Homologs in group_1144

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_06550 FBDBKF_06550 100.0 Morganella morganii S1 robA MDR efflux pump AcrAB transcriptional activator RobA
EHELCC_09595 EHELCC_09595 100.0 Morganella morganii S2 robA MDR efflux pump AcrAB transcriptional activator RobA
NLDBIP_09975 NLDBIP_09975 100.0 Morganella morganii S4 robA MDR efflux pump AcrAB transcriptional activator RobA
LHKJJB_07780 LHKJJB_07780 100.0 Morganella morganii S3 robA MDR efflux pump AcrAB transcriptional activator RobA
F4V73_RS15385 F4V73_RS15385 89.5 Morganella psychrotolerans robA MDR efflux pump AcrAB transcriptional activator RobA
PMI_RS18495 PMI_RS18495 62.3 Proteus mirabilis HI4320 robA MDR efflux pump AcrAB transcriptional activator RobA

Distribution of the homologs in the orthogroup group_1144

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1144

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0ACI2 3.46e-105 311 60 2 267 3 rob Right origin-binding protein Shigella flexneri
P0ACI0 3.46e-105 311 60 2 267 1 rob Right origin-binding protein Escherichia coli (strain K12)
P0ACI1 3.46e-105 311 60 2 267 3 rob Right origin-binding protein Escherichia coli O157:H7
Q8ZJU7 5.78e-104 308 54 4 303 2 rob Transcriptional regulator Rob Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P28816 5.81e-39 137 58 0 106 1 tetD Transposon Tn10 TetD protein Escherichia coli
P0A9E2 2.9e-37 131 57 0 104 1 soxS Regulatory protein SoxS Escherichia coli (strain K12)
P0A9E3 2.9e-37 131 57 0 104 3 soxS Regulatory protein SoxS Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9E4 2.9e-37 131 57 0 104 3 soxS Regulatory protein SoxS Escherichia coli O157:H7
Q56143 2.47e-36 129 55 0 104 3 soxS Regulatory protein SoxS Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q52620 3.34e-30 114 51 1 102 4 pqrA Probable transcription factor PqrA Proteus vulgaris
Q48413 1.58e-29 111 52 0 100 1 ramA Transcriptional activator RamA Klebsiella pneumoniae
A0A0H3GPK2 1.58e-29 111 52 0 100 1 ramA Transcriptional regulator RamA Klebsiella pneumoniae subsp. pneumoniae (strain HS11286)
P77601 2.76e-29 115 39 1 150 5 ykgA Putative HTH-type transcriptional regulator YkgA Escherichia coli (strain K12)
H9L484 9e-29 109 49 0 101 1 ramA Transcriptional regulator RamA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P43463 1.03e-28 110 46 0 110 4 aarP HTH-type transcriptional activator AarP Providencia stuartii
P0A2S4 4.65e-28 108 48 0 98 2 marA Multiple antibiotic resistance protein MarA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2S5 4.65e-28 108 48 0 98 3 marA Multiple antibiotic resistance protein MarA Salmonella typhi
P0A2S6 4.65e-28 108 48 0 98 3 marA Multiple antibiotic resistance protein MarA Salmonella enteritidis
P0ACH7 5.28e-28 108 48 0 98 3 marA Multiple antibiotic resistance protein MarA Shigella flexneri
P0ACH5 5.28e-28 108 48 0 98 1 marA Multiple antibiotic resistance protein MarA Escherichia coli (strain K12)
P0ACH6 5.28e-28 108 48 0 98 3 marA Multiple antibiotic resistance protein MarA Escherichia coli O157:H7
P55922 3.55e-26 102 47 0 100 4 ramA Transcriptional activator RamA Enterobacter cloacae
P26950 5.5e-14 74 27 7 282 4 caf1R F1 operon positive regulatory protein Yersinia pestis
O31456 1.02e-13 73 39 0 98 3 ybfP Uncharacterized HTH-type transcriptional regulator YbfP Bacillus subtilis (strain 168)
Q8ZM00 4.95e-11 65 34 1 99 1 STM3175 Probable HTH-type transcriptional regulator STM3175 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P96662 7.41e-11 65 31 0 104 4 ydeE Uncharacterized HTH-type transcriptional regulator YdeE Bacillus subtilis (strain 168)
O31449 4.13e-09 60 31 1 102 4 ybfI Uncharacterized HTH-type transcriptional regulator YbfI Bacillus subtilis (strain 168)
Q9WW32 5.87e-09 59 33 0 83 1 mtrA HTH-type transcriptional regulator MtrA Neisseria gonorrhoeae
Q6GKK1 4.36e-08 57 32 0 92 4 SAR0107 Uncharacterized HTH-type transcriptional regulator SAR0107 Staphylococcus aureus (strain MRSA252)
