Homologs in group_2223

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_16470 FBDBKF_16470 100.0 Morganella morganii S1 baeR two-component system response regulator BaeR
EHELCC_08335 EHELCC_08335 100.0 Morganella morganii S2 baeR two-component system response regulator BaeR
NLDBIP_08660 NLDBIP_08660 100.0 Morganella morganii S4 baeR two-component system response regulator BaeR
LHKJJB_05605 LHKJJB_05605 100.0 Morganella morganii S3 baeR two-component system response regulator BaeR
F4V73_RS02985 F4V73_RS02985 90.0 Morganella psychrotolerans baeR two-component system response regulator BaeR
PMI_RS07750 PMI_RS07750 62.7 Proteus mirabilis HI4320 baeR two-component system response regulator BaeR

Distribution of the homologs in the orthogroup group_2223

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2223

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P69228 9.7e-104 303 62 1 235 1 baeR Transcriptional regulatory protein BaeR Escherichia coli (strain K12)
P69229 9.7e-104 303 62 1 235 1 baeR Transcriptional regulatory protein BaeR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P08368 2.91e-51 169 40 2 225 1 creB Transcriptional regulatory protein CreB Escherichia coli (strain K12)
Q7A0U4 8.78e-47 158 39 5 229 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain MW2)
Q9L524 8.78e-47 158 39 5 229 2 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus
Q6G972 8.78e-47 158 39 5 229 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain MSSA476)
Q6GGK6 8.78e-47 158 39 5 229 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain MRSA252)
Q7A5H6 8.78e-47 158 39 5 229 1 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain N315)
Q7A2R6 8.78e-47 158 39 5 229 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HFT0 8.78e-47 158 39 5 229 2 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain COL)
Q2FY79 8.78e-47 158 39 5 229 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain NCTC 8325 / PS 47)
P94413 1.34e-45 154 38 4 225 3 yclJ Uncharacterized transcriptional regulatory protein YclJ Bacillus subtilis (strain 168)
Q52990 2.25e-45 154 39 2 223 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Rhizobium meliloti (strain 1021)
P37478 2.73e-45 154 40 3 225 1 walR Transcriptional regulatory protein WalR Bacillus subtilis (strain 168)
P50350 4.68e-45 154 36 2 235 3 chvI Transcriptional regulatory protein ChvI Rhizobium meliloti (strain 1021)
P13792 6.26e-45 153 40 4 231 1 phoP Alkaline phosphatase synthesis transcriptional regulatory protein PhoP Bacillus subtilis (strain 168)
P23620 2.27e-44 151 36 2 222 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P35163 3.09e-44 151 38 5 237 1 resD Transcriptional regulatory protein ResD Bacillus subtilis (strain 168)
P48259 5.14e-44 151 37 2 235 3 ycf27 Probable transcriptional regulator ycf27 Cyanophora paradoxa
Q07783 1.72e-43 149 35 2 236 3 chvI Transcriptional regulatory protein ChvI Rhizobium radiobacter
P45607 4.26e-43 148 37 2 225 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Shigella flexneri
P51358 5.06e-43 148 37 2 235 3 ycf27 Probable transcriptional regulator ycf27 Porphyra purpurea
Q1XDC9 5.23e-43 148 37 2 235 3 ycf27 Probable transcriptional regulator ycf27 Neopyropia yezoensis
P0AFJ5 5.23e-43 148 37 2 225 1 phoB Phosphate regulon transcriptional regulatory protein PhoB Escherichia coli (strain K12)
P0AFJ6 5.23e-43 148 37 2 225 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Escherichia coli O157:H7
P45606 6.35e-43 148 37 2 225 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Shigella dysenteriae
P45605 8.78e-43 147 37 2 227 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Klebsiella pneumoniae
Q9F868 1.09e-42 147 38 1 225 1 regX3 Sensory transduction protein RegX3 Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
P50351 1.2e-42 147 35 2 234 3 chvI Transcriptional regulatory protein ChvI Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P28835 1.24e-42 147 36 2 230 3 ycf27 Probable transcriptional regulator ycf27 Porphyridium aerugineum
A0A4P7TS68 1.63e-42 147 36 4 232 1 ompR DNA-binding dual transcriptional regulator OmpR Shigella flexneri serotype 5a (strain M90T)
P0AA21 1.63e-42 147 36 4 232 3 ompR DNA-binding dual transcriptional regulator OmpR Shigella flexneri
P0AA19 1.63e-42 147 36 4 232 3 ompR DNA-binding dual transcriptional regulator OmpR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A0A0H3NGY1 1.63e-42 147 36 4 232 3 ompR DNA-binding dual transcriptional regulator OmpR Salmonella typhimurium (strain SL1344)
P0AA20 1.63e-42 147 36 4 232 1 ompR DNA-binding dual transcriptional regulator OmpR Salmonella typhi
P0AA16 1.63e-42 147 36 4 232 1 ompR DNA-binding dual transcriptional regulator OmpR Escherichia coli (strain K12)
P0AA17 1.63e-42 147 36 4 232 3 ompR DNA-binding dual transcriptional regulator OmpR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AA18 1.63e-42 147 36 4 232 3 ompR DNA-binding dual transcriptional regulator OmpR Escherichia coli O157:H7
P9WGL9 2.26e-42 146 37 1 224 1 regX3 Sensory transduction protein RegX3 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGL8 2.26e-42 146 37 1 224 2 regX3 Sensory transduction protein RegX3 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
O07130 2.26e-42 146 37 1 224 1 regX3 Sensory transduction protein RegX3 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
O78428 4.62e-42 146 36 2 233 3 ycf27 Probable transcriptional regulator ycf27 Guillardia theta
Q06239 2.37e-41 144 34 2 226 3 vanR Regulatory protein VanR Enterococcus faecium
Q7A216 4.07e-41 143 36 5 229 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain MW2)
Q9RDT5 4.07e-41 143 36 5 229 1 walR Transcriptional regulatory protein WalR Staphylococcus aureus
A8YYU1 4.07e-41 143 36 5 229 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain USA300 / TCH1516)
Q6GD72 4.07e-41 143 36 5 229 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain MSSA476)
Q6GKS7 4.07e-41 143 36 5 229 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain MRSA252)
Q7A8E1 4.07e-41 143 36 5 229 1 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain N315)
Q99XF3 4.07e-41 143 36 5 229 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QD57 4.07e-41 143 36 5 229 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain Newman)
Q5HJX7 4.07e-41 143 36 5 229 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain COL)
Q2YUQ3 4.07e-41 143 36 5 229 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5INQ9 4.07e-41 143 36 5 229 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain JH9)
Q2G2U6 4.07e-41 143 36 5 229 1 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FKN8 4.07e-41 143 36 5 229 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain USA300)
A6TXG8 4.07e-41 143 36 5 229 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain JH1)
A7WWQ5 4.07e-41 143 36 5 229 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q4LAJ9 1.03e-40 142 35 3 228 3 walR Transcriptional regulatory protein WalR Staphylococcus haemolyticus (strain JCSC1435)
Q8CQK0 1.09e-40 142 35 3 228 3 walR Transcriptional regulatory protein WalR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HK18 1.09e-40 142 35 3 228 3 walR Transcriptional regulatory protein WalR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q82EB1 1.19e-40 142 38 3 231 3 cseB Transcriptional regulatory protein CseB Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q9TLQ4 1.49e-40 142 37 3 229 3 ycf27 Probable transcriptional regulator ycf27 Cyanidium caldarium
Q4A160 2.32e-40 141 36 4 228 3 walR Transcriptional regulatory protein WalR Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q8DPL7 2.31e-39 139 36 4 227 1 walR Transcriptional regulatory protein WalR Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
A0A0H2UQ68 2.31e-39 139 36 4 227 1 walR Transcriptional regulatory protein WalR Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
