Homologs in group_1291

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_07175 FBDBKF_07175 93.6 Morganella morganii S1 msbA lipid A ABC transporter ATP-binding protein/permease MsbA
EHELCC_03795 EHELCC_03795 93.6 Morganella morganii S2 msbA lipid A ABC transporter ATP-binding protein/permease MsbA
NLDBIP_03795 NLDBIP_03795 93.6 Morganella morganii S4 msbA lipid A ABC transporter ATP-binding protein/permease MsbA
LHKJJB_09625 LHKJJB_09625 93.6 Morganella morganii S3 msbA lipid A ABC transporter ATP-binding protein/permease MsbA
HKOGLL_09350 HKOGLL_09350 93.6 Morganella morganii S5 msbA lipid A ABC transporter ATP-binding protein/permease MsbA
PMI_RS03530 PMI_RS03530 78.7 Proteus mirabilis HI4320 msbA lipid A ABC transporter ATP-binding protein/permease MsbA

Distribution of the homologs in the orthogroup group_1291

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1291

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P63359 0.0 940 76 0 582 1 msbA ATP-dependent lipid A-core flippase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P63360 0.0 940 76 0 582 3 msbA ATP-dependent lipid A-core flippase Salmonella typhi
Q57R14 0.0 940 76 0 582 3 msbA ATP-dependent lipid A-core flippase Salmonella choleraesuis (strain SC-B67)
Q5PGH0 0.0 939 76 0 582 3 msbA ATP-dependent lipid A-core flippase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q1RDU4 0.0 934 76 0 582 3 msbA ATP-dependent lipid A-core flippase Escherichia coli (strain UTI89 / UPEC)
Q8FJB1 0.0 934 76 0 582 1 msbA ATP-dependent lipid A-core flippase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TJD9 0.0 934 76 0 582 3 msbA ATP-dependent lipid A-core flippase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q32E34 0.0 934 76 0 582 3 msbA ATP-dependent lipid A-core flippase Shigella dysenteriae serotype 1 (strain Sd197)
Q31YT6 0.0 934 76 0 582 3 msbA ATP-dependent lipid A-core flippase Shigella boydii serotype 4 (strain Sb227)
P60752 0.0 934 76 0 582 1 msbA ATP-dependent lipid A-core flippase Escherichia coli (strain K12)
P60753 0.0 934 76 0 582 1 msbA ATP-dependent lipid A-core flippase Escherichia coli O157:H7
Q83LP0 0.0 933 76 0 582 3 msbA ATP-dependent lipid A-core flippase Shigella flexneri
Q3Z3K7 0.0 931 76 0 582 3 msbA ATP-dependent lipid A-core flippase Shigella sonnei (strain Ss046)
Q2NUA5 0.0 899 73 0 582 3 msbA ATP-dependent lipid A-core flippase Sodalis glossinidius (strain morsitans)
Q7N6C6 0.0 899 76 0 581 3 msbA ATP-dependent lipid A-core flippase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q66CI3 0.0 887 73 0 582 3 msbA ATP-dependent lipid A-core flippase Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CGH0 0.0 887 73 0 582 3 msbA ATP-dependent lipid A-core flippase Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZGA9 0.0 887 73 0 582 3 msbA ATP-dependent lipid A-core flippase Yersinia pestis
Q1CA68 0.0 887 73 0 582 3 msbA ATP-dependent lipid A-core flippase Yersinia pestis bv. Antiqua (strain Antiqua)
Q6D437 0.0 874 75 0 582 3 msbA ATP-dependent lipid A-core flippase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q0I4C5 0.0 835 70 1 581 3 msbA ATP-dependent lipid A-core flippase Histophilus somni (strain 129Pt)
Q9CMG7 0.0 834 68 1 579 3 msbA ATP-dependent lipid A-core flippase Pasteurella multocida (strain Pm70)
Q9KQW9 0.0 829 68 0 577 1 msbA ATP-dependent lipid A-core flippase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q87R16 0.0 826 68 0 582 3 msbA ATP-dependent lipid A-core flippase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q5E0F2 0.0 822 67 0 576 3 msbA ATP-dependent lipid A-core flippase Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q8DAV2 0.0 820 67 0 582 3 msbA ATP-dependent lipid A-core flippase Vibrio vulnificus (strain CMCP6)
Q7MJ07 0.0 820 67 0 582 3 msbA ATP-dependent lipid A-core flippase Vibrio vulnificus (strain YJ016)
Q6LPK6 0.0 819 67 1 584 3 msbA ATP-dependent lipid A-core flippase Photobacterium profundum (strain SS9)
Q4QPI4 0.0 803 65 1 580 3 msbA ATP-dependent lipid A-core flippase Haemophilus influenzae (strain 86-028NP)
Q65U21 0.0 800 67 1 581 3 msbA ATP-dependent lipid A-core flippase Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
P44407 0.0 794 65 1 580 3 msbA ATP-dependent lipid A-core flippase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q492S9 0.0 791 67 0 573 3 msbA ATP-dependent lipid A-core flippase Blochmanniella pennsylvanica (strain BPEN)
Q7VL52 0.0 768 63 1 582 3 msbA ATP-dependent lipid A-core flippase Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q8D2U8 0.0 744 62 0 575 3 msbA ATP-dependent lipid A-core flippase Wigglesworthia glossinidia brevipalpis
Q7VR44 0.0 725 61 0 575 3 msbA ATP-dependent lipid A-core flippase Blochmanniella floridana
Q080T2 0.0 652 52 2 588 3 msbA ATP-dependent lipid A-core flippase Shewanella frigidimarina (strain NCIMB 400)
Q8EDF0 0.0 646 52 2 588 3 msbA ATP-dependent lipid A-core flippase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q0HTS8 0.0 645 52 2 588 3 msbA ATP-dependent lipid A-core flippase Shewanella sp. (strain MR-7)
Q0HHH4 0.0 645 52 2 588 3 msbA ATP-dependent lipid A-core flippase Shewanella sp. (strain MR-4)
Q12M46 0.0 645 52 2 588 3 msbA ATP-dependent lipid A-core flippase Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q5QU36 0.0 643 54 0 577 3 msbA ATP-dependent lipid A-core flippase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q3IGX5 0.0 608 50 1 579 3 msbA ATP-dependent lipid A-core flippase Pseudoalteromonas translucida (strain TAC 125)
Q483B6 0.0 604 50 3 586 3 msbA1 ATP-dependent lipid A-core flippase 1 Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q15UY7 0.0 602 51 0 575 3 msbA ATP-dependent lipid A-core flippase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q3J7R8 0.0 530 44 0 568 3 msbA ATP-dependent lipid A-core flippase Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
Q480N3 1.01e-177 518 44 0 567 3 msbA2 ATP-dependent lipid A-core flippase 2 Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q3SFZ6 5.04e-174 508 45 0 575 3 msbA ATP-dependent lipid A-core flippase Thiobacillus denitrificans (strain ATCC 25259)
Q5ZUH9 7.89e-172 503 43 4 585 3 msbA ATP-dependent lipid A-core flippase Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q83D84 8.5e-170 498 42 1 581 3 msbA ATP-dependent lipid A-core flippase Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
Q5X498 1.84e-169 497 43 4 585 3 msbA ATP-dependent lipid A-core flippase Legionella pneumophila (strain Paris)
Q5WVN2 2.2e-167 491 43 4 585 3 msbA ATP-dependent lipid A-core flippase Legionella pneumophila (strain Lens)
Q2SIN5 1.38e-165 487 46 0 517 3 msbA ATP-dependent lipid A-core flippase Hahella chejuensis (strain KCTC 2396)
Q21WN9 1.62e-165 486 44 1 580 3 msbA ATP-dependent lipid A-core flippase Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q47JR8 3.76e-164 483 44 2 576 3 msbA ATP-dependent lipid A-core flippase Dechloromonas aromatica (strain RCB)
Q1QX69 3.29e-163 480 41 2 568 3 msbA ATP-dependent lipid A-core flippase Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q60AA3 1.64e-161 477 42 0 569 3 msbA ATP-dependent lipid A-core flippase Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q31FG2 2.08e-161 476 42 1 571 3 msbA ATP-dependent lipid A-core flippase Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q1GZI0 1.24e-160 474 42 1 573 3 msbA ATP-dependent lipid A-core flippase Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q7NZU6 2.83e-160 473 41 1 581 3 msbA ATP-dependent lipid A-core flippase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q4KJB2 6.91e-160 473 42 5 581 3 msbA ATP-dependent lipid A-core flippase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q0BKJ3 1.58e-158 469 41 3 575 3 msbA ATP-dependent lipid A-core flippase Francisella tularensis subsp. holarctica (strain OSU18)
Q2A1U9 1.58e-158 469 41 3 575 3 msbA ATP-dependent lipid A-core flippase Francisella tularensis subsp. holarctica (strain LVS)
Q4FS42 3.82e-158 468 43 3 571 3 msbA ATP-dependent lipid A-core flippase Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q5NIG3 2.03e-157 467 41 3 575 3 msbA ATP-dependent lipid A-core flippase Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q14JW6 2.03e-157 467 41 3 575 1 msbA ATP-dependent lipid A-core flippase Francisella tularensis subsp. tularensis (strain FSC 198)
Q3KJ31 6.1e-157 465 42 3 580 3 msbA ATP-dependent lipid A-core flippase Pseudomonas fluorescens (strain Pf0-1)
Q1QBW0 8.87e-156 462 42 3 571 3 msbA ATP-dependent lipid A-core flippase Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q142P6 8.45e-155 459 42 3 572 3 msbA ATP-dependent lipid A-core flippase Paraburkholderia xenovorans (strain LB400)
Q0A4U4 2.28e-154 458 42 0 568 3 msbA ATP-dependent lipid A-core flippase Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q39E73 1.54e-153 456 40 2 580 3 msbA ATP-dependent lipid A-core flippase Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q0VQP5 1.03e-152 454 41 7 574 3 msbA ATP-dependent lipid A-core flippase Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q47908 1.35e-152 454 42 3 551 3 msbA ATP-dependent lipid A-core flippase Francisella novicida
Q9HUG8 1.36e-152 454 41 4 585 3 msbA ATP-dependent lipid A-core flippase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q1BUV6 1.65e-152 453 40 2 580 3 msbA ATP-dependent lipid A-core flippase Burkholderia orbicola (strain AU 1054)
Q5P2S7 2.7e-152 453 42 3 585 3 msbA ATP-dependent lipid A-core flippase Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
Q8P8W4 7.8e-152 452 40 0 574 3 msbA ATP-dependent lipid A-core flippase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q4UV65 7.8e-152 452 40 0 574 3 msbA ATP-dependent lipid A-core flippase Xanthomonas campestris pv. campestris (strain 8004)
Q3BTC8 2.07e-151 451 40 0 574 3 msbA ATP-dependent lipid A-core flippase Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q8PKS5 1.07e-150 449 40 0 574 3 msbA ATP-dependent lipid A-core flippase Xanthomonas axonopodis pv. citri (strain 306)
Q5H0H0 1.59e-149 446 39 0 578 3 msbA ATP-dependent lipid A-core flippase Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q2P3E7 1.59e-149 446 39 0 578 3 msbA ATP-dependent lipid A-core flippase Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q8XXB6 6.11e-149 444 39 1 570 3 msbA ATP-dependent lipid A-core flippase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q87VF3 3.24e-148 443 40 3 583 3 msbA ATP-dependent lipid A-core flippase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q48P40 7.7e-147 439 41 3 579 3 msbA ATP-dependent lipid A-core flippase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q88D92 1.16e-146 439 40 3 583 3 msbA ATP-dependent lipid A-core flippase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q1LQD3 9.04e-146 436 40 2 574 3 msbA ATP-dependent lipid A-core flippase Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q4ZZ16 2.76e-145 435 41 3 579 3 msbA ATP-dependent lipid A-core flippase Pseudomonas syringae pv. syringae (strain B728a)