Q99XB1 4.48e-08 57 32 0 92 4 SAV0101 Uncharacterized HTH-type transcriptional regulator SAV0101 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q7A882 4.48e-08 57 32 0 92 4 SA0097 Uncharacterized HTH-type transcriptional regulator SA0097 Staphylococcus aureus (strain N315)
Q6GD21 4.48e-08 57 32 0 92 4 SAS0078 Uncharacterized HTH-type transcriptional regulator SAS0078 Staphylococcus aureus (strain MSSA476)
Q8NYT6 4.48e-08 57 32 0 92 4 MW0077 Uncharacterized HTH-type transcriptional regulator MW0077 Staphylococcus aureus (strain MW2)
Q5HJR8 4.52e-08 57 32 0 92 4 SACOL0084 Uncharacterized HTH-type transcriptional regulator SACOL0084 Staphylococcus aureus (strain COL)
Q936F1 4.85e-08 57 32 0 92 4 None Uncharacterized HTH-type transcriptional regulator Staphylococcus aureus
P54722 7.69e-07 53 29 1 103 4 yfiF Uncharacterized HTH-type transcriptional regulator YfiF Bacillus subtilis (strain 168)
P19219 1.17e-06 52 28 0 99 1 adaA Bifunctional transcriptional activator/DNA repair enzyme AdaA Bacillus subtilis (strain 168)
P0ACI3 3.32e-06 51 30 0 97 1 xylR Xylose operon regulatory protein Escherichia coli (strain K12)
P0ACI4 3.32e-06 51 30 0 97 3 xylR Xylose operon regulatory protein Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0ACI5 3.32e-06 51 30 0 97 3 xylR Xylose operon regulatory protein Escherichia coli O157:H7
Q65Q30 3.33e-06 51 29 0 100 3 rhaR HTH-type transcriptional activator RhaR Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
P0ACH8 4.59e-06 50 29 0 102 1 melR Melibiose operon regulatory protein Escherichia coli (strain K12)
P0ACH9 4.59e-06 50 29 0 102 3 melR Melibiose operon regulatory protein Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q05587 5.58e-06 50 27 0 101 1 pocR Regulatory protein PocR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B5XZ49 5.72e-06 50 30 0 94 3 rhaS HTH-type transcriptional activator RhaS Klebsiella pneumoniae (strain 342)
Q47129 6.58e-06 50 38 2 81 1 feaR Transcriptional activator FeaR Escherichia coli (strain K12)
A6TGA9 1.07e-05 49 30 0 94 3 rhaS HTH-type transcriptional activator RhaS Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q65Q31 1.1e-05 49 26 0 93 3 rhaS HTH-type transcriptional activator RhaS Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
A7ZUB7 1.55e-05 49 30 0 99 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli O139:H28 (strain E24377A / ETEC)
P03022 1.63e-05 49 28 1 101 3 araC Arabinose operon regulatory protein Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B6I4P8 1.65e-05 49 30 0 99 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli (strain SE11)
P11765 1.79e-05 48 28 1 99 3 araC Arabinose operon regulatory protein Citrobacter freundii
Q83PE0 2.12e-05 48 30 0 99 3 rhaS HTH-type transcriptional activator RhaS Shigella flexneri
Q0SZ95 2.12e-05 48 30 0 99 3 rhaS HTH-type transcriptional activator RhaS Shigella flexneri serotype 5b (strain 8401)
B5YZ43 2.2e-05 48 30 0 99 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X897 2.2e-05 48 30 0 99 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli O157:H7
Q32A70 2.22e-05 48 30 0 99 3 rhaS HTH-type transcriptional activator RhaS Shigella dysenteriae serotype 1 (strain Sd197)
Q1R414 2.22e-05 48 30 0 99 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli (strain UTI89 / UPEC)
B7NFK3 2.22e-05 48 30 0 99 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
A1AI82 2.22e-05 48 30 0 99 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli O1:K1 / APEC
B7NUA1 2.22e-05 48 30 0 99 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7MI37 2.22e-05 48 30 0 99 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli O45:K1 (strain S88 / ExPEC)
B1LMU6 2.3e-05 48 30 0 99 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli (strain SMS-3-5 / SECEC)
Q31U84 2.34e-05 48 30 0 99 3 rhaS HTH-type transcriptional activator RhaS Shigella boydii serotype 4 (strain Sb227)
P09377 2.34e-05 48 30 0 99 1 rhaS HTH-type transcriptional activator RhaS Escherichia coli (strain K12)
B1IVH3 2.34e-05 48 30 0 99 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A709 2.34e-05 48 30 0 99 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli O9:H4 (strain HS)
