Homologs in group_2223

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_16470 FBDBKF_16470 90.0 Morganella morganii S1 baeR two-component system response regulator BaeR
EHELCC_08335 EHELCC_08335 90.0 Morganella morganii S2 baeR two-component system response regulator BaeR
NLDBIP_08660 NLDBIP_08660 90.0 Morganella morganii S4 baeR two-component system response regulator BaeR
LHKJJB_05605 LHKJJB_05605 90.0 Morganella morganii S3 baeR two-component system response regulator BaeR
HKOGLL_05310 HKOGLL_05310 90.0 Morganella morganii S5 baeR two-component system response regulator BaeR
PMI_RS07750 PMI_RS07750 63.1 Proteus mirabilis HI4320 baeR two-component system response regulator BaeR

Distribution of the homologs in the orthogroup group_2223

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2223

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P69228 8.26e-107 311 65 1 235 1 baeR Transcriptional regulatory protein BaeR Escherichia coli (strain K12)
P69229 8.26e-107 311 65 1 235 1 baeR Transcriptional regulatory protein BaeR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P08368 1.2e-49 165 39 2 225 1 creB Transcriptional regulatory protein CreB Escherichia coli (strain K12)
P37478 2.72e-48 162 41 4 227 1 walR Transcriptional regulatory protein WalR Bacillus subtilis (strain 168)
Q7A0U4 2.52e-45 154 41 6 229 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain MW2)
Q9L524 2.52e-45 154 41 6 229 2 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus
Q6G972 2.52e-45 154 41 6 229 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain MSSA476)
Q6GGK6 2.52e-45 154 41 6 229 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain MRSA252)
Q7A5H6 2.52e-45 154 41 6 229 1 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain N315)
Q7A2R6 2.52e-45 154 41 6 229 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HFT0 2.52e-45 154 41 6 229 2 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain COL)
Q2FY79 2.52e-45 154 41 6 229 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain NCTC 8325 / PS 47)
P13792 6.46e-45 153 39 5 233 1 phoP Alkaline phosphatase synthesis transcriptional regulatory protein PhoP Bacillus subtilis (strain 168)
P28835 1.08e-44 152 37 3 237 3 ycf27 Probable transcriptional regulator ycf27 Porphyridium aerugineum
P94413 1.47e-44 152 37 3 226 3 yclJ Uncharacterized transcriptional regulatory protein YclJ Bacillus subtilis (strain 168)
Q4LAJ9 3.43e-44 151 38 4 228 3 walR Transcriptional regulatory protein WalR Staphylococcus haemolyticus (strain JCSC1435)
P45607 3.61e-44 151 37 2 225 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Shigella flexneri
P35163 3.71e-44 151 38 5 235 1 resD Transcriptional regulatory protein ResD Bacillus subtilis (strain 168)
P0AFJ5 3.73e-44 151 37 2 225 1 phoB Phosphate regulon transcriptional regulatory protein PhoB Escherichia coli (strain K12)
P0AFJ6 3.73e-44 151 37 2 225 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Escherichia coli O157:H7
P45606 3.93e-44 151 37 2 225 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Shigella dysenteriae
Q8CQK0 3.95e-44 151 38 4 228 3 walR Transcriptional regulatory protein WalR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HK18 3.95e-44 151 38 4 228 3 walR Transcriptional regulatory protein WalR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P48259 4.28e-44 151 37 3 236 3 ycf27 Probable transcriptional regulator ycf27 Cyanophora paradoxa
A0A4P7TS68 5.37e-44 150 37 4 232 1 ompR DNA-binding dual transcriptional regulator OmpR Shigella flexneri serotype 5a (strain M90T)
P0AA21 5.37e-44 150 37 4 232 3 ompR DNA-binding dual transcriptional regulator OmpR Shigella flexneri
P0AA19 5.37e-44 150 37 4 232 3 ompR DNA-binding dual transcriptional regulator OmpR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A0A0H3NGY1 5.37e-44 150 37 4 232 3 ompR DNA-binding dual transcriptional regulator OmpR Salmonella typhimurium (strain SL1344)