A0A0H2ZN37 2.31e-39 139 36 4 227 1 walR Transcriptional regulatory protein WalR Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q9I0I1 2.69e-39 138 37 2 222 1 carR Response regulator protein CarR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9ZEP4 6.2e-39 137 36 3 230 1 cseB Transcriptional regulatory protein CseB Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P45189 1.23e-38 137 35 4 224 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P94504 4.63e-38 135 32 3 232 3 yvrH Transcriptional regulatory protein YvrH Bacillus subtilis (strain 168)
P28257 6.35e-38 135 36 3 230 3 ycf27 Probable transcriptional regulator ycf27 Galdieria sulphuraria
A0QTK2 1.06e-37 134 37 6 237 1 mtrA DNA-binding response regulator MtrA Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
A0A0H3GGB5 1.6e-37 134 38 3 224 2 cpxR Transcriptional regulatory protein CpxR Klebsiella pneumoniae subsp. pneumoniae (strain HS11286)
Q9HUI2 1.89e-37 134 36 4 230 3 aruR Transcriptional regulatory protein AruR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
G3XCY6 2.5e-37 134 33 3 230 1 gltR Transcriptional regulatory protein GltR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
O06978 4.22e-37 133 33 2 226 3 yvcP Uncharacterized transcriptional regulatory protein YvcP Bacillus subtilis (strain 168)
P44895 5.78e-37 132 40 3 179 3 cpxR Transcriptional regulatory protein CpxR homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P0C001 5.98e-37 132 36 3 217 3 arlR Response regulator ArlR Staphylococcus aureus (strain MW2)
Q6G9E6 5.98e-37 132 36 3 217 3 arlR Response regulator ArlR Staphylococcus aureus (strain MSSA476)
Q6GGZ3 5.98e-37 132 36 3 217 3 arlR Response regulator ArlR Staphylococcus aureus (strain MRSA252)
P0C000 5.98e-37 132 36 3 217 3 arlR Response regulator ArlR Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HG04 5.98e-37 132 36 3 217 3 arlR Response regulator ArlR Staphylococcus aureus (strain COL)
Q2YY03 5.98e-37 132 36 3 217 3 arlR Response regulator ArlR Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q9KJN4 5.98e-37 132 36 3 217 1 arlR Response regulator ArlR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FH23 5.98e-37 132 36 3 217 3 arlR Response regulator ArlR Staphylococcus aureus (strain USA300)
P0AE90 1.51e-36 131 37 3 224 3 cpxR Transcriptional regulatory protein CpxR Shigella flexneri
P0AE88 1.51e-36 131 37 3 224 1 cpxR Transcriptional regulatory protein CpxR Escherichia coli (strain K12)
P0AE89 1.51e-36 131 37 3 224 3 cpxR Transcriptional regulatory protein CpxR Escherichia coli O157:H7
P32040 2.02e-36 132 37 6 232 3 SYNPCC7002_A0851 Probable transcriptional regulatory protein SYNPCC7002_A0851 Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
A0R3I8 4.26e-36 130 33 3 220 1 mprA Response regulator MprA Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q9CCJ2 4.44e-36 130 36 6 229 3 mtrA DNA-binding response regulator MtrA Mycobacterium leprae (strain TN)
P9WGM7 4.5e-36 130 36 6 236 1 mtrA DNA-binding response regulator MtrA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM6 4.5e-36 130 36 6 236 3 mtrA DNA-binding response regulator MtrA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A5Z5 4.5e-36 130 36 6 236 3 mtrA DNA-binding response regulator MtrA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q93CB8 5.33e-36 130 36 6 229 3 mtrA DNA-binding response regulator MtrA Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q49ZT8 6.85e-36 129 31 4 218 3 hssR Heme response regulator HssR Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q4L6C6 9.62e-36 129 36 3 217 3 arlR Response regulator ArlR Staphylococcus haemolyticus (strain JCSC1435)
P39663 1.05e-35 130 37 6 236 1 sphR Alkaline phosphatase synthesis transcriptional regulatory protein SphR Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q9CD68 2.25e-35 128 33 4 221 3 mprA Response regulator MprA Mycobacterium leprae (strain TN)
A0PWB4 2.29e-35 128 31 3 222 3 mprA Response regulator MprA Mycobacterium ulcerans (strain Agy99)
A1KHB7 2.29e-35 128 32 4 221 3 mprA Response regulator MprA Mycobacterium bovis (strain BCG / Pasteur 1173P2)
Q7U0X4 2.29e-35 128 32 4 221 1 mprA Response regulator MprA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WGM9 3.48e-35 128 32 4 221 1 mprA Response regulator MprA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM8 3.48e-35 128 32 4 221 3 mprA Response regulator MprA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U123 3.48e-35 128 32 4 221 3 mprA Response regulator MprA Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
Q1B3X8 4e-35 127 33 4 222 3 mprA Response regulator MprA Mycobacterium sp. (strain MCS)
A1UL70 4e-35 127 33 4 222 3 mprA Response regulator MprA Mycobacterium sp. (strain KMS)
A3Q5L9 4e-35 127 33 4 222 3 mprA Response regulator MprA Mycobacterium sp. (strain JLS)
Q742C1 4.91e-35 127 32 3 220 3 mprA Response regulator MprA Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
A0QBQ9 4.91e-35 127 32 3 220 3 mprA Response regulator MprA Mycobacterium avium (strain 104)
P54884 5.31e-35 126 38 1 193 3 rgx3 Sensory transduction protein RegX3 Mycobacterium leprae (strain TN)
A1TEL7 5.97e-35 127 31 3 221 3 mprA Response regulator MprA Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
L7N689 6.57e-35 128 35 5 222 1 trcR Transcriptional regulatory protein TrcR Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P0A9Q4 1.22e-34 127 31 1 229 3 arcA Aerobic respiration control protein ArcA Shigella flexneri
P0A9Q1 1.22e-34 127 31 1 229 1 arcA Aerobic respiration control protein ArcA Escherichia coli (strain K12)
P0A9Q2 1.22e-34 127 31 1 229 3 arcA Aerobic respiration control protein ArcA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9Q3 1.22e-34 127 31 1 229 3 arcA Aerobic respiration control protein ArcA Escherichia coli O157:H7
Q04942 1.35e-34 126 35 1 220 1 afsQ1 Transcriptional regulatory protein AfsQ1 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q44006 1.54e-34 126 35 3 220 2 czcR Transcriptional activator protein CzcR Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q49XM7 2.33e-34 125 36 2 217 3 arlR Response regulator ArlR Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q99U73 2.44e-34 125 35 2 217 3 arlR Response regulator ArlR Staphylococcus aureus (strain N315)
Q9KM23 1.25e-33 124 33 4 231 1 vxrB Transcriptional regulatory protein VxrB Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P21866 1.41e-33 124 36 6 226 1 kdpE KDP operon transcriptional regulatory protein KdpE Escherichia coli (strain K12)
Q5HLN2 2.02e-33 123 32 4 218 3 hssR Heme response regulator HssR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P38684 2.53e-33 123 35 5 226 1 torR TorCAD operon transcriptional regulatory protein TorR Escherichia coli (strain K12)
P42244 2.6e-33 123 30 2 222 3 ycbL Uncharacterized transcriptional regulatory protein YcbL Bacillus subtilis (strain 168)
Q55890 2.96e-33 123 34 4 228 1 rpaA DNA-binding dual master transcriptional regulator RpaA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P58357 3.34e-33 122 35 5 226 3 torR TorCAD operon transcriptional regulatory protein TorR Escherichia coli O157:H7
Q8CN92 4.64e-33 122 32 4 218 3 hssR Heme response regulator HssR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q9AE24 5.35e-33 122 33 3 221 3 rprY Transcriptional regulatory protein RprY Bacteroides fragilis (strain YCH46)
Q4L8L9 1.74e-32 120 33 4 218 3 hssR Heme response regulator HssR Staphylococcus haemolyticus (strain JCSC1435)
O34903 3.05e-32 120 35 4 227 3 ykoG Uncharacterized transcriptional regulatory protein YkoG Bacillus subtilis (strain 168)
Q44929 3.23e-32 120 31 2 230 3 gtcR Response regulator GtcR Aneurinibacillus migulanus
P42421 4.45e-32 120 32 3 224 3 yxdJ Transcriptional regulatory protein YxdJ Bacillus subtilis (strain 168)