B1XB72 2.34e-05 48 30 0 99 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli (strain K12 / DH10B)
C5A073 2.34e-05 48 30 0 99 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli (strain K12 / MC4100 / BW2952)
B7M6V7 2.34e-05 48 30 0 99 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli O8 (strain IAI1)
B7L9G1 2.34e-05 48 30 0 99 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli (strain 55989 / EAEC)
Q8CXW5 2.4e-05 48 30 0 99 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q3YV71 2.43e-05 48 30 0 99 3 rhaS HTH-type transcriptional activator RhaS Shigella sonnei (strain Ss046)
Q0TAF8 2.43e-05 48 30 0 99 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B7UNM6 2.43e-05 48 30 0 99 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B7N2P7 2.47e-05 48 30 0 99 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli O81 (strain ED1a)
A6TGB0 3.04e-05 48 29 0 87 3 rhaR HTH-type transcriptional activator RhaR Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B2TVP7 4.47e-05 47 30 0 99 3 rhaS HTH-type transcriptional activator RhaS Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
O31249 4.56e-05 47 27 0 87 4 alkR HTH-type transcriptional regulator AlkR Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
P96660 4.72e-05 47 21 1 111 4 ydeC Uncharacterized HTH-type transcriptional regulator YdeC Bacillus subtilis (strain 168)
P0A9E0 6.88e-05 47 27 1 99 1 araC Arabinose operon regulatory protein Escherichia coli (strain K12)
P0A9E1 6.88e-05 47 27 1 99 3 araC Arabinose operon regulatory protein Escherichia coli O157:H7
Q32A71 6.98e-05 47 27 0 103 3 rhaR HTH-type transcriptional activator RhaR Shigella dysenteriae serotype 1 (strain Sd197)
O32071 7e-05 48 27 0 101 4 ytdP Uncharacterized HTH-type transcriptional regulator YtdP Bacillus subtilis (strain 168)
G3XCU2 8.25e-05 47 29 0 87 4 argR HTH-type transcriptional regulator ArgR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A4WG91 8.47e-05 47 29 0 99 3 rhaS HTH-type transcriptional activator RhaS Enterobacter sp. (strain 638)
P45008 8.75e-05 47 28 1 91 4 HI_1052 Uncharacterized HTH-type transcriptional regulator HI_1052 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q83PD9 8.85e-05 47 27 0 103 3 rhaR HTH-type transcriptional activator RhaR Shigella flexneri
Q0SZ96 8.85e-05 47 27 0 103 3 rhaR HTH-type transcriptional activator RhaR Shigella flexneri serotype 5b (strain 8401)
Q1R413 8.85e-05 47 27 0 103 3 rhaR HTH-type transcriptional activator RhaR Escherichia coli (strain UTI89 / UPEC)
A1AI83 8.85e-05 47 27 0 103 3 rhaR HTH-type transcriptional activator RhaR Escherichia coli O1:K1 / APEC
B4TPR0 9.34e-05 47 26 0 102 3 rhaR HTH-type transcriptional activator RhaR Salmonella schwarzengrund (strain CVM19633)
Q8X7B3 9.52e-05 47 27 0 103 3 rhaR HTH-type transcriptional activator RhaR Escherichia coli O157:H7
P09378 9.78e-05 47 27 0 103 1 rhaR HTH-type transcriptional activator RhaR Escherichia coli (strain K12)
A8A710 9.78e-05 47 27 0 103 3 rhaR HTH-type transcriptional activator RhaR Escherichia coli O9:H4 (strain HS)
C5A074 9.78e-05 47 27 0 103 3 rhaR HTH-type transcriptional activator RhaR Escherichia coli (strain K12 / MC4100 / BW2952)
Q31U83 9.96e-05 46 27 0 103 3 rhaR HTH-type transcriptional activator RhaR Shigella boydii serotype 4 (strain Sb227)
Q8FBD7 9.96e-05 46 27 0 103 3 rhaR HTH-type transcriptional activator RhaR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TAF7 9.96e-05 46 27 0 103 3 rhaR HTH-type transcriptional activator RhaR Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A7ZUB8 9.96e-05 46 27 0 103 3 rhaR HTH-type transcriptional activator RhaR Escherichia coli O139:H28 (strain E24377A / ETEC)
B4TPQ9 9.97e-05 46 28 0 94 3 rhaS HTH-type transcriptional activator RhaS Salmonella schwarzengrund (strain CVM19633)
A9MI64 0.000107 46 27 0 99 3 rhaS HTH-type transcriptional activator RhaS Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
O87389 0.000121 46 32 0 96 4 glxA HTH-type transcriptional regulator GlxA Rhizobium meliloti (strain 1021)