Q63VX7 9.62e-145 434 40 4 573 3 msbA ATP-dependent lipid A-core flippase Burkholderia pseudomallei (strain K96243)
Q3JUI6 9.62e-145 434 40 4 573 3 msbA ATP-dependent lipid A-core flippase Burkholderia pseudomallei (strain 1710b)
Q62IG3 9.62e-145 434 40 4 573 3 msbA ATP-dependent lipid A-core flippase Burkholderia mallei (strain ATCC 23344)
Q2SZW0 1.07e-144 434 40 4 573 3 msbA ATP-dependent lipid A-core flippase Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q87EF0 9.37e-141 423 38 0 570 3 msbA ATP-dependent lipid A-core flippase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q9PEE7 2.91e-140 422 38 0 570 3 msbA ATP-dependent lipid A-core flippase Xylella fastidiosa (strain 9a5c)
Q7VWD8 2.2e-139 421 37 1 571 3 msbA ATP-dependent lipid A-core flippase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7W9N7 2.58e-139 421 37 1 571 3 msbA ATP-dependent lipid A-core flippase Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WH20 2.58e-139 421 37 1 571 3 msbA ATP-dependent lipid A-core flippase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q21NS8 4.08e-139 419 39 5 580 3 msbA ATP-dependent lipid A-core flippase Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q46Y89 1.96e-138 417 38 1 569 3 msbA ATP-dependent lipid A-core flippase Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q2KYS6 1.41e-137 415 37 1 571 3 msbA ATP-dependent lipid A-core flippase Bordetella avium (strain 197N)
Q6AJW3 1.73e-136 412 38 4 575 3 msbA ATP-dependent lipid A-core flippase Desulfotalea psychrophila (strain LSv54 / DSM 12343)
Q2LVL0 2.03e-133 405 37 4 571 3 msbA ATP-dependent lipid A-core flippase Syntrophus aciditrophicus (strain SB)
Q6F9X0 3.24e-132 401 39 5 573 3 msbA ATP-dependent lipid A-core flippase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q12C33 1.81e-124 381 36 2 573 3 msbA ATP-dependent lipid A-core flippase Polaromonas sp. (strain JS666 / ATCC BAA-500)
Q9JXR3 2.79e-120 372 35 2 597 3 msbA ATP-dependent lipid A-core flippase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9JW59 3.19e-119 369 34 2 597 3 msbA ATP-dependent lipid A-core flippase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q5F4X8 6.96e-119 368 35 3 597 3 msbA ATP-dependent lipid A-core flippase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q9WYC4 6.29e-107 336 33 5 576 1 TM_0288 Uncharacterized ABC transporter ATP-binding protein TM_0288 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q2G2M9 9.77e-103 325 32 4 578 3 SAOUHSC_02003 Putative multidrug export ATP-binding/permease protein SAOUHSC_02003 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q6GFJ1 9.77e-103 325 32 4 578 3 SAR1956 Putative multidrug export ATP-binding/permease protein SAR1956 Staphylococcus aureus (strain MRSA252)
Q5HEQ8 9.77e-103 325 32 4 578 3 SACOL1924 Putative multidrug export ATP-binding/permease protein SACOL1924 Staphylococcus aureus (strain COL)
Q99T13 9.77e-103 325 32 4 578 1 SAV1866 Putative multidrug export ATP-binding/permease protein SAV1866 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q2FFM9 9.77e-103 325 32 4 578 3 SAUSA300_1847 Putative multidrug export ATP-binding/permease protein SAUSA300_1847 Staphylococcus aureus (strain USA300)
Q7A0J1 9.77e-103 325 32 4 578 3 MW1806 Putative multidrug export ATP-binding/permease protein MW1806 Staphylococcus aureus (strain MW2)
Q6G868 9.77e-103 325 32 4 578 3 SAS1788 Putative multidrug export ATP-binding/permease protein SAS1788 Staphylococcus aureus (strain MSSA476)
Q7A4T3 9.77e-103 325 32 4 578 1 SA1683 Putative multidrug export ATP-binding/permease protein SA1683 Staphylococcus aureus (strain N315)
P45861 8.13e-101 320 36 5 516 1 ywjA Uncharacterized ABC transporter ATP-binding protein YwjA Bacillus subtilis (strain 168)
Q2YU20 1.86e-100 319 32 4 578 3 SAB1799c Putative multidrug export ATP-binding/permease protein SAB1799c Staphylococcus aureus (strain bovine RF122 / ET3-1)
P71082 2.76e-99 316 31 4 574 3 ygaD Putative multidrug export ATP-binding/permease protein YgaD Bacillus subtilis (strain 168)
P54719 5.48e-99 316 33 7 584 3 yfiC Uncharacterized ABC transporter ATP-binding protein YfiC Bacillus subtilis (strain 168)
P55469 2.78e-97 311 34 3 506 3 NGR_a03510 Uncharacterized ABC transporter ATP-binding protein y4gM Sinorhizobium fredii (strain NBRC 101917 / NGR234)
O31707 8.2e-97 310 31 2 572 3 yknU Uncharacterized ABC transporter ATP-binding protein YknU Bacillus subtilis (strain 168)
Q9FNU2 1.1e-92 300 34 3 515 2 ABCB25 ABC transporter B family member 25 Oryza sativa subsp. japonica
P22638 1.41e-91 296 35 6 515 2 hepA Heterocyst differentiation ATP-binding protein HepA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q9JI39 4.89e-88 290 33 7 536 1 Abcb10 ATP-binding cassette sub-family B member 10, mitochondrial Mus musculus
Q9NRK6 3.06e-87 289 34 7 533 1 ABCB10 ATP-binding cassette sub-family B member 10, mitochondrial Homo sapiens
Q54BU4 1.29e-86 291 33 5 512 3 abcB1 ABC transporter B family member 1 Dictyostelium discoideum
Q9JJ59 1.3e-86 288 32 6 577 1 Abcb9 ABC-type oligopeptide transporter ABCB9 Mus musculus
P08183 3.14e-86 295 37 12 508 1 ABCB1 ATP-dependent translocase ABCB1 Homo sapiens
P08183 1.28e-77 270 31 12 595 1 ABCB1 ATP-dependent translocase ABCB1 Homo sapiens
Q9QYJ4 3.53e-86 286 32 6 577 1 Abcb9 ABC-type oligopeptide transporter ABCB9 Rattus norvegicus
O06967 7.36e-86 281 33 6 545 1 bmrA Multidrug resistance ABC transporter ATP-binding/permease protein BmrA Bacillus subtilis (strain 168)
Q0WML0 1.33e-85 282 36 7 501 1 ABCB27 ABC transporter B family member 27 Arabidopsis thaliana
O31708 3.69e-85 280 30 7 571 3 yknV Uncharacterized ABC transporter ATP-binding protein YknV Bacillus subtilis (strain 168)
P21440 4.19e-85 291 36 7 494 1 Abcb4 Phosphatidylcholine translocator ABCB4 Mus musculus
P21440 2.05e-78 273 30 12 581 1 Abcb4 Phosphatidylcholine translocator ABCB4 Mus musculus
Q9NP78 5.51e-85 283 31 6 577 1 ABCB9 ABC-type oligopeptide transporter ABCB9 Homo sapiens
P9WQJ3 5.95e-85 280 34 3 482 1 Rv1272c Fatty acid ABC transporter ATP-binding/permease protein Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQJ2 5.95e-85 280 34 3 482 3 MT1310 Fatty acid ABC transporter ATP-binding/permease protein Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63398 5.95e-85 280 34 3 482 3 BQ2027_MB1303C Fatty acid ABC transporter ATP-binding/permease protein Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q9C7F2 6.46e-85 291 36 10 526 3 ABCB14 ABC transporter B family member 14 Arabidopsis thaliana
Q9C7F2 3.05e-74 260 34 8 493 3 ABCB14 ABC transporter B family member 14 Arabidopsis thaliana
O07549 8.64e-85 281 32 6 502 1 yheH Probable multidrug resistance ABC transporter ATP-binding/permease protein YheH Bacillus subtilis (strain 168)
P21439 1.12e-84 290 35 8 512 1 ABCB4 Phosphatidylcholine translocator ABCB4 Homo sapiens
P21439 1.43e-75 265 31 12 587 1 ABCB4 Phosphatidylcholine translocator ABCB4 Homo sapiens
P43245 1.2e-84 290 37 12 505 2 Abcb1 ATP-dependent translocase ABCB1 Rattus norvegicus
P43245 1.42e-76 267 33 12 529 2 Abcb1 ATP-dependent translocase ABCB1 Rattus norvegicus
Q9C7F8 2.07e-84 289 36 12 527 3 ABCB13 ABC transporter B family member 13 Arabidopsis thaliana
Q9C7F8 2.53e-77 269 34 5 487 3 ABCB13 ABC transporter B family member 13 Arabidopsis thaliana
Q9FWX7 8.51e-84 288 35 11 531 2 ABCB11 ABC transporter B family member 11 Arabidopsis thaliana
Q9FWX7 1.7e-76 267 32 10 566 2 ABCB11 ABC transporter B family member 11 Arabidopsis thaliana
P23174 1.81e-83 287 36 9 497 2 ABCB4 Phosphatidylcholine translocator ABCB4 Cricetulus griseus
P23174 3.33e-77 269 29 12 581 2 ABCB4 Phosphatidylcholine translocator ABCB4 Cricetulus griseus
P21449 1.9e-83 287 36 12 505 2 PGY2 Multidrug resistance protein 2 Cricetulus griseus
P21449 6.24e-79 274 32 9 539 2 PGY2 Multidrug resistance protein 2 Cricetulus griseus
P21448 3.9e-83 286 35 11 505 1 ABCB1 ATP-dependent translocase ABCB1 Cricetulus griseus
P21448 1.28e-79 276 32 9 536 1 ABCB1 ATP-dependent translocase ABCB1 Cricetulus griseus
Q08201 7.94e-83 285 34 9 546 1 Abcb4 Phosphatidylcholine translocator ABCB4 Rattus norvegicus
Q08201 2.28e-78 272 30 11 581 1 Abcb4 Phosphatidylcholine translocator ABCB4 Rattus norvegicus
P21447 1.23e-82 285 35 11 507 1 Abcb1a ATP-dependent translocase ABCB1 Mus musculus
P21447 3.6e-80 278 33 10 536 1 Abcb1a ATP-dependent translocase ABCB1 Mus musculus
Q9SYI3 1.29e-82 284 33 16 571 3 ABCB5 ABC transporter B family member 5 Arabidopsis thaliana
Q9SYI3 8.22e-75 262 32 14 596 3 ABCB5 ABC transporter B family member 5 Arabidopsis thaliana
P06795 1.26e-81 281 36 12 505 1 Abcb1b ATP-dependent translocase ABCB1 Mus musculus
P06795 6.9e-77 268 32 9 531 1 Abcb1b ATP-dependent translocase ABCB1 Mus musculus
B2GUP8 6.11e-81 271 35 9 518 2 abcb8 Mitochondrial potassium channel ATP-binding subunit Xenopus tropicalis
Q9M1Q9 7e-81 280 33 12 604 1 ABCB21 ABC transporter B family member 21 Arabidopsis thaliana
Q9M1Q9 8.17e-79 274 33 7 504 1 ABCB21 ABC transporter B family member 21 Arabidopsis thaliana
Q5RFQ9 1.18e-80 271 34 5 514 2 ABCB8 Mitochondrial potassium channel ATP-binding subunit Pongo abelii
Q2ULH4 1.31e-80 271 33 10 524 3 atm1 Iron-sulfur clusters transporter atm1, mitochondrial Aspergillus oryzae (strain ATCC 42149 / RIB 40)
Q9CXJ4 1.7e-80 270 33 7 564 1 Abcb8 Mitochondrial potassium channel ATP-binding subunit Mus musculus
O80725 1.72e-80 278 35 10 500 1 ABCB4 ABC transporter B family member 4 Arabidopsis thaliana
O80725 1.35e-77 270 32 14 568 1 ABCB4 ABC transporter B family member 4 Arabidopsis thaliana
Q9FWX8 2.26e-80 278 35 14 537 2 ABCB12 ABC transporter B family member 12 Arabidopsis thaliana
Q9FWX8 3.56e-79 275 33 9 549 2 ABCB12 ABC transporter B family member 12 Arabidopsis thaliana
Q9NUT2 3e-80 270 34 5 514 1 ABCB8 Mitochondrial potassium channel ATP-binding subunit Homo sapiens
Q56A55 3.03e-80 270 35 5 502 2 abcb8 Mitochondrial potassium channel ATP-binding subunit Danio rerio
Q9FHF1 7.45e-80 276 32 11 572 3 ABCB7 ABC transporter B family member 7 Arabidopsis thaliana
Q9FHF1 8.81e-71 251 32 13 591 3 ABCB7 ABC transporter B family member 7 Arabidopsis thaliana
Q9SGY1 2.79e-79 275 33 10 555 1 ABCB10 ABC transporter B family member 10 Arabidopsis thaliana
Q9SGY1 2.28e-69 246 33 13 511 1 ABCB10 ABC transporter B family member 10 Arabidopsis thaliana
Q5RKI8 6.51e-79 266 33 6 522 2 Abcb8 Mitochondrial potassium channel ATP-binding subunit Rattus norvegicus
Q54W24 1.37e-78 266 34 8 510 3 abcB4 ABC transporter B family member 4 Dictyostelium discoideum
P34712 1.92e-78 273 33 10 558 1 pgp-1 Multidrug resistance protein pgp-1 Caenorhabditis elegans
P34712 8.46e-75 262 33 11 544 1 pgp-1 Multidrug resistance protein pgp-1 Caenorhabditis elegans
P77265 1.95e-78 261 31 3 518 3 mdlA Multidrug resistance-like ATP-binding protein MdlA Escherichia coli (strain K12)