O32192 4.83e-32 119 32 4 223 1 cssR Transcriptional regulatory protein CssR Bacillus subtilis (strain 168)
Q8CP82 7e-32 119 37 5 218 3 arlR Response regulator ArlR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q7A1J1 9.46e-32 119 33 5 225 3 saeR Response regulator SaeR Staphylococcus aureus (strain MW2)
Q6GBC4 9.46e-32 119 33 5 225 3 saeR Response regulator SaeR Staphylococcus aureus (strain MSSA476)
Q6GIT6 9.46e-32 119 33 5 225 3 saeR Response regulator SaeR Staphylococcus aureus (strain MRSA252)
Q7A6V3 9.46e-32 119 33 5 225 1 saeR Response regulator SaeR Staphylococcus aureus (strain N315)
Q99VR7 9.46e-32 119 33 5 225 3 saeR Response regulator SaeR Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q840P8 9.46e-32 119 33 5 225 1 saeR Response regulator SaeR Staphylococcus aureus (strain Newman)
Q5HHW4 9.46e-32 119 33 5 225 1 saeR Response regulator SaeR Staphylococcus aureus (strain COL)
Q2YSM5 9.46e-32 119 33 5 225 3 saeR Response regulator SaeR Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q2G2G2 9.46e-32 119 33 5 225 1 saeR Response regulator SaeR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIT4 9.46e-32 119 33 5 225 3 saeR Response regulator SaeR Staphylococcus aureus (strain USA300)
Q7A039 9.62e-32 119 29 4 221 3 hssR Heme response regulator HssR Staphylococcus aureus (strain MW2)
A8Z552 9.62e-32 119 29 4 221 3 hssR Heme response regulator HssR Staphylococcus aureus (strain USA300 / TCH1516)
Q6G6V9 9.62e-32 119 29 4 221 3 hssR Heme response regulator HssR Staphylococcus aureus (strain MSSA476)
Q7A3X1 9.62e-32 119 29 4 221 3 hssR Heme response regulator HssR Staphylococcus aureus (strain N315)
Q99RR6 9.62e-32 119 29 4 221 3 hssR Heme response regulator HssR Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IVE2 9.62e-32 119 29 4 221 3 hssR Heme response regulator HssR Staphylococcus aureus (strain JH9)
Q2FVQ9 9.62e-32 119 29 4 221 3 hssR Heme response regulator HssR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FED5 9.62e-32 119 29 4 221 3 hssR Heme response regulator HssR Staphylococcus aureus (strain USA300)
A6U488 9.62e-32 119 29 4 221 3 hssR Heme response regulator HssR Staphylococcus aureus (strain JH1)
A7X5Y5 9.62e-32 119 29 4 221 3 hssR Heme response regulator HssR Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q01473 1.04e-31 125 34 2 218 3 rcaC Protein RcaC Microchaete diplosiphon
Q01473 2.86e-08 57 28 2 121 3 rcaC Protein RcaC Microchaete diplosiphon
P0DMK7 1.14e-31 119 35 3 220 3 irlR Transcriptional activator protein IrlR Burkholderia pseudomallei (strain K96243)
I1WSZ4 1.14e-31 119 35 3 220 3 irlR Transcriptional activator protein IrlR Burkholderia pseudomallei (strain 1026b)
Q6GJ11 1.26e-31 118 30 4 222 3 graR Response regulator protein GraR Staphylococcus aureus (strain MRSA252)
A6QJK3 1.31e-31 118 29 4 221 1 hssR Heme response regulator HssR Staphylococcus aureus (strain Newman)
Q5HDJ4 1.31e-31 118 29 4 221 3 hssR Heme response regulator HssR Staphylococcus aureus (strain COL)
A8Z181 1.43e-31 118 29 4 222 3 graR Response regulator protein GraR Staphylococcus aureus (strain USA300 / TCH1516)
A6QEW8 1.43e-31 118 29 4 222 3 graR Response regulator protein GraR Staphylococcus aureus (strain Newman)
Q5HI09 1.43e-31 118 29 4 222 1 graR Response regulator protein GraR Staphylococcus aureus (strain COL)
Q2G0E0 1.43e-31 118 29 4 222 1 graR Response regulator protein GraR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIY0 1.43e-31 118 29 4 222 3 graR Response regulator protein GraR Staphylococcus aureus (strain USA300)
Q9K621 2.1e-31 118 30 4 222 3 bceR Sensory transduction protein BceR Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q6GE73 2.19e-31 118 29 4 221 3 hssR Heme response regulator HssR Staphylococcus aureus (strain MRSA252)
Q5HPC3 2.77e-31 117 36 5 218 3 arlR Response regulator ArlR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q2YSS2 6.49e-31 117 29 4 222 3 graR Response regulator protein GraR Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q2FWH6 1.11e-30 116 34 2 220 1 kdpE Transcriptional regulatory protein KdpE Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q7A1L2 1.23e-30 116 29 4 222 3 graR Response regulator protein GraR Staphylococcus aureus (strain MW2)
Q6GBH1 1.23e-30 116 29 4 222 3 graR Response regulator protein GraR Staphylococcus aureus (strain MSSA476)
Q99VW2 1.23e-30 116 29 4 222 3 graR Response regulator protein GraR Staphylococcus aureus (strain N315)
A5IQL2 1.23e-30 116 29 4 222 3 graR Response regulator protein GraR Staphylococcus aureus (strain JH9)
A6TZD6 1.23e-30 116 29 4 222 3 graR Response regulator protein GraR Staphylococcus aureus (strain JH1)
A7WZC3 1.23e-30 116 29 4 222 3 graR Response regulator protein GraR Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q932F1 1.31e-30 115 29 4 222 1 graR Response regulator protein GraR Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q2YZ24 1.34e-30 115 28 4 221 3 hssR Heme response regulator HssR Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q7D9K0 2.48e-30 116 34 4 223 3 tcrA Transcriptional regulatory protein TcrA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
O07776 2.48e-30 116 34 4 223 1 tcrA Transcriptional regulatory protein TcrA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P52076 2.95e-30 115 32 3 218 2 qseB Transcriptional regulatory protein QseB Escherichia coli (strain K12)
Q8CQ17 4.43e-30 114 31 5 226 1 saeR Response regulator SaeR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HR28 4.43e-30 114 31 5 226 3 saeR Response regulator SaeR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P66795 7.22e-30 114 32 3 218 3 qseB Transcriptional regulatory protein QseB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P66796 7.22e-30 114 32 3 218 3 qseB Transcriptional regulatory protein QseB Salmonella typhi
P44918 9.5e-30 114 29 3 228 3 arcA Aerobic respiration control protein ArcA homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P31079 9.62e-30 114 31 4 235 3 petR Protein PetR Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
P9WGM1 1.73e-29 113 38 6 192 1 prrA Transcriptional regulatory protein PrrA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM0 1.73e-29 113 38 6 192 3 prrA Transcriptional regulatory protein PrrA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A5Z7 1.73e-29 113 38 6 192 3 prrA Transcriptional regulatory protein PrrA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P45337 3.78e-29 112 32 3 218 3 qseB Transcriptional regulatory protein QseB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8XBS3 3.92e-29 112 31 3 218 2 qseB Transcriptional regulatory protein QseB Escherichia coli O157:H7
Q50136 5.67e-29 112 37 5 191 3 prrA Transcriptional regulatory protein PrrA Mycobacterium leprae (strain TN)
Q9HV32 1.13e-28 110 33 3 218 1 pmrA Response regulator protein PmrA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02540 2.08e-28 110 31 2 222 1 copR Transcriptional activator protein CopR Pseudomonas syringae pv. tomato
O34951 2.89e-28 110 28 3 220 3 bceR Sensory transduction protein BceR Bacillus subtilis (strain 168)
Q31S42 4.17e-28 110 31 5 237 1 rpaA DNA-binding dual master transcriptional regulator RpaA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q49VK3 5.03e-28 109 28 4 227 3 graR Response regulator protein GraR Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q8CQ37 6.63e-28 108 28 3 221 3 graR Response regulator protein GraR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HR81 6.63e-28 108 28 3 221 3 graR Response regulator protein GraR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
O69730 8.74e-28 108 33 3 220 1 tcrX Probable transcriptional regulatory protein TcrX Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P33112 9.31e-28 108 35 1 177 3 spaR Transcriptional regulatory protein SpaR Bacillus subtilis