P0AA20 5.37e-44 150 37 4 232 1 ompR DNA-binding dual transcriptional regulator OmpR Salmonella typhi
P0AA16 5.37e-44 150 37 4 232 1 ompR DNA-binding dual transcriptional regulator OmpR Escherichia coli (strain K12)
P0AA17 5.37e-44 150 37 4 232 3 ompR DNA-binding dual transcriptional regulator OmpR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AA18 5.37e-44 150 37 4 232 3 ompR DNA-binding dual transcriptional regulator OmpR Escherichia coli O157:H7
P51358 9.33e-44 150 38 3 235 3 ycf27 Probable transcriptional regulator ycf27 Porphyra purpurea
Q1XDC9 1.08e-43 150 38 3 235 3 ycf27 Probable transcriptional regulator ycf27 Neopyropia yezoensis
P45605 1.25e-43 149 37 2 227 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Klebsiella pneumoniae
Q7A216 1.41e-43 149 36 4 230 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain MW2)
Q9RDT5 1.41e-43 149 36 4 230 1 walR Transcriptional regulatory protein WalR Staphylococcus aureus
A8YYU1 1.41e-43 149 36 4 230 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain USA300 / TCH1516)
Q6GD72 1.41e-43 149 36 4 230 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain MSSA476)
Q6GKS7 1.41e-43 149 36 4 230 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain MRSA252)
Q7A8E1 1.41e-43 149 36 4 230 1 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain N315)
Q99XF3 1.41e-43 149 36 4 230 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QD57 1.41e-43 149 36 4 230 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain Newman)
Q5HJX7 1.41e-43 149 36 4 230 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain COL)
Q2YUQ3 1.41e-43 149 36 4 230 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5INQ9 1.41e-43 149 36 4 230 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain JH9)
Q2G2U6 1.41e-43 149 36 4 230 1 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FKN8 1.41e-43 149 36 4 230 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain USA300)
A6TXG8 1.41e-43 149 36 4 230 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain JH1)
A7WWQ5 1.41e-43 149 36 4 230 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q4A160 3.1e-43 149 37 4 228 3 walR Transcriptional regulatory protein WalR Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
P50350 7.65e-43 148 35 2 235 3 chvI Transcriptional regulatory protein ChvI Rhizobium meliloti (strain 1021)
O78428 7.76e-43 148 36 2 233 3 ycf27 Probable transcriptional regulator ycf27 Guillardia theta
P23620 9.46e-43 147 36 2 225 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P9WGL9 9.65e-43 147 38 1 224 1 regX3 Sensory transduction protein RegX3 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGL8 9.65e-43 147 38 1 224 2 regX3 Sensory transduction protein RegX3 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
O07130 9.65e-43 147 38 1 224 1 regX3 Sensory transduction protein RegX3 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q52990 1.18e-42 147 38 2 224 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Rhizobium meliloti (strain 1021)
Q06239 1.64e-42 147 34 2 229 3 vanR Regulatory protein VanR Enterococcus faecium
Q9F868 8.75e-42 145 38 1 225 1 regX3 Sensory transduction protein RegX3 Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q8DPL7 1.32e-41 144 38 5 230 1 walR Transcriptional regulatory protein WalR Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
A0A0H2UQ68 1.32e-41 144 38 5 230 1 walR Transcriptional regulatory protein WalR Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
A0A0H2ZN37 1.32e-41 144 38 5 230 1 walR Transcriptional regulatory protein WalR Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