A8AL27 0.000123 46 28 0 94 3 rhaS HTH-type transcriptional activator RhaS Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
P43461 0.000126 45 24 1 100 4 None Uncharacterized HTH-type transcriptional regulator in cgkA 5'region (Fragment) Pseudoalteromonas carrageenovora
Q00753 0.000128 46 28 0 84 4 msmR Msm operon regulatory protein Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
B5F0N0 0.000186 45 26 0 102 3 rhaR HTH-type transcriptional activator RhaR Salmonella agona (strain SL483)
P40865 0.000192 45 26 0 102 3 rhaR HTH-type transcriptional activator RhaR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B5BJG9 0.000192 45 26 0 102 3 rhaR HTH-type transcriptional activator RhaR Salmonella paratyphi A (strain AKU_12601)
A9MZC9 0.000192 45 26 0 102 3 rhaR HTH-type transcriptional activator RhaR Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PKG1 0.000192 45 26 0 102 3 rhaR HTH-type transcriptional activator RhaR Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4SZZ4 0.000192 45 26 0 102 3 rhaR HTH-type transcriptional activator RhaR Salmonella newport (strain SL254)
B5QWY5 0.000192 45 26 0 102 3 rhaR HTH-type transcriptional activator RhaR Salmonella enteritidis PT4 (strain P125109)
A9MI63 0.000195 45 26 0 102 3 rhaR HTH-type transcriptional activator RhaR Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
P40408 0.000204 46 25 0 104 1 btr HTH-type transcriptional activator Btr Bacillus subtilis (strain 168)
B5FPP5 0.000254 45 27 0 94 3 rhaS HTH-type transcriptional activator RhaS Salmonella dublin (strain CT_02021853)
B5BJG8 0.000271 45 27 0 94 3 rhaS HTH-type transcriptional activator RhaS Salmonella paratyphi A (strain AKU_12601)
Q5PKG2 0.000271 45 27 0 94 3 rhaS HTH-type transcriptional activator RhaS Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4TBY3 0.000274 45 27 0 94 3 rhaS HTH-type transcriptional activator RhaS Salmonella heidelberg (strain SL476)
Q57HG7 0.000286 45 25 0 102 3 rhaR HTH-type transcriptional activator RhaR Salmonella choleraesuis (strain SC-B67)
P0A2S9 0.000292 45 27 0 94 3 rhaS HTH-type transcriptional activator RhaS Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2T0 0.000292 45 27 0 94 3 rhaS HTH-type transcriptional activator RhaS Salmonella typhi
C0Q3L4 0.000292 45 27 0 94 3 rhaS HTH-type transcriptional activator RhaS Salmonella paratyphi C (strain RKS4594)
A9MZC8 0.000292 45 27 0 94 3 rhaS HTH-type transcriptional activator RhaS Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4SZZ3 0.000292 45 27 0 94 3 rhaS HTH-type transcriptional activator RhaS Salmonella newport (strain SL254)
B5RFC3 0.000292 45 27 0 94 3 rhaS HTH-type transcriptional activator RhaS Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5QWY4 0.000292 45 27 0 94 3 rhaS HTH-type transcriptional activator RhaS Salmonella enteritidis PT4 (strain P125109)
B5F0M9 0.000292 45 27 0 94 3 rhaS HTH-type transcriptional activator RhaS Salmonella agona (strain SL483)
Q8Z2V5 0.000294 45 25 0 102 3 rhaR HTH-type transcriptional activator RhaR Salmonella typhi
B4TBY4 0.000294 45 25 0 102 3 rhaR HTH-type transcriptional activator RhaR Salmonella heidelberg (strain SL476)
Q57HG8 0.000316 45 27 0 94 3 rhaS HTH-type transcriptional activator RhaS Salmonella choleraesuis (strain SC-B67)
C6DJR5 0.000505 44 28 0 96 3 rhaR HTH-type transcriptional activator RhaR Pectobacterium carotovorum subsp. carotovorum (strain PC1)
A7ML57 0.000566 44 27 0 96 3 rhaR HTH-type transcriptional activator RhaR Cronobacter sakazakii (strain ATCC BAA-894)
P26993 0.000631 44 25 0 104 1 exsA HTH-type transcriptional regulator ExsA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q6DA21 0.000693 44 27 0 96 3 rhaR HTH-type transcriptional activator RhaR Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A1JU91 0.000756 43 29 0 95 3 virF Virulence regulon transcriptional activator VirF Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
P28808 0.000791 43 29 0 95 4 lcrF Thermoregulatory protein LcrF Yersinia pestis