Q4L481 9.51e-28 108 28 4 222 3 graR Response regulator protein GraR Staphylococcus haemolyticus (strain JCSC1435)
O24973 1.28e-27 108 32 3 223 1 arsR Transcriptional regulatory protein ArsR Helicobacter pylori (strain ATCC 700392 / 26695)
Q47744 1.98e-27 107 32 4 221 3 vanRB Regulatory protein VanRB Enterococcus faecalis (strain ATCC 700802 / V583)
Q47456 1.98e-27 107 35 5 222 3 pcoR Transcriptional regulatory protein PcoR Escherichia coli
P0ACZ8 1.13e-26 105 33 3 223 1 cusR Transcriptional regulatory protein CusR Escherichia coli (strain K12)
P0ACZ9 1.13e-26 105 33 3 223 3 cusR Transcriptional regulatory protein CusR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AD00 1.13e-26 105 33 3 223 3 cusR Transcriptional regulatory protein CusR Escherichia coli O157:H7
Q70FH0 1.19e-26 105 33 3 218 3 pmrA Transcriptional regulatory protein PmrA Pectobacterium parmentieri
P30843 1.29e-26 105 33 3 218 1 basR Transcriptional regulatory protein BasR Escherichia coli (strain K12)
P54443 2.51e-26 105 28 3 225 3 yrkP Uncharacterized transcriptional regulatory protein YrkP Bacillus subtilis (strain 168)
Q8DN02 2.63e-26 104 30 3 219 1 rr06 Response regulator RR06 Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
A0A0H2ZNF6 2.63e-26 104 30 3 219 1 rr06 Response regulator RR06 Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q07597 3.09e-26 104 31 7 232 3 nisR Nisin biosynthesis regulatory protein NisR Lactococcus lactis subsp. lactis
P36556 3.32e-26 104 33 3 218 1 basR Transcriptional regulatory protein BasR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P9WGN1 4.59e-26 104 26 1 223 1 kdpE Transcriptional regulatory protein KdpE Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGN0 4.59e-26 104 26 1 223 3 kdpE Transcriptional regulatory protein KdpE Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P52108 6.07e-26 104 30 2 228 1 rstA Transcriptional regulatory protein RstA Escherichia coli (strain K12)
Q8Z7H2 4.38e-25 101 32 5 223 3 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhi
P0DM78 7.33e-25 100 32 5 223 1 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
F5ZP95 7.33e-25 100 32 5 223 1 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhimurium (strain ATCC 68169 / UK-1)
E1WFA1 7.33e-25 100 32 5 223 2 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhimurium (strain SL1344)
D0ZV90 7.33e-25 100 32 5 223 1 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhimurium (strain 14028s / SGSC 2262)
Q5PMJ1 7.33e-25 100 32 5 223 3 phoP Virulence transcriptional regulatory protein PhoP Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q57QC3 1.08e-24 100 31 5 223 3 phoP Virulence transcriptional regulatory protein PhoP Salmonella choleraesuis (strain SC-B67)
P0A4I0 2.49e-24 99 27 4 223 3 dltR Transcriptional regulatory protein DltR Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
P0A4H9 2.49e-24 99 27 4 223 3 dltR Transcriptional regulatory protein DltR Streptococcus agalactiae serotype III (strain NEM316)
Q9ZHD3 2.61e-24 99 32 3 223 3 silR Probable transcriptional regulatory protein SilR Salmonella typhimurium
Q8GP20 3.05e-24 99 30 5 219 1 rssB Swarming motility regulation protein RssB Serratia marcescens
Q83RR0 3.95e-24 99 30 5 225 3 phoP Virulence transcriptional regulatory protein PhoP Shigella flexneri
P23836 3.95e-24 99 30 5 225 1 phoP Transcriptional regulatory protein PhoP Escherichia coli (strain K12)
Q8CXZ9 3.95e-24 99 30 5 225 3 phoP Transcriptional regulatory protein PhoP Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P76340 5.71e-24 98 30 2 219 1 hprR Transcriptional regulatory protein HprR Escherichia coli (strain K12)
Q8FZ93 5.74e-24 99 30 3 219 1 ctrA Cell cycle response regulator CtrA Brucella suis biovar 1 (strain 1330)
B0CI76 5.74e-24 99 30 3 219 3 ctrA Cell cycle response regulator CtrA Brucella suis (strain ATCC 23445 / NCTC 10510)
A5VRW9 5.74e-24 99 30 3 219 1 ctrA Cell cycle response regulator CtrA Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q7CNV1 5.74e-24 99 30 3 219 1 ctrA Cell cycle response regulator CtrA Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
A9M708 5.74e-24 99 30 3 219 3 ctrA Cell cycle response regulator CtrA Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q9ZHS1 5.74e-24 99 30 3 219 1 ctrA Cell cycle response regulator CtrA Brucella abortus biovar 1 (strain 9-941)
Q2YQA4 5.74e-24 99 30 3 219 1 ctrA Cell cycle response regulator CtrA Brucella abortus (strain 2308)
B2S753 5.74e-24 99 30 3 219 3 ctrA Cell cycle response regulator CtrA Brucella abortus (strain S19)
Q8X738 6.41e-24 98 30 4 222 3 phoP Transcriptional regulatory protein PhoP Escherichia coli O157:H7
Q04803 6.65e-24 100 34 1 218 3 pfeR Transcriptional activator protein PfeR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P13359 8.04e-24 98 30 3 227 3 virG Regulatory protein VirG Rhizobium rhizogenes
Q55933 1.14e-23 98 28 4 233 1 rppA Response regulator RppA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
A6WZ81 1.26e-23 98 30 3 219 3 ctrA Cell cycle response regulator CtrA Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
O31432 7.56e-23 95 29 9 225 3 ybdJ Uncharacterized transcriptional regulatory protein YbdJ Bacillus subtilis (strain 168)
P62722 2.49e-22 95 32 5 228 3 virG Regulatory protein VirG Agrobacterium tumefaciens (strain 15955)
Q9I4F9 7.49e-22 93 32 3 218 1 phoP Two-component response regulator PhoP Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P07545 2.05e-21 92 30 3 227 3 virG Regulatory protein VirG Agrobacterium fabrum (strain C58 / ATCC 33970)
Q44444 4.07e-21 92 32 5 228 3 virG Regulatory protein VirG Rhizobium radiobacter
P0A4H8 2.18e-20 89 31 4 205 3 ciaR Transcriptional regulatory protein CiaR Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A4H7 2.18e-20 89 31 4 205 3 ciaR Transcriptional regulatory protein CiaR Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
B8H358 2.21e-20 89 27 2 218 3 ctrA Cell cycle transcriptional regulator CtrA Caulobacter vibrioides (strain NA1000 / CB15N)
P0CAW8 2.21e-20 89 27 2 218 3 ctrA Cell cycle transcriptional regulator CtrA Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
P0A4I2 6.4e-20 87 30 4 220 3 cutR Transcriptional regulatory protein CutR Streptomyces lividans
P0A4I1 6.4e-20 87 30 4 220 3 cutR Transcriptional regulatory protein CutR Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P0CL17 1.33e-18 84 29 3 223 2 tctD Transcriptional regulatory protein TctD Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
E1WA34 1.33e-18 84 29 3 223 3 tctD Transcriptional regulatory protein TctD Salmonella typhimurium (strain SL1344)
P72781 6.14e-16 77 26 4 172 1 rre1 Response regulator Rre1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q9HV27 5.05e-15 76 37 4 139 1 PA4781 Cyclic di-GMP phosphodiesterase PA4781 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q05943 1.08e-14 74 33 8 193 3 glnR Transcriptional regulatory protein GlnR Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
T2KMF4 2.67e-14 75 28 7 217 3 BN863_21930 Histidine kinase P4 Formosa agariphila (strain DSM 15362 / KCTC 12365 / LMG 23005 / KMM 3901 / M-2Alg 35-1)
B8GZM2 4.66e-14 74 35 1 117 1 pleD Response regulator PleD Caulobacter vibrioides (strain NA1000 / CB15N)
Q9A5I5 4.66e-14 74 35 1 117 1 pleD Response regulator PleD Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
O25918 1.68e-13 70 26 6 221 3 crdR Transcriptional regulatory protein CrdR Helicobacter pylori (strain ATCC 700392 / 26695)
Q54SP4 3.05e-13 72 32 2 121 2 dhkD Hybrid signal transduction histidine kinase D Dictyostelium discoideum
P43501 4.28e-13 67 31 1 116 3 pilH Protein PilH Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P55701 1.55e-12 68 28 4 183 4 NGR_a00800 Probable transcriptional regulatory protein y4xI Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q9KSB1 6.82e-12 67 35 5 134 1 VC_1348 Probable cyclic di-GMP phosphodiesterase VC_1348 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P40138 7.15e-12 67 33 2 130 1 cyaB Adenylate cyclase 2 Stigmatella aurantiaca