A0QTK2 1.74e-41 144 40 5 228 1 mtrA DNA-binding response regulator MtrA Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q9CCJ2 7.48e-41 142 40 5 223 3 mtrA DNA-binding response regulator MtrA Mycobacterium leprae (strain TN)
Q9TLQ4 1.13e-40 142 38 5 229 3 ycf27 Probable transcriptional regulator ycf27 Cyanidium caldarium
Q82EB1 2.4e-40 141 37 3 231 3 cseB Transcriptional regulatory protein CseB Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
P9WGM7 4.21e-40 140 39 5 228 1 mtrA DNA-binding response regulator MtrA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM6 4.21e-40 140 39 5 228 3 mtrA DNA-binding response regulator MtrA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A5Z5 4.21e-40 140 39 5 228 3 mtrA DNA-binding response regulator MtrA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P50351 6.81e-40 140 32 2 245 3 chvI Transcriptional regulatory protein ChvI Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q93CB8 7.25e-40 140 39 5 223 3 mtrA DNA-binding response regulator MtrA Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q07783 7.42e-40 140 33 2 234 3 chvI Transcriptional regulatory protein ChvI Rhizobium radiobacter
G3XCY6 1.29e-39 139 35 5 234 1 gltR Transcriptional regulatory protein GltR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P28257 2.45e-39 139 36 2 230 3 ycf27 Probable transcriptional regulator ycf27 Galdieria sulphuraria
Q9I0I1 2.26e-38 136 37 2 223 1 carR Response regulator protein CarR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9HUI2 5.56e-38 135 35 5 239 3 aruR Transcriptional regulatory protein AruR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P39663 7.6e-38 135 38 5 234 1 sphR Alkaline phosphatase synthesis transcriptional regulatory protein SphR Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P44895 1.23e-37 134 41 3 180 3 cpxR Transcriptional regulatory protein CpxR homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9ZEP4 4.29e-37 133 35 3 230 1 cseB Transcriptional regulatory protein CseB Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
O06978 4.54e-37 133 33 3 227 3 yvcP Uncharacterized transcriptional regulatory protein YvcP Bacillus subtilis (strain 168)
Q1B3X8 6.82e-37 132 34 3 221 3 mprA Response regulator MprA Mycobacterium sp. (strain MCS)
A1UL70 6.82e-37 132 34 3 221 3 mprA Response regulator MprA Mycobacterium sp. (strain KMS)
A3Q5L9 6.82e-37 132 34 3 221 3 mprA Response regulator MprA Mycobacterium sp. (strain JLS)
P32040 7.98e-37 132 37 5 233 3 SYNPCC7002_A0851 Probable transcriptional regulatory protein SYNPCC7002_A0851 Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
P94504 1.66e-36 131 32 3 228 3 yvrH Transcriptional regulatory protein YvrH Bacillus subtilis (strain 168)
Q04942 1.84e-36 131 37 1 220 1 afsQ1 Transcriptional regulatory protein AfsQ1 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
A0R3I8 4.36e-36 130 35 4 224 1 mprA Response regulator MprA Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
P54884 5.16e-36 129 39 1 193 3 rgx3 Sensory transduction protein RegX3 Mycobacterium leprae (strain TN)
P0C001 6.54e-36 129 36 3 220 3 arlR Response regulator ArlR Staphylococcus aureus (strain MW2)
Q6G9E6 6.54e-36 129 36 3 220 3 arlR Response regulator ArlR Staphylococcus aureus (strain MSSA476)
Q6GGZ3 6.54e-36 129 36 3 220 3 arlR Response regulator ArlR Staphylococcus aureus (strain MRSA252)
P0C000 6.54e-36 129 36 3 220 3 arlR Response regulator ArlR Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HG04 6.54e-36 129 36 3 220 3 arlR Response regulator ArlR Staphylococcus aureus (strain COL)
Q2YY03 6.54e-36 129 36 3 220 3 arlR Response regulator ArlR Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q9KJN4 6.54e-36 129 36 3 220 1 arlR Response regulator ArlR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FH23 6.54e-36 129 36 3 220 3 arlR Response regulator ArlR Staphylococcus aureus (strain USA300)
