Homologs in group_2733

Help

5 homologs were identified in 5 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_07525 FBDBKF_07525 100.0 Morganella morganii S1 mngR DNA-binding transcriptional regulator, GntR family
EHELCC_17195 EHELCC_17195 100.0 Morganella morganii S2 mngR DNA-binding transcriptional regulator, GntR family
NLDBIP_13800 NLDBIP_13800 100.0 Morganella morganii S4 mngR DNA-binding transcriptional regulator, GntR family
LHKJJB_09050 LHKJJB_09050 100.0 Morganella morganii S3 mngR DNA-binding transcriptional regulator, GntR family
F4V73_RS13590 F4V73_RS13590 84.7 Morganella psychrotolerans - UTRA domain-containing protein

Distribution of the homologs in the orthogroup group_2733

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2733

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0ACN1 4.08e-87 260 51 0 236 4 yihL Uncharacterized HTH-type transcriptional regulator YihL Shigella flexneri
P0ACM9 4.08e-87 260 51 0 236 4 yihL Uncharacterized HTH-type transcriptional regulator YihL Escherichia coli (strain K12)
P0ACN0 4.08e-87 260 51 0 236 4 yihL Uncharacterized HTH-type transcriptional regulator YihL Escherichia coli O157:H7
Q7CR30 6.36e-37 132 30 1 226 2 phnR Putative transcriptional regulator of 2-aminoethylphosphonate degradation operons Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P96061 6.36e-37 132 30 1 226 4 phnR Putative transcriptional regulator of 2-aminoethylphosphonate degradation operons Salmonella typhi
Q5PFQ9 1.06e-36 132 30 1 226 4 phnR Putative transcriptional regulator of 2-aminoethylphosphonate degradation operons Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q57SD4 2.07e-36 131 29 1 226 4 phnR Putative transcriptional regulator of 2-aminoethylphosphonate degradation operons Salmonella choleraesuis (strain SC-B67)
O34817 4.07e-11 64 23 4 199 1 nagR HTH-type transcriptional repressor NagR Bacillus subtilis (strain 168)
P0ACM8 1.89e-10 62 22 7 228 4 yegW Uncharacterized HTH-type transcriptional regulator YegW Shigella flexneri
P0ACM5 1.89e-10 62 22 7 228 4 yegW Uncharacterized HTH-type transcriptional regulator YegW Escherichia coli (strain K12)
P0ACM6 1.89e-10 62 22 7 228 4 yegW Uncharacterized HTH-type transcriptional regulator YegW Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0ACM7 1.89e-10 62 22 7 228 4 yegW Uncharacterized HTH-type transcriptional regulator YegW Escherichia coli O157:H7
A0QQ72 6.84e-08 55 26 8 232 1 phnF HTH-type transcriptional repressor PhnF Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
O86331 9.09e-08 55 22 3 228 1 Rv0792c HTH-type transcriptional regulator Rv0792c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
O31459 1.05e-07 54 23 2 207 1 gamR HTH-type transcriptional repressor GamR Bacillus subtilis (strain 168)
O31761 2.98e-07 53 20 4 230 4 ymfC Uncharacterized HTH-type transcriptional regulator YmfC Bacillus subtilis (strain 168)
P0ACL9 6.33e-07 52 38 0 63 1 pdhR Pyruvate dehydrogenase complex repressor Escherichia coli (strain K12)
P0ACM0 6.33e-07 52 38 0 63 3 pdhR Pyruvate dehydrogenase complex repressor Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0ACM1 6.33e-07 52 38 0 63 3 pdhR Pyruvate dehydrogenase complex repressor Escherichia coli O157:H7
P0CL10 6.45e-07 52 38 0 63 3 pdhR Pyruvate dehydrogenase complex repressor Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
E1W823 6.45e-07 52 38 0 63 3 pdhR Pyruvate dehydrogenase complex repressor Salmonella typhimurium (strain SL1344)
P0A2S3 6.45e-07 52 38 0 63 3 pdhR Pyruvate dehydrogenase complex repressor Salmonella typhi
P42239 3.09e-06 50 43 0 65 4 ycbG Uncharacterized HTH-type transcriptional regulator YcbG Bacillus subtilis (strain 168)
P67740 9.2e-06 48 53 1 52 4 BQ2027_MB0505 Uncharacterized HTH-type transcriptional regulator Mb0505 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WMG7 9.2e-06 48 53 1 52 1 Rv0494 Uncharacterized HTH-type transcriptional regulator Rv0494 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WMG6 9.2e-06 48 53 1 52 4 MT0514 Uncharacterized HTH-type transcriptional regulator MT0514 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P16684 2.62e-05 47 30 2 112 1 phnF Probable transcriptional regulator PhnF Escherichia coli (strain K12)
Q82IW0 5.25e-05 46 21 3 214 3 dasR HTH-type transcriptional repressor DasR Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q9K492 0.000103 45 25 3 149 1 dasR HTH-type transcriptional repressor DasR Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P0ACL8 0.000186 45 38 0 62 3 lldR Putative L-lactate dehydrogenase operon regulatory protein Shigella flexneri
P0ACL7 0.000186 45 38 0 62 2 lldR Putative L-lactate dehydrogenase operon regulatory protein Escherichia coli (strain K12)
Q9KBQ0 0.000302 44 26 0 75 3 araR Arabinose metabolism transcriptional repressor Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q9X9E0 0.00035 44 38 0 54 4 exuR Exu regulon transcriptional regulator Dickeya chrysanthemi
Q8VV01 0.000554 43 21 4 228 2 dasR HTH-type transcriptional repressor DasR Streptomyces griseus
P12380 0.000582 43 31 0 63 4 hutC Histidine utilization repressor Klebsiella aerogenes
Q7N3Z5 0.000675 43 42 0 54 3 fadR Fatty acid metabolism regulator protein Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
P44487 0.000693 43 35 0 53 3 uxuR Uxu operon regulator Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9HU78 0.000853 43 22 2 148 3 hutC Histidine utilization repressor Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9CPJ0 0.001 43 42 0 54 3 fadR Fatty acid metabolism regulator protein Pasteurella multocida (strain Pm70)