Q8KIY1 1.82e-11 67 31 2 116 1 tmoS Sensor histidine kinase TmoS Pseudomonas mendocina
Q9K998 5.72e-11 63 31 5 138 3 dctR Probable C4-dicarboxylate response regulator DctR Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
P96602 7.4e-11 63 27 3 136 3 dctR Probable C4-dicarboxylate response regulator DctR Bacillus subtilis (strain 168)
Q1XDE4 2.03e-10 62 27 1 118 3 ycf29 Probable transcriptional regulator ycf29 Neopyropia yezoensis
E0X9C7 5.17e-10 62 29 2 116 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain DOT-T1E)
Q4UU85 6.87e-10 61 33 1 92 1 rpfG Cyclic di-GMP phosphodiesterase response regulator RpfG Xanthomonas campestris pv. campestris (strain 8004)
P46384 7.94e-10 58 26 2 123 1 pilG Protein PilG Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P24072 1.72e-09 57 27 2 118 1 cheY Chemotaxis protein CheY Bacillus subtilis (strain 168)
Q56312 1.78e-09 57 27 2 108 1 cheY Chemotaxis protein CheY Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
A6X580 1.9e-09 57 31 1 116 3 divK Polar-differentiation response regulator DivK Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
A5W4E3 1.99e-09 60 28 2 116 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q06065 2.99e-09 60 32 1 101 1 atoC Regulatory protein AtoC Escherichia coli (strain K12)
P21649 3.65e-09 58 29 4 127 1 mrkE Protein MrkE Klebsiella pneumoniae
O25153 5.04e-09 59 40 1 62 1 cheAY Sensor histidine kinase CheAY Helicobacter pylori (strain ATCC 700392 / 26695)
Q8FW53 5.27e-09 56 31 1 116 3 divK Polar-differentiation response regulator DivK Brucella suis biovar 1 (strain 1330)
A9WYT1 5.27e-09 56 31 1 116 3 divK Polar-differentiation response regulator DivK Brucella suis (strain ATCC 23445 / NCTC 10510)
A5VUU3 5.27e-09 56 31 1 116 3 divK Polar-differentiation response regulator DivK Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q8YC73 5.27e-09 56 31 1 116 3 divK Polar-differentiation response regulator DivK Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
A9MBQ2 5.27e-09 56 31 1 116 3 divK Polar-differentiation response regulator DivK Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q7BBW0 5.27e-09 56 31 1 116 1 divK Polar-differentiation response regulator DivK Brucella abortus biovar 1 (strain 9-941)
Q2YKN1 5.27e-09 56 31 1 116 3 divK Polar-differentiation response regulator DivK Brucella abortus (strain 2308)
B2SB45 5.27e-09 56 31 1 116 3 divK Polar-differentiation response regulator DivK Brucella abortus (strain S19)
O29221 7.13e-09 58 33 3 127 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
B0R4K1 1.03e-08 55 27 1 117 1 cheY Chemotaxis protein CheY Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
Q10WZ6 1.04e-08 58 27 9 198 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Trichodesmium erythraeum (strain IMS101)
P52929 1.4e-08 56 28 4 139 3 spo0A Stage 0 sporulation protein A (Fragment) Brevibacillus parabrevis
Q8FFE0 1.47e-08 57 29 4 135 3 ypdB Transcriptional regulatory protein YpdB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P52940 1.72e-08 57 26 5 160 3 spo0A Stage 0 sporulation protein A homolog Clostridium pasteurianum
P51343 2.14e-08 56 30 1 118 3 ycf29 Probable transcriptional regulator ycf29 Porphyra purpurea
O07528 2.54e-08 55 35 1 79 3 yhcZ Uncharacterized transcriptional regulatory protein YhcZ Bacillus subtilis (strain 168)
P71403 4.25e-08 53 25 4 119 1 cheY1 Chemotaxis protein CheY1 Helicobacter pylori (strain ATCC 700392 / 26695)
Q9ZM64 4.25e-08 53 25 4 119 3 cheY1 Chemotaxis protein CheY1 Helicobacter pylori (strain J99 / ATCC 700824)
P48359 4.49e-08 55 29 3 113 3 ycf29 Probable transcriptional regulator ycf29 Cyanophora paradoxa
Q39T95 4.7e-08 56 44 0 58 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
P41789 7.44e-08 55 26 1 138 1 glnG DNA-binding transcriptional regulator NtrC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q54YZ9 1.1e-07 55 32 1 118 3 dhkJ Hybrid signal transduction histidine kinase J Dictyostelium discoideum
Q30RX5 1.12e-07 55 27 4 136 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Sulfurimonas denitrificans (strain ATCC 33889 / DSM 1251)
P0AE41 1.15e-07 54 30 5 135 3 ypdB Transcriptional regulatory protein YpdB Shigella flexneri
P0AE39 1.15e-07 54 30 5 135 1 ypdB Transcriptional regulatory protein YpdB Escherichia coli (strain K12)
P0AE40 1.15e-07 54 30 5 135 3 ypdB Transcriptional regulatory protein YpdB Escherichia coli O157:H7
A5VW00 1.24e-07 54 26 7 209 3 ftcR Flagellar transcriptional regulator FtcR Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
P09432 1.33e-07 55 28 2 121 3 ntrC DNA-binding transcriptional regulator NtrC Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
P52931 1.47e-07 53 29 5 141 3 spo0A Stage 0 sporulation protein A (Fragment) Niallia circulans
Q8FUS8 1.47e-07 53 27 7 209 3 ftcR Flagellar transcriptional regulator FtcR Brucella suis biovar 1 (strain 1330)
Q8YDL7 1.47e-07 53 27 7 209 1 ftcR Flagellar transcriptional regulator FtcR Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q576I4 1.47e-07 53 27 7 209 3 ftcR Flagellar transcriptional regulator FtcR Brucella abortus biovar 1 (strain 9-941)
Q2YJF8 1.47e-07 53 27 7 209 3 ftcR Flagellar transcriptional regulator FtcR Brucella abortus (strain 2308)
P62640 1.78e-07 54 41 0 58 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
P66797 2.41e-07 53 32 1 83 3 uvrY Response regulator UvrY Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P66798 2.41e-07 53 32 1 83 3 uvrY Response regulator UvrY Escherichia coli O157:H7
P52936 2.95e-07 53 26 4 135 3 spo0A Stage 0 sporulation protein A homolog Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
P0AED6 3.07e-07 53 32 1 83 3 uvrY Response regulator UvrY Shigella flexneri
P0AED5 3.07e-07 53 32 1 83 1 uvrY Response regulator UvrY Escherichia coli (strain K12)
P51586 3.2e-07 51 30 1 109 3 None Uncharacterized 14.6 kDa protein in sodA1 3'region Leptolyngbya boryana
P39486 3.33e-07 53 27 3 112 3 dctR Probable C4-dicarboxylate response regulator DctR Priestia megaterium
P06628 3.77e-07 51 27 1 116 1 spo0F Sporulation initiation phosphotransferase F Bacillus subtilis (strain 168)
P0AFB8 3.8e-07 53 25 1 135 1 glnG DNA-binding transcriptional regulator NtrC Escherichia coli (strain K12)
P0AFB9 3.8e-07 53 25 1 135 3 glnG DNA-binding transcriptional regulator NtrC Escherichia coli O157:H7
P58253 4.03e-07 53 26 7 168 3 spo0A Stage 0 sporulation protein A homolog Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
P10577 4.46e-07 53 25 2 130 1 ntrC DNA-binding transcriptional regulator NtrC Rhizobium meliloti (strain 1021)
P45709 4.79e-07 50 26 2 115 3 ccdB Protein CcdB Bacillus subtilis (strain 168)
Q6H805 5.06e-07 53 26 2 131 2 RR24 Two-component response regulator ORR24 Oryza sativa subsp. japonica
Q9KT84 5.37e-07 53 24 3 166 1 luxO Regulatory protein LuxO Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
O85128 5.42e-07 53 32 3 104 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Agrobacterium fabrum (strain C58 / ATCC 33970)
A2X1N2 5.45e-07 53 26 2 131 3 RR24 Two-component response regulator ORR24 Oryza sativa subsp. indica
Q05522 5.75e-07 53 32 3 103 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Bacillus subtilis (strain 168)
P52941 5.82e-07 52 26 3 105 3 spo0A Stage 0 sporulation protein A homolog Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
A1W0A5 5.83e-07 50 23 3 119 3 cheY Chemotaxis protein CheY homolog Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
P0C635 5.83e-07 50 23 3 119 3 cheY Chemotaxis protein CheY homolog Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
A8FMH1 5.83e-07 50 23 3 119 3 cheY Chemotaxis protein CheY homolog Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