P45189 9.46e-36 129 35 4 225 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q742C1 1.59e-35 129 33 4 225 3 mprA Response regulator MprA Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
A0QBQ9 1.59e-35 129 33 4 225 3 mprA Response regulator MprA Mycobacterium avium (strain 104)
A1TEL7 2e-35 128 33 3 222 3 mprA Response regulator MprA Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
A0A0H3GGB5 2.24e-35 128 36 3 225 2 cpxR Transcriptional regulatory protein CpxR Klebsiella pneumoniae subsp. pneumoniae (strain HS11286)
P42244 3.68e-35 127 31 2 222 3 ycbL Uncharacterized transcriptional regulatory protein YcbL Bacillus subtilis (strain 168)
Q4L6C6 4.96e-35 127 37 4 220 3 arlR Response regulator ArlR Staphylococcus haemolyticus (strain JCSC1435)
A0PWB4 5.62e-35 127 33 3 223 3 mprA Response regulator MprA Mycobacterium ulcerans (strain Agy99)
Q9CD68 7.45e-35 127 34 4 222 3 mprA Response regulator MprA Mycobacterium leprae (strain TN)
A1KHB7 1.04e-34 127 33 3 221 3 mprA Response regulator MprA Mycobacterium bovis (strain BCG / Pasteur 1173P2)
Q7U0X4 1.04e-34 127 33 3 221 1 mprA Response regulator MprA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WGM9 1.73e-34 126 33 3 221 1 mprA Response regulator MprA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM8 1.73e-34 126 33 3 221 3 mprA Response regulator MprA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U123 1.73e-34 126 33 3 221 3 mprA Response regulator MprA Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
Q55890 3.12e-34 125 34 5 230 1 rpaA DNA-binding dual master transcriptional regulator RpaA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
L7N689 3.58e-34 126 34 4 222 1 trcR Transcriptional regulatory protein TrcR Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q49ZT8 4.86e-34 125 31 4 218 3 hssR Heme response regulator HssR Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
P0AE90 5.6e-34 125 35 3 225 3 cpxR Transcriptional regulatory protein CpxR Shigella flexneri
P0AE88 5.6e-34 125 35 3 225 1 cpxR Transcriptional regulatory protein CpxR Escherichia coli (strain K12)
P0AE89 5.6e-34 125 35 3 225 3 cpxR Transcriptional regulatory protein CpxR Escherichia coli O157:H7
P0A9Q4 1.22e-33 124 32 1 229 3 arcA Aerobic respiration control protein ArcA Shigella flexneri
P0A9Q1 1.22e-33 124 32 1 229 1 arcA Aerobic respiration control protein ArcA Escherichia coli (strain K12)
P0A9Q2 1.22e-33 124 32 1 229 3 arcA Aerobic respiration control protein ArcA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9Q3 1.22e-33 124 32 1 229 3 arcA Aerobic respiration control protein ArcA Escherichia coli O157:H7
P21866 1.55e-33 123 36 6 225 1 kdpE KDP operon transcriptional regulatory protein KdpE Escherichia coli (strain K12)
Q99U73 3.09e-33 122 35 3 218 3 arlR Response regulator ArlR Staphylococcus aureus (strain N315)
Q7A1J1 3.46e-33 122 34 6 226 3 saeR Response regulator SaeR Staphylococcus aureus (strain MW2)
Q6GBC4 3.46e-33 122 34 6 226 3 saeR Response regulator SaeR Staphylococcus aureus (strain MSSA476)
Q6GIT6 3.46e-33 122 34 6 226 3 saeR Response regulator SaeR Staphylococcus aureus (strain MRSA252)
Q7A6V3 3.46e-33 122 34 6 226 1 saeR Response regulator SaeR Staphylococcus aureus (strain N315)
Q99VR7 3.46e-33 122 34 6 226 3 saeR Response regulator SaeR Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q840P8 3.46e-33 122 34 6 226 1 saeR Response regulator SaeR Staphylococcus aureus (strain Newman)
Q5HHW4 3.46e-33 122 34 6 226 1 saeR Response regulator SaeR Staphylococcus aureus (strain COL)
Q2YSM5 3.46e-33 122 34 6 226 3 saeR Response regulator SaeR Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q2G2G2 3.46e-33 122 34 6 226 1 saeR Response regulator SaeR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIT4 3.46e-33 122 34 6 226 3 saeR Response regulator SaeR Staphylococcus aureus (strain USA300)