Q4WPP6 4.55e-78 265 36 10 499 2 mdr2 ABC multidrug transporter mdr2 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
P16875 5.48e-78 271 33 10 513 3 MDR1 Multidrug resistance protein 1 Entamoeba histolytica (strain ATCC 30459 / HM-1:IMSS / ABRM)
P16875 6.3e-71 251 32 8 530 3 MDR1 Multidrug resistance protein 1 Entamoeba histolytica (strain ATCC 30459 / HM-1:IMSS / ABRM)
P47261 6.92e-78 260 32 8 495 3 MG015 Putative ABC transporter ATP-binding protein MG015 Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q9LJX0 1.18e-77 270 34 10 540 1 ABCB19 ABC transporter B family member 19 Arabidopsis thaliana
Q9LJX0 1.73e-65 235 31 5 504 1 ABCB19 ABC transporter B family member 19 Arabidopsis thaliana
Q8T9W4 1.56e-77 271 32 16 585 3 abcB3 ABC transporter B family member 3 Dictyostelium discoideum
Q8T9W4 1.42e-68 244 33 14 563 3 abcB3 ABC transporter B family member 3 Dictyostelium discoideum
Q8K985 1.71e-77 259 29 3 482 3 mdlA Multidrug resistance-like ATP-binding protein MdlA Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
P16876 2.15e-77 270 32 11 524 3 MDR3 Multidrug resistance protein 3 Entamoeba histolytica (strain ATCC 30459 / HM-1:IMSS / ABRM)
P16876 1.42e-69 247 32 9 512 3 MDR3 Multidrug resistance protein 3 Entamoeba histolytica (strain ATCC 30459 / HM-1:IMSS / ABRM)
Q9ZR72 2.83e-77 269 34 13 542 1 ABCB1 ABC transporter B family member 1 Arabidopsis thaliana
Q9ZR72 9.98e-69 245 35 12 493 1 ABCB1 ABC transporter B family member 1 Arabidopsis thaliana
Q6C6N0 2.99e-77 261 30 8 523 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Yarrowia lipolytica (strain CLIB 122 / E 150)
B5X0E4 3.23e-77 269 34 10 523 2 Abcb5 ATP-binding cassette sub-family B member 5 Mus musculus
B5X0E4 1.29e-74 261 31 8 529 2 Abcb5 ATP-binding cassette sub-family B member 5 Mus musculus
P16877 4.92e-77 269 33 10 518 3 MDR4 Multidrug resistance protein 4 Entamoeba histolytica (strain ATCC 30459 / HM-1:IMSS / ABRM)
P16877 3.76e-68 243 30 6 528 3 MDR4 Multidrug resistance protein 4 Entamoeba histolytica (strain ATCC 30459 / HM-1:IMSS / ABRM)
Q2HIE9 5e-77 258 32 9 501 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Chaetomium globosum (strain ATCC 6205 / CBS 148.51 / DSM 1962 / NBRC 6347 / NRRL 1970)
Q7RX59 5.14e-77 261 32 7 500 3 fes-4 Iron-sulfur clusters transporter atm1, mitochondrial Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q8LPK2 1.89e-76 267 32 11 562 1 ABCB2 ABC transporter B family member 2 Arabidopsis thaliana
Q8LPK2 1.03e-63 230 32 14 529 1 ABCB2 ABC transporter B family member 2 Arabidopsis thaliana
P34713 2.62e-76 266 33 8 523 2 pgp-3 Multidrug resistance protein pgp-3 Caenorhabditis elegans
P34713 2.71e-72 255 32 16 602 2 pgp-3 Multidrug resistance protein pgp-3 Caenorhabditis elegans
Q8RY46 3.32e-76 258 30 8 584 1 ABCB26 ABC transporter B family member 26, chloroplastic Arabidopsis thaliana
Q54BT3 5.11e-76 266 32 8 495 3 abcB2 ABC transporter B family member 2 Dictyostelium discoideum
Q54BT3 3.73e-57 211 45 3 270 3 abcB2 ABC transporter B family member 2 Dictyostelium discoideum
Q6YUU5 1.17e-75 265 35 11 501 3 Os02g0190300 Putative multidrug resistance protein Oryza sativa subsp. japonica
Q6YUU5 4.22e-72 254 35 13 515 3 Os02g0190300 Putative multidrug resistance protein Oryza sativa subsp. japonica
Q9CHL8 1.45e-75 254 32 5 489 1 lmrA Multidrug resistance ABC transporter ATP-binding and permease protein Lactococcus lactis subsp. lactis (strain IL1403)
P75094 1.47e-75 255 33 12 502 3 MPN_019 Putative ABC transporter ATP-binding protein MG015 homolog Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q9DC29 2.06e-75 259 34 10 486 1 Abcb6 ATP-binding cassette sub-family B member 6 Mus musculus
Q9SYI2 2.15e-75 264 33 13 567 3 ABCB3 ABC transporter B family member 3 Arabidopsis thaliana
Q9SYI2 2.12e-73 258 32 12 544 3 ABCB3 ABC transporter B family member 3 Arabidopsis thaliana
Q46717 2.17e-75 256 32 9 501 3 hlyB Alpha-hemolysin translocation ATP-binding protein HlyB Escherichia coli O157:H7
G5EG61 2.35e-75 264 32 9 569 2 pgp-14 P-glycoprotein 14 Caenorhabditis elegans
G5EG61 5.69e-72 254 33 9 511 2 pgp-14 P-glycoprotein 14 Caenorhabditis elegans
Q9M0M2 3.77e-75 263 34 11 540 3 ABCB9 ABC transporter B family member 9 Arabidopsis thaliana
Q9M0M2 1.31e-73 259 31 15 577 3 ABCB9 ABC transporter B family member 9 Arabidopsis thaliana
P26760 8.07e-75 255 31 12 550 1 apxIB Toxin RTX-I translocation ATP-binding protein Actinobacillus pleuropneumoniae
P08716 8.68e-75 255 31 11 547 1 hlyB Alpha-hemolysin translocation ATP-binding protein HlyB Escherichia coli
A0A1U8QG99 1.04e-74 262 33 12 536 2 atrC ABC multidrug transporter atrC Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
A0A1U8QG99 2.62e-49 187 29 16 585 2 atrC ABC multidrug transporter atrC Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
P10089 1.2e-74 254 31 11 547 3 hlyB Alpha-hemolysin translocation ATP-binding protein HlyB Escherichia coli
Q4HVU7 1.82e-74 254 31 7 485 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
Q47258 1.85e-74 254 31 11 547 1 hlyB Alpha-hemolysin translocation ATP-binding protein HlyB Escherichia coli
Q2M3G0 2.28e-74 261 32 7 507 1 ABCB5 ATP-binding cassette sub-family B member 5 Homo sapiens
Q2M3G0 4.49e-71 251 31 11 546 1 ABCB5 ATP-binding cassette sub-family B member 5 Homo sapiens
A0A125QXJ1 2.36e-74 256 34 11 486 2 ABCB6 ATP-binding cassette sub-family B member 6 Mesocricetus auratus
Q9LSJ2 3.62e-74 260 34 7 525 3 ABCB22 ABC transporter B family member 22 Arabidopsis thaliana
Q9LSJ2 1.84e-70 249 32 13 568 3 ABCB22 ABC transporter B family member 22 Arabidopsis thaliana
Q4WLN7 4.32e-74 253 33 10 524 3 atm1 Iron-sulfur clusters transporter atm1, mitochondrial Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
P0DKX6 5.48e-74 253 31 7 552 3 cyaB Cyclolysin secretion/processing ATP-binding protein CyaB Bordetella pertussis (strain ATCC 9797 / DSM 5571 / CCUG 30873 / LMG 14455 / NCTC 10739 / 18323)
Q4WTT9 5.78e-74 260 35 12 499 2 mdr1 ABC multidrug transporter mdr1 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WTT9 3.18e-71 252 32 12 549 2 mdr1 ABC multidrug transporter mdr1 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
P36619 6.94e-74 260 33 13 546 3 pmd1 Leptomycin B resistance protein pmd1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P36619 5.21e-65 234 30 8 532 3 pmd1 Leptomycin B resistance protein pmd1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q8FDZ8 8.44e-74 252 31 11 547 1 hlyB Alpha-hemolysin translocation ATP-binding protein HlyB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q9NP58 9.26e-74 254 36 11 433 1 ABCB6 ATP-binding cassette sub-family B member 6 Homo sapiens
Q9LHD1 9.85e-74 259 34 7 503 3 ABCB15 ABC transporter B family member 15 Arabidopsis thaliana
Q9LHD1 5.71e-65 234 31 13 566 3 ABCB15 ABC transporter B family member 15 Arabidopsis thaliana
Q4WA92 1.02e-73 259 34 11 520 2 abcE ABC multidrug transporter E Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WA92 8.23e-51 192 28 17 596 2 abcE ABC multidrug transporter E Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q9Y8G2 1.14e-73 259 33 12 536 2 atrC ABC multidrug transporter atrC Emericella nidulans
Q9Y8G2 2.3e-49 188 29 16 585 2 atrC ABC multidrug transporter atrC Emericella nidulans
Q6BXD7 1.43e-73 251 30 13 584 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
P0DKX5 1.55e-73 251 31 7 552 3 cyaB Cyclolysin secretion/processing ATP-binding protein CyaB Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
O07550 1.96e-73 248 30 9 523 1 yheI Probable multidrug resistance ABC transporter ATP-binding/permease protein YheI Bacillus subtilis (strain 168)
Q5B1Q2 2.23e-73 251 32 8 499 3 atm1 Iron-sulfur clusters transporter atm1, mitochondrial Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
P35598 2.28e-73 248 29 9 528 3 exp8 Putative ABC transporter ATP-binding protein exp8 Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q54RU1 2.8e-73 250 40 5 345 3 abcB6 ABC transporter B family member 6 Dictyostelium discoideum
P0C086 3.65e-73 250 31 10 547 3 lktB Leukotoxin translocation ATP-binding protein LktB Mannheimia haemolytica
P0C087 3.65e-73 250 31 10 547 3 lktB Leukotoxin translocation ATP-binding protein LktB Mannheimia haemolytica
Q8T9W2 3.77e-73 250 34 8 480 3 abcB5 ABC transporter B family member 5 Dictyostelium discoideum
Q93FH2 3.85e-73 250 31 10 547 3 lktB Leukotoxin translocation ATP-binding protein LktB Mannheimia haemolytica
Q933E0 4.35e-73 250 31 10 547 3 lktB Leukotoxin translocation ATP-binding protein LktB Bibersteinia trehalosi
Q93FH0 4.78e-73 250 31 10 547 3 lktB Leukotoxin translocation ATP-binding protein LktB Mannheimia haemolytica
Q93FH6 4.78e-73 250 31 10 547 3 lktB Leukotoxin translocation ATP-binding protein LktB Mannheimia haemolytica
P97046 5.9e-73 247 32 5 489 3 lmrA Multidrug resistance ABC transporter ATP-binding and permease protein Lactococcus lactis subsp. cremoris (strain MG1363)
P54718 6.71e-73 246 29 10 567 3 yfiB Uncharacterized ABC transporter ATP-binding protein YfiB Bacillus subtilis (strain 168)
P97998 8.07e-73 249 33 11 524 3 MDL1 ATP-dependent permease MDL1 Candida albicans
Q57180 8.81e-73 247 31 17 602 3 HI_1051 Uncharacterized ABC transporter ATP-binding protein HI_1051 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P16532 1.04e-72 249 30 10 560 3 lktB Leukotoxin translocation ATP-binding protein LktB Mannheimia haemolytica
Q9LSJ6 1.06e-72 256 33 16 573 3 ABCB17 ABC transporter B family member 17 Arabidopsis thaliana
Q9LSJ6 3.21e-71 252 33 10 512 3 ABCB17 ABC transporter B family member 17 Arabidopsis thaliana
Q933I3 1.1e-72 249 31 10 547 3 lktB Leukotoxin translocation ATP-binding protein LktB Mannheimia glucosida
Q93FH3 1.34e-72 249 31 10 547 3 lktB Leukotoxin translocation ATP-binding protein LktB Mannheimia haemolytica
Q02592 1.92e-72 251 32 7 486 2 hmt1 Heavy metal tolerance protein Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9FUT3 2.44e-72 248 33 11 515 1 ABCB23 ABC transporter B family member 23, mitochondrial Arabidopsis thaliana
B8K1W2 4.5e-72 254 34 9 508 1 Abcb11e Bile salt export pump Canis lupus familiaris
B8K1W2 3.04e-68 243 30 10 593 1 Abcb11e Bile salt export pump Canis lupus familiaris
O70595 4.92e-72 250 35 13 488 1 Abcb6 ATP-binding cassette sub-family B member 6 Rattus norvegicus
P23702 5.19e-72 247 31 12 546 1 ltxB Leukotoxin export ATP-binding protein LtxB Aggregatibacter actinomycetemcomitans
J9VF33 6.76e-72 254 35 10 497 1 MDR1 ABC multidrug transporter MDR1 Cryptococcus neoformans var. grubii serotype A (strain H99 / ATCC 208821 / CBS 10515 / FGSC 9487)
J9VF33 2.49e-61 223 33 11 499 1 MDR1 ABC multidrug transporter MDR1 Cryptococcus neoformans var. grubii serotype A (strain H99 / ATCC 208821 / CBS 10515 / FGSC 9487)
Q93FG6 8.23e-72 247 31 10 547 3 lktB Leukotoxin translocation ATP-binding protein LktB Mannheimia haemolytica