Q9RC52 6.19e-07 52 31 6 148 3 citT Transcriptional regulatory protein CitT Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q9UYF3 6.74e-07 52 31 4 123 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Pyrococcus abyssi (strain GE5 / Orsay)
Q82Z76 7.18e-07 52 24 5 169 4 lytT Sensory transduction protein LytT Enterococcus faecalis (strain ATCC 700802 / V583)
Q7A0I0 7.88e-07 51 31 1 87 3 vraR Response regulator protein VraR Staphylococcus aureus (strain MW2)
Q6G850 7.88e-07 51 31 1 87 3 vraR Response regulator protein VraR Staphylococcus aureus (strain MSSA476)
Q6GFH3 7.88e-07 51 31 1 87 3 vraR Response regulator protein VraR Staphylococcus aureus (strain MRSA252)
Q7A4R9 7.88e-07 51 31 1 87 1 vraR Response regulator protein VraR Staphylococcus aureus (strain N315)
Q7A2Q1 7.88e-07 51 31 1 87 1 vraR Response regulator protein VraR Staphylococcus aureus (strain Mu50 / ATCC 700699)
P0C0Z1 7.88e-07 51 31 1 87 3 vraR Response regulator protein VraR Staphylococcus aureus (strain Mu3 / ATCC 700698)
O58192 8.65e-07 52 31 4 123 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q5N6V8 1.05e-06 52 29 2 136 3 RR26 Two-component response regulator ORR26 Oryza sativa subsp. japonica
P96686 1.15e-06 51 34 1 75 3 ydfI Transcriptional regulatory protein YdfI Bacillus subtilis (strain 168)
P03029 1.33e-06 52 27 1 132 1 ntrC DNA-binding transcriptional regulator NtrC Klebsiella pneumoniae
P0DMC5 1.36e-06 52 29 1 124 1 rcsC Sensor histidine kinase RcsC Escherichia coli (strain K12)
O05251 1.41e-06 51 32 5 128 3 malR Transcriptional regulatory protein MalR Bacillus subtilis (strain 168)
Q0AWZ8 1.45e-06 52 32 3 103 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
P45671 1.69e-06 52 25 2 125 3 ntrC DNA-binding transcriptional regulator NtrC Azospirillum brasilense
Q04848 1.86e-06 51 22 1 120 3 ntrC DNA-binding transcriptional regulator NtrC Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
P18769 2.7e-06 51 29 1 111 1 frzE Gliding motility regulatory protein Myxococcus xanthus
B2J4Q8 2.76e-06 50 30 4 118 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
P52942 2.96e-06 48 28 2 108 3 spo0F Sporulation initiation phosphotransferase F Bacillus thuringiensis subsp. kurstaki
Q7MM78 3.24e-06 50 24 4 166 3 luxO Regulatory protein LuxO Vibrio vulnificus (strain YJ016)
Q8CWJ5 3.24e-06 50 24 4 166 3 luxO Regulatory protein LuxO Vibrio vulnificus (strain CMCP6)
Q56128 3.6e-06 51 32 1 103 3 rcsC Sensor histidine kinase RcsC Salmonella typhi
Q9APD9 3.64e-06 50 32 1 100 3 zraR Transcriptional regulatory protein ZraR Klebsiella oxytoca
P58662 3.66e-06 51 32 1 103 3 rcsC Sensor histidine kinase RcsC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q1IQS9 3.73e-06 50 28 3 123 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Koribacter versatilis (strain Ellin345)
Q65JK6 3.83e-06 50 31 3 103 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
P0C5S5 3.85e-06 50 22 4 166 3 luxO Luminescence regulatory protein LuxO Vibrio harveyi
A7MVC2 3.85e-06 50 22 4 166 1 luxO Luminescence regulatory protein LuxO Vibrio campbellii (strain ATCC BAA-1116)
Q87MX7 4.07e-06 50 22 4 166 3 luxO Regulatory protein LuxO Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q2RRX2 4.46e-06 50 35 3 103 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q5L0L0 4.54e-06 50 30 4 107 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Geobacillus kaustophilus (strain HTA426)
Q9ZWJ9 4.68e-06 50 29 1 101 1 ARR2 Two-component response regulator ARR2 Arabidopsis thaliana
Q8D5Z6 4.87e-06 50 28 1 107 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio vulnificus (strain CMCP6)
Q7MD16 4.96e-06 50 28 1 107 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio vulnificus (strain YJ016)
Q39WQ9 5.01e-06 50 33 3 106 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
P0AEV3 5.28e-06 50 32 1 100 3 rssB Regulator of RpoS Shigella flexneri
P0AEV1 5.28e-06 50 32 1 100 1 rssB Regulator of RpoS Escherichia coli (strain K12)
P0AEV2 5.28e-06 50 32 1 100 3 rssB Regulator of RpoS Escherichia coli O157:H7
P37599 5.4e-06 50 33 4 112 1 cheV Chemotaxis protein CheV Bacillus subtilis (strain 168)
P0AEL8 6.02e-06 49 24 5 170 3 fimZ Fimbriae Z protein Escherichia coli (strain K12)
P0AEL9 6.02e-06 49 24 5 170 3 fimZ Fimbriae Z protein Escherichia coli O157:H7
P10576 6.55e-06 50 23 1 110 3 ntrC DNA-binding transcriptional regulator NtrC Bradyrhizobium sp. (strain RP501 Parasponia)
Q12YX1 7.64e-06 49 27 3 108 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Methanococcoides burtonii (strain DSM 6242 / NBRC 107633 / OCM 468 / ACE-M)
Q5A4X5 8.23e-06 49 29 1 102 3 SKN7 Transcription factor SKN7 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q2LR65 8.51e-06 49 34 4 104 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Syntrophus aciditrophicus (strain SB)
P9WGM3 9e-06 48 27 3 120 1 pdtaR Transcriptional regulatory protein PdtaR Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM2 9e-06 48 27 3 120 3 pdtaR Transcriptional regulatory protein PdtaR Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P52934 1.02e-05 48 27 3 109 1 spo0A Stage 0 sporulation protein A Geobacillus stearothermophilus
Q2SFK0 1.08e-05 49 30 3 122 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Hahella chejuensis (strain KCTC 2396)
Q8L9Y3 1.22e-05 49 25 3 144 1 ARR14 Two-component response regulator ARR14 Arabidopsis thaliana
Q9I6V9 1.22e-05 48 29 5 126 1 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8EQQ3 1.29e-05 48 27 3 107 3 lytT Sensory transduction protein LytT Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q5A599 1.32e-05 49 28 1 114 1 NIK1 Histidine protein kinase NIK1 Candida albicans (strain SC5314 / ATCC MYA-2876)
P38889 1.43e-05 49 25 1 102 1 SKN7 Transcription factor SKN7 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q3ADA6 1.45e-05 48 32 3 103 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
O34534 1.48e-05 48 36 1 74 1 citT Transcriptional regulatory protein CitT Bacillus subtilis (strain 168)
P0DMC6 1.49e-05 49 27 1 124 1 rcsC Sensor histidine kinase RcsC Escherichia coli
Q9FXD6 1.5e-05 48 26 1 117 1 ARR11 Two-component response regulator ARR11 Arabidopsis thaliana
P33394 1.62e-05 47 25 3 140 3 rrf1 Protein Rrf1 Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q55169 1.83e-05 47 28 3 126 1 rcp1 Response regulator Rcp1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P25852 2.07e-05 48 30 1 100 1 zraR Transcriptional regulatory protein ZraR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8Z333 2.12e-05 48 30 1 100 3 zraR Transcriptional regulatory protein ZraR Salmonella typhi
Q0A9Z5 2.13e-05 48 34 1 75 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q5JF95 2.18e-05 48 33 3 105 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
Q1D359 2.28e-05 48 33 0 74 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Myxococcus xanthus (strain DK1622)
Q8RAZ3 2.67e-05 48 32 3 103 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
P0A2D5 2.7e-05 45 25 2 119 1 cheY Chemotaxis protein CheY Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2D6 2.7e-05 45 25 2 119 3 cheY Chemotaxis protein CheY Salmonella typhi
Q2ILG8 2.77e-05 48 34 0 58 3 cheB6 Protein-glutamate methylesterase/protein-glutamine glutaminase 6 Anaeromyxobacter dehalogenans (strain 2CP-C)
P28787 2.8e-05 48 26 2 104 3 ntrC DNA-binding transcriptional regulator NtrC Proteus hauseri
A1SMR4 2.95e-05 47 30 5 131 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Nocardioides sp. (strain ATCC BAA-499 / JS614)
Q1IRH0 3.2e-05 47 32 4 112 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Koribacter versatilis (strain Ellin345)
Q13SY2 3.27e-05 47 29 2 103 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Paraburkholderia xenovorans (strain LB400)
O33558 3.43e-05 47 44 2 63 1 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase of group 3 operon Cereibacter sphaeroides
Q8D0P1 3.49e-05 45 28 1 76 3 cheY Chemotaxis protein CheY Yersinia pestis