Q8CP82 3.99e-33 122 38 5 220 3 arlR Response regulator ArlR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q7D9K0 4.46e-33 123 34 3 220 3 tcrA Transcriptional regulatory protein TcrA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
O07776 4.46e-33 123 34 3 220 1 tcrA Transcriptional regulatory protein TcrA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P44918 4.76e-33 122 32 2 230 3 arcA Aerobic respiration control protein ArcA homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P0DMK7 5.1e-33 122 35 2 218 3 irlR Transcriptional activator protein IrlR Burkholderia pseudomallei (strain K96243)
I1WSZ4 5.1e-33 122 35 2 218 3 irlR Transcriptional activator protein IrlR Burkholderia pseudomallei (strain 1026b)
Q9AE24 5.29e-33 122 34 3 222 3 rprY Transcriptional regulatory protein RprY Bacteroides fragilis (strain YCH46)
Q5HLN2 8.72e-33 121 32 4 218 3 hssR Heme response regulator HssR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q01473 9.66e-33 128 34 2 227 3 rcaC Protein RcaC Microchaete diplosiphon
Q01473 1.64e-08 58 26 2 126 3 rcaC Protein RcaC Microchaete diplosiphon
Q44929 1.01e-32 122 30 2 234 3 gtcR Response regulator GtcR Aneurinibacillus migulanus
O34903 1.34e-32 121 35 4 227 3 ykoG Uncharacterized transcriptional regulatory protein YkoG Bacillus subtilis (strain 168)
Q5HPC3 1.41e-32 120 37 5 220 3 arlR Response regulator ArlR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8CN92 1.94e-32 120 32 4 218 3 hssR Heme response regulator HssR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q44006 2.06e-32 120 33 2 218 2 czcR Transcriptional activator protein CzcR Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
O32192 2.1e-32 120 31 4 223 1 cssR Transcriptional regulatory protein CssR Bacillus subtilis (strain 168)
Q4L8L9 2.88e-32 120 33 4 220 3 hssR Heme response regulator HssR Staphylococcus haemolyticus (strain JCSC1435)
Q49XM7 4.58e-32 119 37 4 221 3 arlR Response regulator ArlR Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q9KM23 4.94e-32 120 32 4 231 1 vxrB Transcriptional regulatory protein VxrB Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P38684 1.82e-31 118 36 6 230 1 torR TorCAD operon transcriptional regulatory protein TorR Escherichia coli (strain K12)
O34951 2.22e-31 118 29 3 220 3 bceR Sensory transduction protein BceR Bacillus subtilis (strain 168)
P58357 4.96e-31 117 36 7 230 3 torR TorCAD operon transcriptional regulatory protein TorR Escherichia coli O157:H7
P42421 5.05e-31 117 32 3 224 3 yxdJ Transcriptional regulatory protein YxdJ Bacillus subtilis (strain 168)
Q9K621 5.37e-31 117 29 4 228 3 bceR Sensory transduction protein BceR Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
P54443 7e-31 117 31 3 228 3 yrkP Uncharacterized transcriptional regulatory protein YrkP Bacillus subtilis (strain 168)
Q7A039 1.19e-30 116 29 4 221 3 hssR Heme response regulator HssR Staphylococcus aureus (strain MW2)
A8Z552 1.19e-30 116 29 4 221 3 hssR Heme response regulator HssR Staphylococcus aureus (strain USA300 / TCH1516)
Q6G6V9 1.19e-30 116 29 4 221 3 hssR Heme response regulator HssR Staphylococcus aureus (strain MSSA476)
Q7A3X1 1.19e-30 116 29 4 221 3 hssR Heme response regulator HssR Staphylococcus aureus (strain N315)
Q99RR6 1.19e-30 116 29 4 221 3 hssR Heme response regulator HssR Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IVE2 1.19e-30 116 29 4 221 3 hssR Heme response regulator HssR Staphylococcus aureus (strain JH9)
Q2FVQ9 1.19e-30 116 29 4 221 3 hssR Heme response regulator HssR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FED5 1.19e-30 116 29 4 221 3 hssR Heme response regulator HssR Staphylococcus aureus (strain USA300)
A6U488 1.19e-30 116 29 4 221 3 hssR Heme response regulator HssR Staphylococcus aureus (strain JH1)