  • Number of RefSeq hits:

General

Source Morganella morganii S5
Locus tag HKOGLL_08600
Feature type CDS
Gene mngR
Product DNA-binding transcriptional regulator, GntR family
Location 145354 - 146064 (strand: 1)
Length 711 (nucleotides) / 236 (amino acids)

Contig

Accession ZDB_685
Length 192328 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2733
Orthogroup size 6
N. genomes 6

Actions

Genomic region

Domains

PF00392 Bacterial regulatory proteins, gntR family
PF07702 UTRA domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG2188 Transcription (K) K DNA-binding transcriptional regulator, GntR family

Protein Sequence

MKTTQTAADLAREKLDAMLTAGVIAPGDKLPAERPLTEQLGVNRMSLRQALLSLENDGKIFRKNRSGWFAALPVFNYNPKSPASFNQAAKAQGRVPSWEYTDKLTVTDAPAEITGKFGLAAGDAVYLITGWGALDGHKVFWHQTYINPAAGPDFTAKLDNHSFAAIWEEKYNITTTTAGLAFKPARMPETASKAIGCTANSPGIRVEKYRCDAEHNIVQIDIEYWRFESVYFFVEL

Flanking regions ( +/- flanking 50bp)

ACTCACGTAACGTACAAACCAGTTTGGTTTAAACCAAAAAGGATCATCCGATGAAAACAACACAAACTGCAGCTGATCTTGCCAGAGAGAAACTCGATGCCATGCTGACCGCCGGCGTTATCGCGCCCGGAGACAAGCTGCCCGCAGAACGTCCGCTGACAGAACAACTCGGTGTCAACCGGATGTCACTGCGCCAGGCACTGCTCAGCCTGGAAAATGACGGAAAGATCTTCCGCAAAAACCGCAGCGGGTGGTTCGCAGCCCTGCCGGTCTTCAATTACAACCCGAAATCCCCGGCAAGTTTTAATCAGGCGGCAAAAGCACAAGGACGGGTACCGTCATGGGAATATACAGACAAACTGACGGTCACTGATGCCCCTGCGGAGATTACCGGTAAATTCGGTCTTGCGGCCGGTGATGCGGTGTATCTCATTACCGGGTGGGGGGCACTGGACGGGCATAAAGTGTTCTGGCACCAGACCTATATTAACCCGGCTGCCGGTCCGGATTTTACCGCAAAACTGGATAACCACTCTTTCGCGGCAATCTGGGAAGAAAAATACAATATCACCACCACGACTGCCGGACTGGCATTCAAACCGGCCCGGATGCCGGAAACCGCCAGTAAGGCTATCGGCTGTACCGCGAATTCCCCCGGTATCCGGGTGGAAAAATACCGCTGTGATGCGGAACATAATATCGTTCAAATCGACATTGAGTACTGGCGGTTTGAATCTGTTTATTTTTTTGTTGAGCTTTAGACACAGGAATCTGAATCATGAATACTGATGATGCCCGCCGGATTATTGAA