F2SQT8 9.54e-72 253 32 11 552 1 MDR5 ABC multidrug transporter MDR5 Trichophyton rubrum (strain ATCC MYA-4607 / CBS 118892)
F2SQT8 1.49e-57 212 43 1 239 1 MDR5 ABC multidrug transporter MDR5 Trichophyton rubrum (strain ATCC MYA-4607 / CBS 118892)
H2LNR5 1.26e-71 247 33 9 493 1 abcb7 Iron-sulfur clusters transporter ABCB7, mitochondrial Oryzias latipes
Q9Y7M7 1.7e-71 246 34 9 528 3 mdl1 ATP-dependent permease MDL1, mitochondrial Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9LSJ5 1.93e-71 252 34 13 535 3 ABCB18 ABC transporter B family member 18 Arabidopsis thaliana
Q9LSJ5 2.4e-71 252 32 13 566 3 ABCB18 ABC transporter B family member 18 Arabidopsis thaliana
H6TB12 2.96e-71 252 32 12 526 1 mdr Sophorolipid transporter Starmerella bombicola
H6TB12 2.93e-65 235 32 8 499 1 mdr Sophorolipid transporter Starmerella bombicola
P33311 6.95e-71 246 33 5 509 1 MDL2 ATP-dependent permease MDL2, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
F2T1C4 7.76e-71 251 32 9 534 1 MDR2 ABC multidrug transporter MDR2 Trichophyton rubrum (strain ATCC MYA-4607 / CBS 118892)
F2T1C4 1.15e-67 242 33 13 517 1 MDR2 ABC multidrug transporter MDR2 Trichophyton rubrum (strain ATCC MYA-4607 / CBS 118892)
Q9RCG7 7.96e-71 244 30 10 549 3 paxB Exotoxin translocation ATP-binding protein PaxB Pasteurella aerogenes
F2RP52 1.17e-70 251 31 9 542 2 MDR2 ABC multidrug transporter MDR2 Trichophyton tonsurans (strain CBS 112818)
F2RP52 3.93e-68 243 33 13 517 2 MDR2 ABC multidrug transporter MDR2 Trichophyton tonsurans (strain CBS 112818)
F2PRR1 1.17e-70 251 31 9 542 2 MDR2 ABC multidrug transporter MDR2 Trichophyton equinum (strain ATCC MYA-4606 / CBS 127.97)
F2PRR1 3.93e-68 243 33 13 517 2 MDR2 ABC multidrug transporter MDR2 Trichophyton equinum (strain ATCC MYA-4606 / CBS 127.97)
Q00449 1.28e-70 250 32 11 496 2 Mdr49 Multidrug resistance protein homolog 49 Drosophila melanogaster
Q00449 6.1e-67 239 32 14 602 2 Mdr49 Multidrug resistance protein homolog 49 Drosophila melanogaster
A0A059JJ46 1.96e-70 250 31 9 542 2 MDR2 ABC multidrug transporter MDR2 Trichophyton interdigitale (strain MR816)
A0A059JJ46 3.86e-68 243 33 13 517 2 MDR2 ABC multidrug transporter MDR2 Trichophyton interdigitale (strain MR816)
Q9GTN7 2.11e-70 250 30 6 521 1 tagA Serine protease/ABC transporter B family protein tagA Dictyostelium discoideum
Q8LPQ6 2.21e-70 243 33 15 562 2 ABCB28 ABC transporter B family member 28 Arabidopsis thaliana
Q2G506 2.91e-70 240 32 7 485 1 atm1 ATM1-type heavy metal exporter Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
E7F6F7 3.29e-70 243 31 12 588 3 abcb7 Iron-sulfur clusters transporter ABCB7, mitochondrial Danio rerio
P55122 4.75e-70 242 30 10 547 3 lktB Leukotoxin translocation ATP-binding protein LktB Pasteurella haemolytica-like sp. (strain 5943B)
Q9Y8G1 5.25e-70 249 35 13 500 1 atrD ABC multidrug transporter atrD Emericella nidulans
Q9Y8G1 1.28e-68 244 32 11 548 1 atrD ABC multidrug transporter atrD Emericella nidulans
Q5BAY0 6.06e-70 248 35 14 503 1 atrD ABC multidrug transporter atrD Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5BAY0 1.46e-68 244 32 11 548 1 atrD ABC multidrug transporter atrD Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q6Q876 9.64e-70 248 31 11 557 2 sirA Multidrug resistance protein sirA Leptosphaeria maculans
Q6Q876 5.48e-62 225 30 12 541 2 sirA Multidrug resistance protein sirA Leptosphaeria maculans
O95342 9.84e-70 248 32 9 508 1 ABCB11 Bile salt export pump Homo sapiens
O95342 6.45e-69 245 30 13 603 1 ABCB11 Bile salt export pump Homo sapiens
Q20Z38 1.28e-69 238 34 8 485 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Rhodopseudomonas palustris (strain BisB18)
O70127 2.03e-69 247 34 11 503 1 Abcb11 Bile salt export pump Rattus norvegicus
O70127 3.36e-67 240 31 11 582 1 Abcb11 Bile salt export pump Rattus norvegicus
Q9M0G9 3.74e-69 239 36 6 402 1 ABCB24 ABC transporter B family member 24, mitochondrial Arabidopsis thaliana
Q2UPC0 4.07e-69 241 33 5 431 3 aclQ ABC transporter aclQ Aspergillus oryzae (strain ATCC 42149 / RIB 40)
A0A095C325 5.82e-69 246 35 10 509 1 MDR1 ABC multidrug transporter MDR1 Cryptococcus deuterogattii (strain R265)
A0A095C325 1.19e-60 221 33 10 498 1 MDR1 ABC multidrug transporter MDR1 Cryptococcus deuterogattii (strain R265)
Q1RJ91 7.11e-69 236 30 8 508 3 RBE_0492 Putative export ATP-binding/permease protein RBE_0492 Rickettsia bellii (strain RML369-C)
Q71ED1 8.38e-69 236 32 3 475 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Agrobacterium vitis
Q6G2Z5 9.76e-69 236 32 9 492 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
P11599 9.96e-69 238 31 11 550 3 hlyB Alpha-hemolysin translocation ATP-binding protein HlyB Proteus vulgaris
Q89UT8 2e-68 235 34 9 487 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q9QY30 2.27e-68 244 34 11 503 1 Abcb11 Bile salt export pump Mus musculus
Q9QY30 1.64e-63 229 30 10 574 1 Abcb11 Bile salt export pump Mus musculus
Q4PH16 7.34e-68 237 30 10 521 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Ustilago maydis (strain 521 / FGSC 9021)
Q6N1Y7 7.69e-68 234 34 7 489 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q9LSJ8 9.51e-68 242 31 10 563 2 ABCB16 ABC transporter B family member 16 Arabidopsis thaliana
Q9LSJ8 3.82e-67 240 31 7 525 2 ABCB16 ABC transporter B family member 16 Arabidopsis thaliana
Q6FZF2 1.1e-67 233 32 8 478 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Bartonella quintana (strain Toulouse)
Q9LHK4 1.79e-67 241 29 10 577 5 ABCB8 Putative ABC transporter B family member 8 Arabidopsis thaliana
Q9LHK4 1.85e-58 215 33 14 519 5 ABCB8 Putative ABC transporter B family member 8 Arabidopsis thaliana
Q03519 2.65e-67 234 30 6 481 1 TAP2 Antigen peptide transporter 2 Homo sapiens
Q9LVM1 3.72e-67 234 32 10 515 1 ABCB25 ABC transporter B family member 25, mitochondrial Arabidopsis thaliana
J9VWU3 4.82e-67 234 31 9 487 2 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Cryptococcus neoformans var. grubii serotype A (strain H99 / ATCC 208821 / CBS 10515 / FGSC 9487)
Q00748 4.85e-67 240 32 11 542 1 Mdr65 Multidrug resistance protein homolog 65 Drosophila melanogaster
Q00748 8.06e-65 233 34 12 523 1 Mdr65 Multidrug resistance protein homolog 65 Drosophila melanogaster
Q3SP57 6.47e-67 231 33 13 533 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
Q07QX6 1.26e-66 231 33 7 491 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Rhodopseudomonas palustris (strain BisA53)
Q04473 1.41e-66 233 29 10 547 3 apxIIIB Toxin RTX-III translocation ATP-binding protein Actinobacillus pleuropneumoniae
P0CL93 2.65e-66 233 31 9 487 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Cryptococcus neoformans var. neoformans serotype D (strain B-3501A)
P0CL92 2.73e-66 233 31 9 487 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565)
Q9N0V3 2.99e-66 238 29 9 592 2 ABCB11 Bile salt export pump Oryctolagus cuniculus
Q9N0V3 5.71e-59 216 32 8 489 2 ABCB11 Bile salt export pump Oryctolagus cuniculus
Q1QH37 4.73e-66 229 32 12 545 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
G5EFD4 6.26e-66 233 32 8 487 2 hmt-1 Heavy metal tolerance factor 1 Caenorhabditis elegans
Q8LPT1 6.87e-66 237 29 9 528 1 ABCB6 ABC transporter B family member 6 Arabidopsis thaliana
Q8LPT1 2.39e-57 211 30 10 524 1 ABCB6 ABC transporter B family member 6 Arabidopsis thaliana
P40416 6.95e-66 230 31 9 486 1 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P59852 7.83e-66 231 29 9 533 1 lagD Lactococcin-G-processing and transport ATP-binding protein LagD Lactococcus lactis subsp. lactis
O75027 8.33e-66 231 29 14 608 1 ABCB7 Iron-sulfur clusters transporter ABCB7, mitochondrial Homo sapiens
Q6CX96 9.37e-66 231 29 13 601 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
Q2J0F4 1.11e-65 228 34 9 490 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Rhodopseudomonas palustris (strain HaA2)
A0A1U9YI12 1.18e-65 236 31 9 520 2 verA ABC-type transmembrane transporter verA Clonostachys rogersoniana
A0A1U9YI12 1.15e-52 197 27 19 597 2 verA ABC-type transmembrane transporter verA Clonostachys rogersoniana
P70864 1.6e-65 227 31 12 526 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Bartonella bacilliformis
A1USS5 1.93e-65 227 31 12 526 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Bartonella bacilliformis (strain ATCC 35685 / KC583 / Herrer 020/F12,63)
Q704E8 2.52e-65 230 29 14 607 1 Abcb7 Iron-sulfur clusters transporter ABCB7, mitochondrial Rattus norvegicus
Q68W42 3.82e-65 226 29 9 584 3 RT0691 Putative export ATP-binding/permease protein RT0691 Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q13BH6 4.12e-65 226 34 11 496 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Rhodopseudomonas palustris (strain BisB5)
Q4WD46 4.2e-65 234 31 8 516 2 fsqE ABC-type transporter fsqE Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WD46 1.74e-55 206 32 10 519 2 fsqE ABC-type transporter fsqE Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
P57551 5.15e-65 226 28 4 470 3 mdlA Multidrug resistance-like ATP-binding protein MdlA Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q2K342 5.26e-65 226 47 2 251 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q1MAB5 5.48e-65 226 41 3 329 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
O14286 6.79e-65 228 31 10 500 3 atm1 Iron-sulfur clusters transporter atm1, mitochondrial Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P0AAG5 1.49e-64 225 27 9 590 1 mdlB Multidrug resistance-like ATP-binding protein MdlB Escherichia coli (strain K12)
P0AAG6 1.49e-64 225 27 9 590 3 mdlB Multidrug resistance-like ATP-binding protein MdlB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AAG7 1.49e-64 225 27 9 590 3 mdlB Multidrug resistance-like ATP-binding protein MdlB Escherichia coli O157:H7
Q9ZCM8 4.8e-64 223 28 8 577 3 RP696 Putative export ATP-binding/permease protein RP696 Rickettsia prowazekii (strain Madrid E)
Q61102 5.6e-64 226 29 15 610 1 Abcb7 Iron-sulfur clusters transporter ABCB7, mitochondrial Mus musculus
Q59R09 1.25e-63 225 28 13 606 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Candida albicans (strain SC5314 / ATCC MYA-2876)
P33310 2.16e-63 224 30 8 508 1 MDL1 ATP-dependent permease MDL1, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A0A0D1BUH6 1.06e-62 227 31 9 534 2 atr1 ABC-type transporter atr1 Ustilago maydis (strain 521 / FGSC 9021)
A0A0D1BUH6 1.01e-59 219 30 10 528 2 atr1 ABC-type transporter atr1 Ustilago maydis (strain 521 / FGSC 9021)
Q9M3B9 1.52e-62 227 28 8 530 1 ABCB20 ABC transporter B family member 20 Arabidopsis thaliana
Q9M3B9 2e-55 206 30 10 524 1 ABCB20 ABC transporter B family member 20 Arabidopsis thaliana
S0EGU4 1.76e-62 226 29 10 541 2 BEA3 ABC transporter BEA3 Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
S0EGU4 5.93e-48 184 30 13 565 2 BEA3 ABC transporter BEA3 Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
P36372 2.37e-62 221 31 7 484 1 Tap2 Antigen peptide transporter 2 Rattus norvegicus