  • Number of RefSeq hits:

General

Source Morganella morganii S5
Locus tag HKOGLL_07330
Feature type CDS
Gene robA
Product MDR efflux pump AcrAB transcriptional activator RobA
Location 65337 - 66257 (strand: -1)
Length 921 (nucleotides) / 306 (amino acids)

Contig

Accession ZDB_684
Length 217237 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1144
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF06445 GyrI-like small molecule binding domain
PF12833 Helix-turn-helix domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG2207 Transcription (K) K AraC-type DNA-binding domain and AraC-containing proteins

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K05804 AraC family transcriptional regulator, mar-sox-rob regulon activator - -

Protein Sequence

MDQTSIIRDLLRWLDEHLDQPLSLDNVAAKAGYSKWHLQRMFKDVTGEAIGAYIRARRLSRAAIALRLTARPILDIALQYRFDSQQTFTRAFKKQFNKTPALYRRLDEWCSDGICSAILLDDVPMPEHEFVTLPPRTVTGIENSCSHRLEDWATACTHMRQEFWLHHISVAKTIPDYVYGLYSTTRNPDKEDEQTVHYTTAVAKEFAAFTTEENVHEVEMPGGEYLCFTFSGIPYRGAMQEFLFTIYGQCVPRLGITRRRGYDIESYKLRKGTDIRYPDAADVDETDPRHHIEEFKYYIPVRRDAQ

Flanking regions ( +/- flanking 50bp)

AAATTCGTTATATCTCTTTCAGAACTTCATCAATCCAATAAGGGAGATGTATGGATCAGACCAGCATCATTCGCGATTTACTCCGTTGGTTAGATGAGCATTTAGATCAGCCACTTTCCCTCGATAACGTCGCTGCGAAGGCAGGCTACTCCAAGTGGCATTTACAACGTATGTTCAAGGACGTTACCGGTGAGGCCATCGGCGCTTACATCCGCGCCCGCCGTTTATCACGCGCAGCCATTGCACTGCGGCTGACTGCCCGTCCTATTTTAGATATCGCATTACAGTATCGTTTCGATTCACAGCAAACCTTTACCCGCGCATTCAAGAAACAGTTTAATAAAACACCTGCGCTGTACCGCCGTCTTGACGAATGGTGCTCTGACGGAATCTGCTCCGCCATTCTGCTTGATGATGTGCCGATGCCGGAGCACGAGTTTGTCACGCTGCCGCCGCGCACAGTCACCGGTATAGAGAACAGCTGTTCACATCGTCTGGAAGACTGGGCAACCGCGTGTACCCACATGCGCCAAGAGTTCTGGCTGCATCATATTTCTGTGGCGAAAACTATCCCAGACTATGTTTACGGGCTTTACAGCACTACCCGTAATCCGGACAAAGAAGATGAGCAGACAGTCCATTACACCACTGCCGTGGCGAAGGAATTTGCTGCCTTTACCACTGAGGAAAATGTTCACGAGGTGGAAATGCCCGGTGGCGAATATCTCTGCTTCACCTTCAGCGGCATTCCTTACCGCGGTGCGATGCAGGAATTCCTGTTCACGATTTACGGCCAGTGTGTGCCGCGACTGGGGATCACCCGCCGCCGTGGTTACGATATTGAGAGCTATAAACTGAGAAAGGGAACCGACATCCGCTATCCGGATGCGGCTGATGTGGATGAGACTGATCCGCGCCATCACATCGAGGAATTTAAATACTACATTCCTGTCAGACGTGACGCGCAGTAACAGCCTTCCCGCAGAACAAACACCGCCGCCGGTGGTGTCTTGTTCACCCG