLILIVIAPIVAFVIRKVSVRFREISKNMQSGMGQVSASAEQMLKGHKEVLIFGGQKVENDRFDKVSNHMRRQGMKLVTASSIADPIIQIIASFALAFVLFAASFPEIKEALSAGSITVVFSSMIALMRPLKSLTNVNAQFQRGMAACQTLFVLLDMEQEKDTGTKVLKDAKGDVAFENVTFRYQGKENPALKNVSFTIPSGKTVALVGRSGSGKSTIANLITRFYEIESGHITIDGNDIRDYTLASLRSQVALVSQNVHLFNDTVANNIAYATEGKYTREQIEKAAEMAYAMDFINKMEKGLDTEIGENGVLLSGGQRQRIAIARALLRDAPILILDEATSALDTESERAIQAALDELQKNRTCLVIAHRLSTIEKADEILVVQDGEVQERGTHDELVKQPGIYAQLYNMQFGH

Flanking regions ( +/- flanking 50bp)

GGTAAACGGGTAATATAGGCAGCTAATTTTTAGTATTGGTAAACGCAATAATGAAAGATATTGATATTTCAACCCGGCAAACATTCCGCCGGTTATGGCCGACAATCGCACCGTTTAAAACAGGTATCATCGTGGCGGCTATTGCGTTAGTCATCAATGCGGGCGGCGATGCATTTATGCTGTCGCTGCTGAAACCGCTGCTTGATGAAGGTTTCGGCACTGCCGACAATGATTTTCTCCGTATCATGCCGCTGATTATCCTGGGGCTGATGCTGTTACGCGGTATCTCCAGTTTTGTTTCAGGCTACTGCCTCTCCTGGGTGTCCGGCAAAGTGGTTATGACCATGCGCCGTAACCTGTTCCGGCATATGATGGGCATGCCGGTTTCCTTCTTTGATCAGCAATCCACCGGGACACTGCTTTCCCGTATCACCTATGATTCCGAACAGGTGGCTTCGTCTTCTTCCGGTGCACTGGTAACGGTCGTCCGTGAAGGCGCCTATATTATTGCGCTGTTCGGGCTGATGTTTTACAACAGCTGGCAGCTGTCGCTGATTCTGATCGTTATTGCGCCGATTGTGGCTTTTGTTATCCGTAAAGTCTCTGTCCGCTTCCGCGAAATCAGTAAAAACATGCAGAGCGGCATGGGACAGGTCAGCGCCAGTGCTGAACAGATGCTGAAAGGGCATAAAGAAGTGCTGATTTTCGGTGGTCAGAAAGTGGAAAATGATCGTTTCGATAAAGTCAGCAACCATATGCGCCGCCAGGGTATGAAACTGGTTACCGCATCATCTATTGCCGACCCGATTATTCAGATCATTGCCTCCTTTGCGCTGGCATTTGTGCTGTTTGCCGCCAGTTTCCCTGAAATTAAAGAAGCGCTGAGTGCCGGTTCCATTACAGTTGTCTTCTCTTCCATGATTGCTCTGATGCGTCCGCTGAAATCCCTGACCAACGTGAACGCTCAGTTCCAGCGCGGGATGGCGGCTTGTCAGACACTGTTTGTTCTGCTTGATATGGAGCAGGAAAAAGACACCGGCACCAAAGTGCTGAAAGATGCCAAAGGTGATGTGGCGTTTGAGAATGTGACTTTCCGTTATCAGGGGAAAGAGAACCCGGCGCTGAAAAATGTGTCATTCACTATTCCGTCAGGCAAAACGGTGGCGCTGGTCGGGCGCTCCGGCTCCGGGAAATCCACCATTGCCAATCTGATCACCCGTTTCTATGAAATTGAAAGCGGACATATTACGATCGACGGCAACGATATCCGTGACTACACACTGGCATCACTGCGCAGTCAGGTGGCGCTGGTGTCGCAGAATGTTCACCTCTTCAATGATACGGTCGCGAATAATATCGCTTATGCCACAGAAGGTAAGTACACCCGCGAGCAGATTGAAAAAGCCGCTGAAATGGCTTATGCCATGGACTTTATCAATAAGATGGAGAAGGGGCTGGATACCGAAATCGGTGAGAACGGTGTTCTGCTTTCCGGTGGTCAGCGCCAGCGTATTGCAATTGCCCGTGCATTGCTGCGTGACGCACCGATCCTTATCCTCGACGAAGCAACCTCGGCACTGGATACTGAATCTGAGCGTGCGATTCAGGCCGCGCTCGATGAGTTACAGAAAAACCGTACCTGTCTGGTGATCGCTCACCGCTTATCCACCATTGAGAAGGCGGATGAAATCCTCGTGGTGCAGGACGGCGAAGTGCAGGAGCGCGGTACGCATGATGAACTGGTGAAACAGCCGGGTATCTATGCGCAGCTCTATAACATGCAGTTTGGTCACTAAGCGGCACTGCTGATGATCGATAAAATTTGGTCCGGCCGCTCAAAGCTTTA