Q89A96 2.49e-62 218 26 10 583 3 mdlB Multidrug resistance-like ATP-binding protein MdlB Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q751N2 3.22e-62 221 29 10 533 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
Q08D64 3.64e-62 223 31 11 488 2 abcb6 ATP-binding cassette sub-family B member 6 Xenopus tropicalis
A0A348AXX9 2.11e-61 223 30 13 532 2 kk1G ABC-type transporter kk1G Curvularia clavata
A0A348AXX9 3.34e-58 214 28 19 640 2 kk1G ABC-type transporter kk1G Curvularia clavata
Q9LZB8 3.91e-61 216 33 7 503 1 ABCB29 ABC transporter B family member 29, chloroplastic Arabidopsis thaliana
Q4WSI1 4.22e-61 223 30 7 515 2 mdr4 ABC multidrug transporter mdr4 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WSI1 2.17e-57 212 29 11 520 2 mdr4 ABC multidrug transporter mdr4 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q28433 6.25e-61 218 29 3 483 2 TAP1 Antigen peptide transporter 1 Gorilla gorilla gorilla
P21958 7.36e-61 218 30 7 514 1 Tap1 Antigen peptide transporter 1 Mus musculus
Q8G0T8 8.18e-61 215 37 3 329 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Brucella suis biovar 1 (strain 1330)
P0CU83 9.27e-61 221 30 13 560 2 MDR4 ABC multidrug transporter MDR2 Trichophyton rubrum (strain ATCC MYA-4607 / CBS 118892)
P0CU83 1.39e-54 203 28 11 552 2 MDR4 ABC multidrug transporter MDR2 Trichophyton rubrum (strain ATCC MYA-4607 / CBS 118892)
P59653 1.6e-60 216 27 5 505 1 comA Transport/processing ATP-binding protein ComA Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
A0A059JK44 1.69e-60 221 30 13 560 2 MDR4 ABC multidrug transporter MDR2 Trichophyton interdigitale (strain MR816)
A0A059JK44 5.39e-55 204 28 11 552 2 MDR4 ABC multidrug transporter MDR2 Trichophyton interdigitale (strain MR816)
F2Q5G0 1.77e-60 221 30 13 560 2 MDR4 ABC multidrug transporter MDR2 Trichophyton equinum (strain ATCC MYA-4606 / CBS 127.97)
F2Q5G0 6.38e-55 204 28 11 552 2 MDR4 ABC multidrug transporter MDR2 Trichophyton equinum (strain ATCC MYA-4606 / CBS 127.97)
Q4UMZ3 2.97e-60 213 30 10 513 3 RF_0214 Putative export ATP-binding/permease protein RF_0214 Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
F2RPA4 3.14e-60 220 30 13 560 2 MDR4 ABC multidrug transporter MDR2 Trichophyton tonsurans (strain CBS 112818)
F2RPA4 1.43e-51 194 43 3 254 2 MDR4 ABC multidrug transporter MDR2 Trichophyton tonsurans (strain CBS 112818)
Q03727 3.34e-60 216 27 5 505 3 comA Transport/processing ATP-binding protein ComA Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q03518 3.56e-60 216 29 3 483 1 TAP1 Antigen peptide transporter 1 Homo sapiens
Q8YH20 5.66e-60 213 37 3 329 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
P0C529 6.88e-60 212 37 3 329 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Brucella abortus biovar 1 (strain 9-941)
Q2YQ73 6.88e-60 212 37 3 329 1 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Brucella abortus (strain 2308)
Q6FIK3 1.18e-59 214 30 11 490 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
P36370 2.83e-59 213 30 3 473 1 Tap1 Antigen peptide transporter 1 Rattus norvegicus
P18767 3.62e-59 210 32 6 477 1 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Rhizobium meliloti (strain 1021)
P36371 3.69e-59 212 30 5 483 1 Tap2 Antigen peptide transporter 2 Mus musculus
O53645 7.78e-59 216 28 6 540 1 Rv0194 Multidrug efflux ATP-binding/permease protein Rv0194 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
O53645 1.68e-50 191 30 3 386 1 Rv0194 Multidrug efflux ATP-binding/permease protein Rv0194 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
A1KF14 8.39e-59 216 28 6 540 1 BCG_0231 Multidrug efflux ATP-binding/permease protein BCG_0231 Mycobacterium bovis (strain BCG / Pasteur 1173P2)
A1KF14 2.29e-50 191 28 9 505 1 BCG_0231 Multidrug efflux ATP-binding/permease protein BCG_0231 Mycobacterium bovis (strain BCG / Pasteur 1173P2)
Q983H5 1.71e-58 208 38 3 329 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
P12866 8.21e-58 213 31 11 496 1 STE6 Alpha-factor-transporting ATPase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P12866 4.78e-44 172 25 10 563 1 STE6 Alpha-factor-transporting ATPase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q92GP9 8.25e-57 203 28 10 579 3 RC1073 Putative export ATP-binding/permease protein RC1073 Rickettsia conorii (strain ATCC VR-613 / Malish 7)
B2KWH4 8.38e-57 210 28 10 556 2 ABC1 ABC transporter 1 Ajellomyces capsulatus
B2KWH4 6.25e-53 198 29 13 539 2 ABC1 ABC transporter 1 Ajellomyces capsulatus
Q8K984 1.01e-56 203 29 8 493 3 mdlB Multidrug resistance-like ATP-binding protein MdlB Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
A0R6H8 1.27e-56 207 31 13 532 1 irtA Mycobactin import ATP-binding/permease protein IrtA Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
P0A2V1 1.48e-56 203 43 3 265 1 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Rhizobium radiobacter
P0A2V0 1.48e-56 203 43 3 265 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Agrobacterium fabrum (strain C58 / ATCC 33970)
Q06034 3.26e-56 208 28 14 580 3 MDR1 Multidrug resistance protein 1 Leishmania enriettii
Q06034 2.21e-44 173 29 14 547 3 MDR1 Multidrug resistance protein 1 Leishmania enriettii
P57552 4.74e-55 199 27 4 485 3 mdlB Multidrug resistance-like ATP-binding protein MdlB Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
P9WQJ9 9.77e-55 202 45 4 246 1 irtA Mycobactin import ATP-binding/permease protein IrtA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQJ8 9.77e-55 202 45 4 246 3 irtA Mycobactin import ATP-binding/permease protein IrtA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63392 9.77e-55 202 45 4 246 3 irtA Mycobactin import ATP-binding/permease protein IrtA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
G7CBF5 2.68e-54 201 31 20 600 1 irtA Mycobactin import ATP-binding/permease protein IrtA Mycolicibacterium thermoresistibile (strain ATCC 19527 / DSM 44167 / CIP 105390 / JCM 6362 / NCTC 10409 / 316)
K3VYH8 3.32e-54 202 29 10 582 3 FPSE_09185 ABC transporter FPSE_09185 Fusarium pseudograminearum (strain CS3096)
K3VYH8 3.63e-53 199 41 4 260 3 FPSE_09185 ABC transporter FPSE_09185 Fusarium pseudograminearum (strain CS3096)
P0A4W5 6.01e-54 196 26 10 545 3 BQ2027_MB1304C Uncharacterized ABC transporter ATP-binding protein Mb1304c Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WQJ1 6.01e-54 196 26 10 545 1 Rv1273c Uncharacterized ABC transporter ATP-binding protein Rv1273c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQJ0 6.72e-54 196 26 10 545 3 MT1311 Uncharacterized ABC transporter ATP-binding protein MT1311 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P36497 1.91e-53 197 28 7 479 3 pedD Pediocin PA-1 transport/processing ATP-binding protein PedD Pediococcus acidilactici
Q9ZNB0 3.05e-53 194 28 7 574 3 SCO0742 Uncharacterized ABC transporter ATP-binding protein SCO0742 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q00564 7.21e-53 195 26 10 554 3 lcnC Lactococcin-A transport/processing ATP-binding protein LcnC Lactococcus lactis subsp. lactis
Q89A97 1e-52 192 26 6 486 3 mdlA Multidrug resistance-like ATP-binding protein MdlA Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q9CJB8 2.56e-52 194 25 10 554 3 lcnC Lactococcin transport/processing ATP-binding protein LcnC-like Lactococcus lactis subsp. lactis (strain IL1403)
P23886 7.3e-52 190 31 8 387 1 cydC Glutathione/L-cysteine transport system ATP-binding/permease protein CydC Escherichia coli (strain K12)
P13568 1.9e-51 194 26 24 681 3 MDR1 Multidrug resistance protein Plasmodium falciparum (isolate FC27 / Papua New Guinea)
P13568 3.24e-49 187 27 23 655 3 MDR1 Multidrug resistance protein Plasmodium falciparum (isolate FC27 / Papua New Guinea)
Q23868 3.51e-51 193 40 3 247 2 tagC Serine protease/ABC transporter B family protein tagC Dictyostelium discoideum
Q23868 4.04e-06 53 20 9 348 2 tagC Serine protease/ABC transporter B family protein tagC Dictyostelium discoideum
Q10418 8.6e-51 189 26 9 509 3 mesD Mesentericin-Y105 transport/processing ATP-binding protein MesD Leuconostoc mesenteroides
P9WQJ7 2.24e-50 186 41 1 238 1 irtB Mycobactin import ATP-binding/permease protein IrtB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQJ6 2.24e-50 186 41 1 238 3 irtB Mycobactin import ATP-binding/permease protein IrtB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63394 2.24e-50 186 41 1 238 3 irtB Mycobactin import ATP-binding/permease protein IrtB Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q57538 2.48e-49 182 28 15 505 1 HI_0664 Probable ABC transporter ATP-binding/permease protein HI_0664 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P54683 1.99e-47 182 40 4 246 3 tagB Serine protease/ABC transporter B family protein tagB Dictyostelium discoideum
P54683 0.000683 46 25 1 98 3 tagB Serine protease/ABC transporter B family protein tagB Dictyostelium discoideum
O35379 2.34e-47 182 29 14 526 1 Abcc1 Multidrug resistance-associated protein 1 Mus musculus
O35379 2.76e-27 121 27 8 337 1 Abcc1 Multidrug resistance-associated protein 1 Mus musculus
P94367 3.88e-47 177 27 14 555 3 cydD Glutathione/L-cysteine transport system ATP-binding/permease protein CydD Bacillus subtilis (strain 168)
Q8CG09 5.11e-47 181 29 14 528 1 Abcc1 Multidrug resistance-associated protein 1 Rattus norvegicus
Q8CG09 1.2e-27 122 28 10 363 1 Abcc1 Multidrug resistance-associated protein 1 Rattus norvegicus
Q8T9W1 1.91e-46 179 39 4 245 3 tagD Serine protease/ABC transporter B family protein tagD Dictyostelium discoideum
Q8T9W1 9.07e-06 52 29 2 124 3 tagD Serine protease/ABC transporter B family protein tagD Dictyostelium discoideum
P45081 3.55e-46 174 35 4 256 3 cydC Glutathione/L-cysteine transport system ATP-binding/permease protein CydC Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P71355 3.83e-46 174 27 10 569 3 HI_0663 Uncharacterized ABC transporter ATP-binding protein HI_0663 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P33527 4.64e-45 175 27 11 520 1 ABCC1 Multidrug resistance-associated protein 1 Homo sapiens
P33527 5.17e-28 123 30 4 239 1 ABCC1 Multidrug resistance-associated protein 1 Homo sapiens
Q0P9C4 9.85e-45 170 36 3 235 1 pglK Protein glycosylation K Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q92887 1.05e-44 174 26 12 531 1 ABCC2 ATP-binding cassette sub-family C member 2 Homo sapiens
Q92887 4.14e-25 114 29 3 236 1 ABCC2 ATP-binding cassette sub-family C member 2 Homo sapiens
Q864R9 1.09e-44 174 27 12 526 1 ABCC1 Multidrug resistance-associated protein 1 Macaca fascicularis
Q864R9 7.52e-28 123 27 7 339 1 ABCC1 Multidrug resistance-associated protein 1 Macaca fascicularis
A0R6H7 1.59e-44 169 32 6 330 1 irtB Mycobactin import ATP-binding/permease protein IrtB Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q8HXQ5 3.81e-44 172 27 13 521 1 ABCC1 Multidrug resistance-associated protein 1 Bos taurus