P94439 3.5e-05 47 25 8 199 1 lnrK Transcriptional regulatory protein LnrK Bacillus subtilis (strain 168)
P39048 3.65e-05 47 36 1 63 2 patA Protein PatA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q2KCH8 3.69e-05 47 30 3 104 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
P45365 3.75e-05 47 26 1 117 3 None Uncharacterized 76.5 kDa protein in phbC 3'region Thiocystis violacea
P06534 3.88e-05 47 26 4 118 1 spo0A Stage 0 sporulation protein A Bacillus subtilis (strain 168)
Q820K0 3.94e-05 47 30 2 103 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q39KQ1 3.97e-05 47 30 3 104 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q4ZSY3 4.18e-05 47 30 6 123 3 Psyr_2700 Blue-light-activated protein Pseudomonas syringae pv. syringae (strain B728a)
Q1BRL2 4.3e-05 47 30 3 104 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Burkholderia orbicola (strain AU 1054)
Q7NSI8 4.33e-05 47 34 1 64 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q04849 4.35e-05 47 30 2 104 3 ntrX Nitrogen assimilation regulatory protein NtrX Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
O83639 4.36e-05 47 33 3 77 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Treponema pallidum (strain Nichols)
P0AE69 4.37e-05 45 28 1 81 3 cheY Chemotaxis protein CheY Shigella flexneri
P0AE67 4.37e-05 45 28 1 81 1 cheY Chemotaxis protein CheY Escherichia coli (strain K12)
P0AE68 4.37e-05 45 28 1 81 3 cheY Chemotaxis protein CheY Escherichia coli O157:H7
Q2SPQ1 4.51e-05 47 37 1 64 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Hahella chejuensis (strain KCTC 2396)
Q87K77 4.51e-05 47 24 4 137 3 VPA0021 Uncharacterized response regulatory protein VPA0021 Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q8FGP6 4.55e-05 45 28 1 81 3 cheY Chemotaxis protein CheY Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q93P00 4.97e-05 45 28 1 76 3 cheY Chemotaxis protein CheY Yersinia enterocolitica
P62637 5.12e-05 47 33 3 105 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q3SIG0 5.67e-05 47 33 1 65 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Thiobacillus denitrificans (strain ATCC 25259)
O87717 5.76e-05 47 26 4 136 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q54RP6 5.78e-05 47 27 3 119 3 dhkL Hybrid signal transduction histidine kinase L Dictyostelium discoideum
Q940D0 6.02e-05 47 28 1 101 1 ARR1 Two-component response regulator ARR1 Arabidopsis thaliana
Q3J653 6.06e-05 47 44 2 63 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
P14375 6.15e-05 47 30 1 100 1 zraR Transcriptional regulatory protein ZraR Escherichia coli (strain K12)
Q881J7 6.48e-05 47 30 6 123 1 PSPTO_2896 Blue-light-activated protein Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q2STS8 6.9e-05 47 35 1 65 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q63PS2 6.94e-05 47 35 1 65 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Burkholderia pseudomallei (strain K96243)
P0DOA0 7.08e-05 47 27 4 121 1 cckA Sensor kinase CckA Brucella abortus (strain 2308)
P62646 7.12e-05 46 27 4 127 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q3JY65 7.23e-05 46 35 1 65 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Burkholderia pseudomallei (strain 1710b)
Q62G12 7.23e-05 46 35 1 65 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Burkholderia mallei (strain ATCC 23344)
Q8X613 7.45e-05 47 30 1 100 3 zraR Transcriptional regulatory protein ZraR Escherichia coli O157:H7
Q9KS59 7.56e-05 46 32 3 106 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q8XQ83 7.76e-05 46 33 1 65 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q3SVA1 7.81e-05 46 32 4 108 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
Q7VZ94 8.18e-05 46 37 2 66 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
P0DMI2 8.44e-05 46 31 3 101 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
B0R4K0 8.44e-05 46 31 3 101 1 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
Q7WAA4 8.57e-05 46 37 2 66 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WJE7 8.64e-05 46 37 2 66 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q9FAD7 9.12e-05 44 27 1 81 3 cheY Chemotaxis protein CheY Enterobacter cloacae
P26319 9.44e-05 45 23 4 158 3 fimZ Fimbriae Z protein Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q6K8X6 9.57e-05 46 27 1 117 2 RR23 Two-component response regulator ORR23 Oryza sativa subsp. japonica
Q20XE6 9.6e-05 46 33 2 103 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Rhodopseudomonas palustris (strain BisB18)
Q86AT9 9.89e-05 47 27 2 133 3 dhkI-1 Hybrid signal transduction histidine kinase I Dictyostelium discoideum
Q2L1D1 9.94e-05 46 33 1 65 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Bordetella avium (strain 197N)
P62645 0.000103 46 40 1 64 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase of group 3 operon Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
B8AEH1 0.000108 46 27 1 117 3 RR23 Two-component response regulator ORR23 Oryza sativa subsp. indica
Q1RAQ1 0.000113 46 29 4 105 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Escherichia coli (strain UTI89 / UPEC)
Q0TGV0 0.000113 46 29 4 105 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q83R52 0.000114 46 29 4 105 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Shigella flexneri
Q3Z2R1 0.000118 46 29 4 105 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Shigella sonnei (strain Ss046)
Q8FGP5 0.000118 46 29 4 105 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P07330 0.00012 46 29 4 105 1 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Escherichia coli (strain K12)
Q9KA55 0.000122 45 26 3 106 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
O78417 0.000122 45 24 3 111 3 ycf29 Probable transcriptional regulator ycf29 Guillardia theta
Q8XCF9 0.000122 45 29 4 105 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Escherichia coli O157:H7
P04042 0.000123 45 29 4 105 1 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q5PMY3 0.000123 45 29 4 105 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q8Z5V2 0.000129 45 29 4 105 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Salmonella typhi
Q57N81 0.000129 45 29 4 105 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Salmonella choleraesuis (strain SC-B67)
Q322K2 0.000133 45 29 4 105 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Shigella boydii serotype 4 (strain Sb227)
Q51455 0.000138 43 23 2 121 3 cheY Chemotaxis protein CheY Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8D4X6 0.000144 45 25 3 108 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Vibrio vulnificus (strain CMCP6)
Q7MBQ5 0.000153 45 25 3 108 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Vibrio vulnificus (strain YJ016)
Q5SML5 0.000153 46 28 3 119 2 RR22 Two-component response regulator ORR22 Oryza sativa subsp. japonica
Q3LWR6 0.000153 45 20 2 130 3 todT Response regulator protein TodT Pseudomonas putida
I7CA98 0.000153 45 20 2 130 1 todT Response regulator protein TodT Pseudomonas putida (strain DOT-T1E)
A5W4E2 0.000153 45 20 2 130 1 todT Response regulator protein TodT Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q9FAD8 0.000154 45 29 4 105 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Enterobacter cloacae
Q6LTM2 0.000155 45 33 1 72 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Photobacterium profundum (strain SS9)
B8B3I4 0.000156 46 28 3 119 3 RR22 Two-component response regulator ORR22 Oryza sativa subsp. indica
Q9KL96 0.000158 45 25 3 105 3 VC_A0850 Uncharacterized response regulatory protein VC_A0850 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q30ZJ5 0.000164 45 31 3 104 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
Q1CI99 0.00018 45 29 4 105 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZFM0 0.00018 45 29 4 105 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Yersinia pestis

  • Number of RefSeq hits:

General

Source Morganella morganii S5
Locus tag HKOGLL_05310
Feature type CDS
Gene baeR
Product two-component system response regulator BaeR
Location 118939 - 119658 (strand: -1)
Length 720 (nucleotides) / 239 (amino acids)
In genomic island -

Contig

Accession ZDB_682
Length 259781 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2223
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00072 Response regulator receiver domain
PF00486 Transcriptional regulatory protein, C terminal

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0745 Signal transduction mechanisms (T)
Transcription (K)
TK DNA-binding response regulator, OmpR family, contains REC and winged-helix (wHTH) domain

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K07664 two-component system, OmpR family, response regulator BaeR Two-component system -

Protein Sequence

MEQNAELILIVEDEPKLAQLLTDYLHAAHYRTHWLARGGEVTAWVQENKPDLILLDLMLPEKDGLTLCREIRQFSDVPVMMVTAKTEEIDRLLGLEIGADDYVCKPYSPREVVARIKTILRRCQRSNDTSEDKCDTLTIDEVNYQVRFGTQSLDLTQVEFRLLRTMVSQPGTVLSRNQLLDNLYDDYRVVTDRTIDSHIKNLRRKLGQLDGDRDFIHSVYGLGYRWEGGPAEIIAATII

Flanking regions ( +/- flanking 50bp)

GTGACCATCACTCTGATCCTGCCCCGCCCTGACTGACAGGAGTTGACTGCATGGAACAAAATGCTGAACTGATTCTTATTGTGGAAGATGAGCCGAAACTGGCTCAGTTACTGACAGATTACCTGCACGCCGCCCATTACCGCACGCACTGGCTGGCACGCGGCGGCGAAGTTACGGCCTGGGTGCAGGAAAATAAACCGGATCTGATTTTGCTGGATCTGATGCTGCCGGAGAAAGACGGCCTGACACTCTGCCGTGAAATCCGTCAGTTCAGTGACGTGCCGGTGATGATGGTCACGGCCAAAACCGAAGAGATTGACCGCCTGCTGGGGCTGGAAATCGGTGCGGATGATTATGTCTGCAAGCCTTACAGCCCGCGTGAGGTGGTGGCGCGGATCAAAACCATTCTGCGCCGCTGTCAGCGCAGTAACGATACGTCAGAGGATAAGTGTGACACTCTGACTATTGACGAGGTGAATTATCAGGTGCGTTTCGGGACACAAAGCCTGGATCTCACTCAGGTTGAATTCCGCCTGCTGCGCACCATGGTGTCACAGCCGGGCACTGTGCTGTCACGCAATCAGCTGCTGGATAATCTGTATGATGATTACCGCGTGGTCACTGACCGCACGATTGACAGCCATATCAAAAATCTGCGCCGCAAGCTCGGGCAGTTAGACGGTGACCGCGATTTTATTCATTCCGTCTACGGGCTGGGCTACCGCTGGGAAGGCGGACCGGCAGAGATTATTGCCGCCACCATTATCTGATAAAAAACGGCGGAATATCCGCCGTTTGTTGTTTCTCTGATTACTGAATA