Q8HXQ5 2.46e-27 121 31 4 238 1 ABCC1 Multidrug resistance-associated protein 1 Bos taurus
Q9QYM0 4.45e-44 172 28 14 571 2 Abcc5 ATP-binding cassette sub-family C member 5 Rattus norvegicus
Q9QYM0 1.04e-25 116 33 3 225 2 Abcc5 ATP-binding cassette sub-family C member 5 Rattus norvegicus
Q54NL1 5.08e-44 172 25 13 570 3 abcC9 ABC transporter C family member 9 Dictyostelium discoideum
Q54NL1 1.2e-18 94 28 7 217 3 abcC9 ABC transporter C family member 9 Dictyostelium discoideum
Q5F364 9.15e-44 171 28 10 492 2 ABCC1 Multidrug resistance-associated protein 1 Gallus gallus
Q5F364 2.24e-30 130 26 11 421 2 ABCC1 Multidrug resistance-associated protein 1 Gallus gallus
Q6UR05 1.29e-43 171 27 13 521 1 ABCC1 Multidrug resistance-associated protein 1 Canis lupus familiaris
Q6UR05 2.64e-28 124 31 4 238 1 ABCC1 Multidrug resistance-associated protein 1 Canis lupus familiaris
G7CBF6 2.07e-43 166 34 4 282 1 irtB Mycobactin import ATP-binding/permease protein IrtB Mycolicibacterium thermoresistibile (strain ATCC 19527 / DSM 44167 / CIP 105390 / JCM 6362 / NCTC 10409 / 316)
P47260 2.1e-43 167 27 8 518 3 MG014 Putative ABC transporter ATP-binding protein MG014 Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q9R1X5 3.58e-43 169 28 14 568 1 Abcc5 ATP-binding cassette sub-family C member 5 Mus musculus
Q9R1X5 7.52e-26 116 33 3 225 1 Abcc5 ATP-binding cassette sub-family C member 5 Mus musculus
Q5A762 7.05e-43 169 27 18 594 1 MLT1 Multiple drug resistance-associated protein-like transporter 1 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q5A762 1.18e-17 90 22 12 496 1 MLT1 Multiple drug resistance-associated protein-like transporter 1 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q52402 9.57e-43 165 27 6 425 3 aarD Transport ATP-binding protein AarD Providencia stuartii
P33116 1.94e-42 164 27 14 468 3 spaT Subtilin transport ATP-binding protein SpaT Bacillus subtilis
Q63120 1.23e-41 165 25 9 518 1 Abcc2 ATP-binding cassette sub-family C member 2 Rattus norvegicus
Q63120 3.76e-26 117 30 3 238 1 Abcc2 ATP-binding cassette sub-family C member 2 Rattus norvegicus
B2RX12 3.81e-41 163 27 16 528 1 Abcc3 ATP-binding cassette sub-family C member 3 Mus musculus
B2RX12 1.02e-22 107 29 3 237 1 Abcc3 ATP-binding cassette sub-family C member 3 Mus musculus
O15440 5.67e-41 163 29 12 479 1 ABCC5 ATP-binding cassette sub-family C member 5 Homo sapiens
O15440 1.24e-25 116 33 3 225 1 ABCC5 ATP-binding cassette sub-family C member 5 Homo sapiens
Q28689 7.27e-41 162 24 8 493 1 ABCC2 ATP-binding cassette sub-family C member 2 Oryctolagus cuniculus
Q28689 1.35e-28 125 31 3 236 1 ABCC2 ATP-binding cassette sub-family C member 2 Oryctolagus cuniculus
P39109 1.15e-40 162 26 9 464 1 YCF1 Metal resistance protein YCF1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P39109 5.91e-22 104 22 12 464 1 YCF1 Metal resistance protein YCF1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9SKX0 3.07e-40 160 26 10 559 2 ABCC13 ABC transporter C family member 13 Arabidopsis thaliana
Q9SKX0 3.41e-17 89 30 5 232 2 ABCC13 ABC transporter C family member 13 Arabidopsis thaliana
P29018 4.15e-40 157 26 6 428 1 cydD Glutathione/L-cysteine transport system ATP-binding/permease protein CydD Escherichia coli (strain K12)
Q9P5N0 4.35e-40 160 24 9 529 1 abc3 Vacuolar heme ABC transmembrane exporter abc3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9P5N0 1.97e-16 87 23 7 315 1 abc3 Vacuolar heme ABC transmembrane exporter abc3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9VL32 8.54e-40 159 36 2 233 1 Sur ATP-binding cassette sub-family C member Sur Drosophila melanogaster
Q9VL32 7.27e-21 101 32 10 240 1 Sur ATP-binding cassette sub-family C member Sur Drosophila melanogaster
O88563 1.74e-39 158 27 17 546 1 Abcc3 ATP-binding cassette sub-family C member 3 Rattus norvegicus
O88563 3.6e-24 111 29 3 237 1 Abcc3 ATP-binding cassette sub-family C member 3 Rattus norvegicus
Q63563 2.22e-39 158 25 10 536 1 Abcc9 ATP-binding cassette sub-family C member 9 Rattus norvegicus
Q63563 2.49e-22 105 32 6 227 1 Abcc9 ATP-binding cassette sub-family C member 9 Rattus norvegicus
Q9M1C7 2.71e-39 158 26 9 471 2 ABCC9 ABC transporter C family member 9 Arabidopsis thaliana
Q9M1C7 2.47e-21 102 29 6 294 2 ABCC9 ABC transporter C family member 9 Arabidopsis thaliana
P70170 3.67e-39 157 25 10 536 1 Abcc9 ATP-binding cassette sub-family C member 9 Mus musculus
P70170 2.47e-22 105 32 6 227 1 Abcc9 ATP-binding cassette sub-family C member 9 Mus musculus
Q54P13 4.55e-39 157 26 10 529 3 abcC8 ABC transporter C family member 8 Dictyostelium discoideum
Q54P13 4.47e-26 117 25 12 418 3 abcC8 ABC transporter C family member 8 Dictyostelium discoideum
Q7FB56 6.67e-39 156 26 9 473 5 ABCC15 Putative ABC transporter C family member 15 Arabidopsis thaliana
Q7FB56 1.86e-25 115 28 6 294 5 ABCC15 Putative ABC transporter C family member 15 Arabidopsis thaliana
O15438 7.81e-39 156 27 13 493 1 ABCC3 ATP-binding cassette sub-family C member 3 Homo sapiens
O15438 4.91e-23 108 30 4 233 1 ABCC3 ATP-binding cassette sub-family C member 3 Homo sapiens
P78966 9.54e-39 156 27 8 418 3 mam1 Mating factor M secretion protein mam1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P78966 1.2e-38 155 27 20 554 3 mam1 Mating factor M secretion protein mam1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q8R4P9 1.17e-38 156 38 4 232 1 Abcc10 ATP-binding cassette sub-family C member 10 Mus musculus
Q8R4P9 1.93e-14 80 27 4 204 1 Abcc10 ATP-binding cassette sub-family C member 10 Mus musculus
P82451 2.83e-38 155 24 13 553 2 ABCC9 ATP-binding cassette sub-family C member 9 Oryctolagus cuniculus
P82451 2.97e-20 99 30 6 227 2 ABCC9 ATP-binding cassette sub-family C member 9 Oryctolagus cuniculus
A7KVC2 4e-38 154 26 8 473 2 MRP4 ABC transporter C family MRP4 Zea mays
A7KVC2 1.67e-16 87 26 6 294 2 MRP4 ABC transporter C family MRP4 Zea mays
P53706 8e-38 153 26 11 489 3 HST6 Alpha-factor-transporting ATPase Candida albicans (strain WO-1)
P53706 1.45e-20 100 26 7 303 3 HST6 Alpha-factor-transporting ATPase Candida albicans (strain WO-1)
Q9EXN5 1.05e-37 151 26 10 535 3 mchF Probable microcin-H47 secretion/processing ATP-binding protein MchF Escherichia coli
Q10RX7 1.07e-37 153 27 9 471 2 ABCC13 ABC transporter C family member 13 Oryza sativa subsp. japonica
Q10RX7 2.03e-17 90 23 13 471 2 ABCC13 ABC transporter C family member 13 Oryza sativa subsp. japonica
A2XCD4 1.07e-37 153 27 9 471 3 ABCC13 ABC transporter C family member 13 Oryza sativa subsp. indica
A2XCD4 2.03e-17 90 23 13 471 3 ABCC13 ABC transporter C family member 13 Oryza sativa subsp. indica
O60706 1.78e-37 152 25 10 536 1 ABCC9 ATP-binding cassette sub-family C member 9 Homo sapiens
O60706 3.02e-21 102 31 6 227 1 ABCC9 ATP-binding cassette sub-family C member 9 Homo sapiens
P45082 2.03e-37 149 28 10 429 3 cydD Glutathione/L-cysteine transport system ATP-binding/permease protein CydD Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8ST87 2.4e-37 152 27 12 489 3 abcC10 ABC transporter C family member 10 Dictyostelium discoideum
Q8ST87 3.32e-24 111 28 6 346 3 abcC10 ABC transporter C family member 10 Dictyostelium discoideum
P91660 2.58e-37 152 24 12 561 2 l(2)03659 Probable multidrug resistance-associated protein lethal(2)03659 Drosophila melanogaster
P91660 9.49e-17 88 27 5 219 2 l(2)03659 Probable multidrug resistance-associated protein lethal(2)03659 Drosophila melanogaster
Q54VJ0 1.77e-36 149 25 8 474 3 abcC2 ABC transporter C family member 2 Dictyostelium discoideum
Q54VJ0 6.61e-23 107 33 10 229 3 abcC2 ABC transporter C family member 2 Dictyostelium discoideum
G5EE72 3.2e-36 148 34 1 229 2 mrp-5 Multidrug resistance-associated protein 5 Caenorhabditis elegans
G5EE72 1.52e-17 90 28 4 210 2 mrp-5 Multidrug resistance-associated protein 5 Caenorhabditis elegans
P75095 3.58e-36 146 28 11 535 3 MPN_018 Putative ABC transporter ATP-binding protein MG014 homolog Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
P53049 4.04e-36 148 27 11 502 1 YOR1 Oligomycin resistance ATP-dependent permease YOR1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P53049 2.21e-13 77 25 5 225 1 YOR1 Oligomycin resistance ATP-dependent permease YOR1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q80WJ6 4.54e-36 148 35 1 231 1 Abcc12 ATP-binding cassette sub-family C member 12 Mus musculus
Q80WJ6 1.08e-29 128 30 4 229 1 Abcc12 ATP-binding cassette sub-family C member 12 Mus musculus
Q9LK64 4.64e-36 148 26 13 523 1 ABCC3 ABC transporter C family member 3 Arabidopsis thaliana
Q9LK64 2.94e-15 83 23 15 478 1 ABCC3 ABC transporter C family member 3 Arabidopsis thaliana
Q42093 7.33e-36 147 39 1 231 1 ABCC2 ABC transporter C family member 2 Arabidopsis thaliana
Q42093 1.11e-26 119 25 11 415 1 ABCC2 ABC transporter C family member 2 Arabidopsis thaliana
Q7GB25 7.38e-36 147 25 6 481 2 ABCC5 ABC transporter C family member 5 Arabidopsis thaliana
Q7GB25 1.11e-19 97 26 7 313 2 ABCC5 ABC transporter C family member 5 Arabidopsis thaliana
Q10185 8.22e-36 147 25 12 521 1 abc2 ATP-binding cassette transporter abc2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q10185 7.76e-18 91 21 16 489 1 abc2 ATP-binding cassette transporter abc2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q54V86 1.02e-35 147 26 5 467 3 abcC13 ABC transporter C family member 13 Dictyostelium discoideum
Q54V86 4.08e-21 102 32 9 216 3 abcC13 ABC transporter C family member 13 Dictyostelium discoideum
S3D778 1.19e-35 147 26 10 485 3 gloK ABC transporter gloK Glarea lozoyensis (strain ATCC 20868 / MF5171)
S3D778 3.57e-17 89 30 9 246 3 gloK ABC transporter gloK Glarea lozoyensis (strain ATCC 20868 / MF5171)
Q6Y306 1.29e-35 146 35 1 231 2 Abcc12 ATP-binding cassette sub-family C member 12 Rattus norvegicus
Q6Y306 7.13e-29 126 30 4 229 2 Abcc12 ATP-binding cassette sub-family C member 12 Rattus norvegicus
Q96J66 2.35e-35 145 36 1 232 1 ABCC11 ATP-binding cassette sub-family C member 11 Homo sapiens
Q96J66 2.35e-22 105 29 4 220 1 ABCC11 ATP-binding cassette sub-family C member 11 Homo sapiens
P94366 3e-35 143 37 1 205 3 cydC Glutathione/L-cysteine transport system ATP-binding/permease protein CydC Bacillus subtilis (strain 168)
Q54VC1 3.38e-35 145 24 7 477 3 abcC15 ABC transporter C family member 15 Dictyostelium discoideum
Q54VC1 1.14e-12 75 30 7 213 3 abcC15 ABC transporter C family member 15 Dictyostelium discoideum
O88039 3.81e-35 143 35 5 247 2 ramA ABC transporter ATP-binding protein RamA Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P22520 4.79e-35 144 25 14 557 3 cvaB Colicin V secretion/processing ATP-binding protein CvaB Escherichia coli
Q8VZZ4 4.91e-35 145 26 9 479 2 ABCC6 ABC transporter C family member 6 Arabidopsis thaliana
Q8VZZ4 2.17e-15 83 26 6 328 2 ABCC6 ABC transporter C family member 6 Arabidopsis thaliana
Q54U44 4.98e-35 145 26 16 515 3 abcC12 ABC transporter C family member 12 Dictyostelium discoideum
Q54U44 3.69e-23 108 26 7 380 3 abcC12 ABC transporter C family member 12 Dictyostelium discoideum
Q96J65 1.3e-34 143 24 11 533 1 ABCC12 ATP-binding cassette sub-family C member 12 Homo sapiens
Q96J65 6.54e-28 123 30 4 223 1 ABCC12 ATP-binding cassette sub-family C member 12 Homo sapiens
Q9C8H1 1.85e-34 143 27 8 473 2 ABCC11 ABC transporter C family member 11 Arabidopsis thaliana
Q9C8H1 2.44e-24 112 25 14 418 2 ABCC11 ABC transporter C family member 11 Arabidopsis thaliana
Q9LYS2 2.49e-34 142 26 10 502 2 ABCC10 ABC transporter C family member 10 Arabidopsis thaliana
Q9LYS2 9.94e-24 110 25 15 465 2 ABCC10 ABC transporter C family member 10 Arabidopsis thaliana
Q54K24 2.57e-34 142 34 2 233 3 abcC14 ABC transporter C family member 14 Dictyostelium discoideum
Q54K24 4.09e-13 76 32 6 159 3 abcC14 ABC transporter C family member 14 Dictyostelium discoideum
Q8VI47 3.64e-34 142 25 10 489 1 Abcc2 ATP-binding cassette sub-family C member 2 Mus musculus
Q8VI47 2.09e-27 121 30 3 236 1 Abcc2 ATP-binding cassette sub-family C member 2 Mus musculus
Q8T6H3 3.81e-34 142 34 2 233 3 abcC6 ABC transporter C family member 6 Dictyostelium discoideum
Q8T6H3 1.03e-18 94 31 8 215 3 abcC6 ABC transporter C family member 6 Dictyostelium discoideum
Q9C8G9 3.95e-34 142 40 1 227 1 ABCC1 ABC transporter C family member 1 Arabidopsis thaliana
Q9C8G9 8.55e-25 113 24 12 415 1 ABCC1 ABC transporter C family member 1 Arabidopsis thaliana
P38735 4.3e-34 142 33 8 301 2 VMR1 ABC transporter ATP-binding protein/permease VMR1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P38735 1.62e-24 112 23 20 591 2 VMR1 ABC transporter ATP-binding protein/permease VMR1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q8LGU1 5.3e-34 142 25 6 475 2 ABCC8 ABC transporter C family member 8 Arabidopsis thaliana
Q8LGU1 1.7e-24 112 29 9 313 2 ABCC8 ABC transporter C family member 8 Arabidopsis thaliana
Q54JR2 5.3e-34 142 27 11 495 3 abcC3 ABC transporter C family member 3 Dictyostelium discoideum
Q54JR2 5.99e-24 110 26 10 405 3 abcC3 ABC transporter C family member 3 Dictyostelium discoideum
Q4WT65 5.95e-34 141 25 13 490 2 abcB ABC multidrug transporter B Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WT65 2.2e-14 80 28 6 223 2 abcB ABC multidrug transporter B Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q9LK62 7.54e-34 141 25 13 513 1 ABCC7 ABC transporter C family member 7 Arabidopsis thaliana
Q9LK62 2.07e-18 93 24 17 488 1 ABCC7 ABC transporter C family member 7 Arabidopsis thaliana
P14772 7.96e-34 141 26 11 521 1 BPT1 Bile pigment transporter 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P14772 3.31e-18 92 24 19 503 1 BPT1 Bile pigment transporter 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q5T3U5 9.8e-34 141 37 6 253 1 ABCC10 ATP-binding cassette sub-family C member 10 Homo sapiens
Q5T3U5 3.9e-15 82 28 4 204 1 ABCC10 ATP-binding cassette sub-family C member 10 Homo sapiens
Q9U2G5 1.41e-33 140 26 11 512 2 mrp-7 Multidrug resistance protein mrp-7 Caenorhabditis elegans
Q9U2G5 3.46e-22 105 29 4 237 2 mrp-7 Multidrug resistance protein mrp-7 Caenorhabditis elegans
Q9C8H0 1.72e-33 140 38 1 229 2 ABCC12 ABC transporter C family member 12 Arabidopsis thaliana
Q9C8H0 3.25e-23 108 27 8 291 2 ABCC12 ABC transporter C family member 12 Arabidopsis thaliana
F1M3J4 2.49e-33 139 26 13 509 1 Abcc4 ATP-binding cassette subfamily C member 4 Rattus norvegicus
F1M3J4 5.44e-23 107 31 6 232 1 Abcc4 ATP-binding cassette subfamily C member 4 Rattus norvegicus
J9VQH1 3.63e-33 139 25 10 510 3 YOR1 ATP-dependent permease YOR1 Cryptococcus neoformans var. grubii serotype A (strain H99 / ATCC 208821 / CBS 10515 / FGSC 9487)
J9VQH1 7.58e-21 101 30 4 225 3 YOR1 ATP-dependent permease YOR1 Cryptococcus neoformans var. grubii serotype A (strain H99 / ATCC 208821 / CBS 10515 / FGSC 9487)
E9Q236 3.91e-33 139 25 13 509 1 Abcc4 ATP-binding cassette sub-family C member 4 Mus musculus
E9Q236 1.53e-24 112 31 6 252 1 Abcc4 ATP-binding cassette sub-family C member 4 Mus musculus
Q7DM58 5.61e-33 139 25 6 512 1 ABCC4 ABC transporter C family member 4 Arabidopsis thaliana
Q7DM58 6.63e-25 114 27 12 356 1 ABCC4 ABC transporter C family member 4 Arabidopsis thaliana
Q8T6H8 8.31e-33 138 33 2 249 3 abcC1 ABC transporter C family member 1 Dictyostelium discoideum
Q8T6H8 3.09e-21 102 33 9 217 3 abcC1 ABC transporter C family member 1 Dictyostelium discoideum
Q9R1S7 1.48e-32 137 25 7 491 1 Abcc6 ATP-binding cassette sub-family C member 6 Mus musculus
Q9R1S7 1.89e-22 106 28 5 259 1 Abcc6 ATP-binding cassette sub-family C member 6 Mus musculus
Q88RL5 1.69e-32 130 36 8 239 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
I1R9B3 1.86e-32 137 24 12 490 3 FGRAMPH1_01T00151 ABC-type transporter FGSG_00046 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
I1R9B3 9.69e-05 49 42 0 61 3 FGRAMPH1_01T00151 ABC-type transporter FGSG_00046 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
P32386 2.28e-32 137 25 12 502 1 YBT1 ATP-dependent bile acid permease Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P32386 1.22e-23 110 25 12 360 1 YBT1 ATP-dependent bile acid permease Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q54LE6 2.45e-32 136 25 14 509 3 abcC5 ABC transporter C family member 5 Dictyostelium discoideum
Q54LE6 1.97e-14 80 27 7 214 3 abcC5 ABC transporter C family member 5 Dictyostelium discoideum
Q09427 2.78e-32 136 25 8 504 1 ABCC8 ATP-binding cassette sub-family C member 8 Cricetus cricetus
Q09427 2e-25 115 32 7 238 1 ABCC8 ATP-binding cassette sub-family C member 8 Cricetus cricetus
Q8SQI5 4.45e-32 134 28 10 340 3 ECU01_0200 Probable ABC transporter ECU01_0200/ECU01_1410 Encephalitozoon cuniculi (strain GB-M1)
A0A1U8QTJ9 5.61e-32 135 35 3 249 1 cicA ABC-type transporter cicA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
A0A1U8QTJ9 9.74e-20 97 22 12 444 1 cicA ABC-type transporter cicA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q92337 5.62e-32 135 32 5 282 3 abc1 ATP-binding cassette transporter abc1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q92337 6.57e-20 98 31 6 221 3 abc1 ATP-binding cassette transporter abc1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9P7V2 5.64e-32 135 34 2 242 3 abc4 ATP-binding cassette transporter abc4 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9P7V2 3.38e-16 86 27 7 229 3 abc4 ATP-binding cassette transporter abc4 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q09429 8.2e-32 135 24 8 506 1 Abcc8 ATP-binding cassette sub-family C member 8 Rattus norvegicus
Q09429 1.32e-24 112 32 7 232 1 Abcc8 ATP-binding cassette sub-family C member 8 Rattus norvegicus
Q03024 9.19e-32 133 33 4 272 3 aprD Alkaline protease secretion ATP-binding protein AprD Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
O88269 9.53e-32 135 25 7 491 1 Abcc6 ATP-binding cassette sub-family C member 6 Rattus norvegicus
O88269 7.34e-22 104 28 6 260 1 Abcc6 ATP-binding cassette sub-family C member 6 Rattus norvegicus
Q6FWS5 1.48e-31 134 32 8 297 2 YBT1 Pleiotropic ABC efflux transporter of multiple drugs YBT1 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
Q6FWS5 3.64e-25 114 30 7 243 2 YBT1 Pleiotropic ABC efflux transporter of multiple drugs YBT1 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
Q9LZJ5 2.74e-31 133 36 2 237 1 ABCC14 ABC transporter C family member 14 Arabidopsis thaliana
Q9LZJ5 1.85e-24 112 26 11 352 1 ABCC14 ABC transporter C family member 14 Arabidopsis thaliana
Q09428 4.3e-31 133 24 8 494 1 ABCC8 ATP-binding cassette sub-family C member 8 Homo sapiens
Q09428 2.18e-24 112 31 5 231 1 ABCC8 ATP-binding cassette sub-family C member 8 Homo sapiens
Q03203 5.1e-31 131 30 7 271 3 nisT Nisin transport ATP-binding protein NisT Lactococcus lactis subsp. lactis
P0CE69 8.46e-31 125 33 3 238 5 YKR104W Putative uncharacterized protein YKR104W Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q81J16 2.02e-30 123 34 7 237 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q03P57 2.46e-30 125 35 7 232 3 metN Methionine import ATP-binding protein MetN Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
Q7ANN4 2.99e-30 128 33 4 264 1 prsD Type I secretion system ATP-binding protein PrsD Rhizobium meliloti (strain 1021)
A7A063 3.18e-30 130 29 5 324 3 NFT1 ABC transporter NFT1 Saccharomyces cerevisiae (strain YJM789)
A7A063 6.86e-18 91 28 5 251 3 NFT1 ABC transporter NFT1 Saccharomyces cerevisiae (strain YJM789)
Q50294 3.26e-30 123 34 7 239 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
K0E4D9 3.44e-30 130 25 11 525 1 ecdL ABC transporter ecdL Aspergillus rugulosus
K0E4D9 1.63e-12 74 28 7 235 1 ecdL ABC transporter ecdL Aspergillus rugulosus
O15439 4.02e-30 130 25 9 471 1 ABCC4 ATP-binding cassette sub-family C member 4 Homo sapiens
O15439 1.23e-25 116 30 4 231 1 ABCC4 ATP-binding cassette sub-family C member 4 Homo sapiens
A0A0U1LQE1 4.43e-30 130 31 8 311 3 cctS ABC-type transporter cctS Talaromyces islandicus
A0A0U1LQE1 5.43e-16 85 25 7 279 3 cctS ABC-type transporter cctS Talaromyces islandicus
Q4A5A5 4.56e-30 122 34 7 237 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Mycoplasmopsis synoviae (strain 53)
P0CE70 5.75e-30 129 29 5 324 3 NFT1 ABC transporter NFT1 Saccharomyces cerevisiae
P0CE70 5.15e-18 92 28 5 251 3 NFT1 ABC transporter NFT1 Saccharomyces cerevisiae
Q6KHL1 6.06e-30 122 33 5 232 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Mycoplasma mobile (strain ATCC 43663 / 163K / NCTC 11711)
C8ZCR2 6.64e-30 129 29 5 324 3 NFT1 ABC transporter NFT1 Saccharomyces cerevisiae (strain Lalvin EC1118 / Prise de mousse)
C8ZCR2 9.46e-18 91 28 5 251 3 NFT1 ABC transporter NFT1 Saccharomyces cerevisiae (strain Lalvin EC1118 / Prise de mousse)
Q55DA7 7.71e-30 128 24 16 552 3 abcB7 ABC transporter B family member 7 Dictyostelium discoideum
Q1GBJ0 2.13e-29 120 33 5 232 1 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
I1RF50 2.2e-29 127 25 18 508 3 FG02316 ABC-type transporter FG02316 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
I1RF50 6.22e-14 79 28 6 215 3 FG02316 ABC-type transporter FG02316 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
Q1IGZ0 2.25e-29 122 35 7 239 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas entomophila (strain L48)
O95255 3.41e-29 127 26 9 496 1 ABCC6 ATP-binding cassette sub-family C member 6 Homo sapiens
O95255 1.32e-24 112 26 9 329 1 ABCC6 ATP-binding cassette sub-family C member 6 Homo sapiens
Q73F67 3.7e-29 120 33 7 237 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus cereus (strain ATCC 10987 / NRS 248)
F9X9V4 4.96e-29 126 31 6 331 3 MYCGRDRAFT_41235 ABC-type transporter MYCGRDRAFT_41235 Zymoseptoria tritici (strain CBS 115943 / IPO323)
F9X9V4 2.8e-22 105 26 7 323 3 MYCGRDRAFT_41235 ABC-type transporter MYCGRDRAFT_41235 Zymoseptoria tritici (strain CBS 115943 / IPO323)
Q6HPN0 5.11e-29 119 33 7 235 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q81VQ2 5.11e-29 119 33 7 235 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus anthracis

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS01360
Feature type CDS
Gene msbA
Product lipid A ABC transporter ATP-binding protein/permease MsbA
Location 297128 - 298876 (strand: 1)
Length 1749 (nucleotides) / 582 (amino acids)
In genomic island -

Contig

Accession NZ_VXKB01000001
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1291
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00005 ABC transporter
PF00664 ABC transporter transmembrane region

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1132 Defense mechanisms (V) V ABC-type multidrug transport system, ATPase and permease component

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K11085 ATP-binding cassette, subfamily B, bacterial MsbA [EC:7.5.2.6] ABC transporters -

Virulence factor Annotation(s)

VF gene ID Protein VF ID Category
VFG013253 lipid transporter ATP-binding/permease VF0044 Immune modulation

Protein Sequence

MMKDIDISTRQTFRRLWPTIAPFKSGIIVAAVALVINAGGDAFMLSLLKPLLDEGFGKADNDFLRMMPLIILALMLVRGASSFISGYCLSWVSGKVVMVMRRNLFRHMMGMPVPFFDQQSTGTLLSRITYDSEQVASSSSGALVTVVREGAYITALFGLMFYNSWQLSLILIVIAPIVAVVIRKVSVRFREISKTMQSGMGQVSASAEQMLKGHKEVLIFGGQKVENDHFDKVSNDMRRQGMKLVTASSIADPIIQIIASFALAFVLFAASFPEIKDALSAGSITVVFSSMVALMRPLKSLTNVNAQFQRGMAACQTLFALLDLEQEKDTGTKVLKEVKGDVKFEDVTFTYPGREQPALKNVSFTIPQGKTVALVGRSGSGKSTIANLITRFYEIDSGHIVIDGNDIRDYTLASLRSQVALVSQNVHLFNDTVANNIAYATEGKYSREQIEKAAEMAYAMDFIKKMEKGLDTEIGENGVLLSGGQRQRIAIARALLRDAPILILDEATSALDTESERAIQSALDELQKDRTCLVIAHRLSTIEKADEILVVQDGEVQERGSHAELVKQPGIYAQLYNMQFGK

Flanking regions ( +/- flanking 50bp)

GCCGATAAACGGGTAATATAGGCAGCTAATTTTTAGTATTGGTAAACGCAATAATGAAAGATATTGATATTTCAACCCGGCAAACATTTCGCCGGTTATGGCCGACAATTGCACCTTTTAAATCAGGTATCATCGTAGCGGCTGTTGCGTTAGTCATAAATGCGGGGGGCGATGCATTTATGCTGTCGCTGCTCAAACCCCTGCTTGATGAAGGTTTCGGCAAAGCCGACAACGATTTTCTCCGGATGATGCCTCTGATTATCCTTGCGCTGATGCTGGTGCGCGGAGCATCGAGTTTTATTTCCGGCTATTGCCTTTCCTGGGTGTCAGGCAAAGTAGTTATGGTTATGCGCCGTAATCTGTTCCGTCATATGATGGGGATGCCGGTTCCTTTCTTTGACCAGCAATCCACCGGGACACTGTTATCCCGTATTACCTATGATTCTGAGCAGGTTGCTTCTTCTTCTTCAGGTGCGCTGGTCACTGTTGTCCGTGAAGGTGCTTATATTACGGCACTGTTCGGACTGATGTTTTATAACAGTTGGCAGCTTTCGCTTATTTTGATTGTTATTGCCCCGATTGTGGCGGTGGTTATCCGCAAAGTCTCTGTCCGTTTCCGTGAAATCAGTAAAACTATGCAAAGCGGAATGGGGCAGGTGAGTGCCAGCGCGGAACAGATGCTGAAAGGGCATAAAGAAGTGCTTATTTTCGGCGGGCAAAAAGTCGAAAATGACCACTTCGATAAAGTCAGCAATGACATGCGCCGCCAGGGTATGAAGCTGGTTACCGCATCTTCTATTGCCGACCCGATTATTCAGATAATCGCGTCTTTTGCCCTGGCATTTGTACTGTTTGCCGCCAGTTTTCCTGAAATTAAAGACGCACTGAGCGCCGGTTCTATTACGGTTGTGTTCTCATCAATGGTCGCGCTGATGCGTCCGTTAAAATCTCTGACGAATGTTAATGCACAGTTCCAGCGCGGTATGGCTGCATGTCAGACCCTGTTTGCGCTGCTGGATCTGGAGCAGGAAAAAGATACCGGCACCAAAGTGCTGAAAGAAGTTAAAGGGGATGTGAAATTTGAAGATGTCACTTTCACTTACCCGGGAAGAGAACAACCCGCACTGAAAAACGTGTCATTCACTATTCCTCAAGGTAAAACCGTGGCACTGGTGGGACGTTCCGGCTCCGGAAAATCAACAATTGCCAATCTTATTACCCGTTTCTATGAAATCGACAGCGGGCATATTGTGATTGATGGTAACGATATCCGCGATTATACGCTGGCTTCCCTGCGCAGCCAGGTGGCGCTGGTATCGCAAAATGTGCATCTGTTCAATGATACCGTGGCGAATAATATCGCGTACGCGACAGAAGGGAAGTACAGCCGTGAGCAGATAGAGAAAGCGGCAGAAATGGCGTATGCCATGGACTTTATCAAAAAAATGGAAAAAGGACTGGATACCGAAATCGGTGAGAACGGTGTTCTGCTTTCCGGCGGGCAGCGTCAGCGTATTGCCATCGCCCGCGCGCTGCTGCGTGACGCCCCGATCCTTATCCTCGATGAAGCAACCTCAGCGCTGGATACCGAATCTGAGCGTGCGATTCAGTCCGCTCTGGATGAATTACAGAAAGACCGCACCTGTCTGGTAATAGCACACCGCTTATCGACCATTGAGAAAGCAGATGAAATTCTGGTTGTGCAGGATGGCGAAGTGCAGGAGCGCGGCTCACATGCTGAACTGGTGAAACAACCGGGTATCTATGCACAGCTCTATAATATGCAGTTTGGTAAGTAACGGGCATAACGATTAATTGACTGACAATAATGATTGAAAAAATATGGTCC