A7X5Y5 1.19e-30 116 29 4 221 3 hssR Heme response regulator HssR Staphylococcus aureus (strain Mu3 / ATCC 700698)
A6QJK3 2.01e-30 115 29 4 221 1 hssR Heme response regulator HssR Staphylococcus aureus (strain Newman)
Q5HDJ4 2.01e-30 115 29 4 221 3 hssR Heme response regulator HssR Staphylococcus aureus (strain COL)
Q6GE73 2.45e-30 115 29 4 221 3 hssR Heme response regulator HssR Staphylococcus aureus (strain MRSA252)
Q6GJ11 2.91e-30 115 28 4 223 3 graR Response regulator protein GraR Staphylococcus aureus (strain MRSA252)
P31079 3.7e-30 115 32 5 238 3 petR Protein PetR Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
Q2YSS2 6.89e-30 114 27 3 222 3 graR Response regulator protein GraR Staphylococcus aureus (strain bovine RF122 / ET3-1)
A8Z181 9.09e-30 114 27 3 222 3 graR Response regulator protein GraR Staphylococcus aureus (strain USA300 / TCH1516)
A6QEW8 9.09e-30 114 27 3 222 3 graR Response regulator protein GraR Staphylococcus aureus (strain Newman)
Q5HI09 9.09e-30 114 27 3 222 1 graR Response regulator protein GraR Staphylococcus aureus (strain COL)
Q2G0E0 9.09e-30 114 27 3 222 1 graR Response regulator protein GraR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIY0 9.09e-30 114 27 3 222 3 graR Response regulator protein GraR Staphylococcus aureus (strain USA300)
Q2FWH6 1.05e-29 114 33 2 221 1 kdpE Transcriptional regulatory protein KdpE Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2YZ24 1.7e-29 113 29 4 221 3 hssR Heme response regulator HssR Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q7A1L2 1.78e-29 113 27 3 222 3 graR Response regulator protein GraR Staphylococcus aureus (strain MW2)
Q6GBH1 1.78e-29 113 27 3 222 3 graR Response regulator protein GraR Staphylococcus aureus (strain MSSA476)
Q99VW2 1.78e-29 113 27 3 222 3 graR Response regulator protein GraR Staphylococcus aureus (strain N315)
A5IQL2 1.78e-29 113 27 3 222 3 graR Response regulator protein GraR Staphylococcus aureus (strain JH9)
A6TZD6 1.78e-29 113 27 3 222 3 graR Response regulator protein GraR Staphylococcus aureus (strain JH1)
A7WZC3 1.78e-29 113 27 3 222 3 graR Response regulator protein GraR Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q932F1 2.08e-29 112 27 3 222 1 graR Response regulator protein GraR Staphylococcus aureus (strain Mu50 / ATCC 700699)
P52076 2.51e-29 112 31 3 219 2 qseB Transcriptional regulatory protein QseB Escherichia coli (strain K12)
Q49VK3 4.38e-29 112 29 3 226 3 graR Response regulator protein GraR Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
P9WGM1 7.47e-29 111 37 5 191 1 prrA Transcriptional regulatory protein PrrA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM0 7.47e-29 111 37 5 191 3 prrA Transcriptional regulatory protein PrrA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A5Z7 7.47e-29 111 37 5 191 3 prrA Transcriptional regulatory protein PrrA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q8CQ17 8.67e-29 111 30 5 227 1 saeR Response regulator SaeR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HR28 8.67e-29 111 30 5 227 3 saeR Response regulator SaeR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q50136 9.94e-29 111 37 5 191 3 prrA Transcriptional regulatory protein PrrA Mycobacterium leprae (strain TN)
O24973 1.15e-28 110 34 3 223 1 arsR Transcriptional regulatory protein ArsR Helicobacter pylori (strain ATCC 700392 / 26695)
Q4L481 1.35e-28 110 28 4 223 3 graR Response regulator protein GraR Staphylococcus haemolyticus (strain JCSC1435)
O69730 1.62e-28 110 34 4 221 1 tcrX Probable transcriptional regulatory protein TcrX Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P66795 1.89e-28 110 31 3 219 3 qseB Transcriptional regulatory protein QseB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P66796 1.89e-28 110 31 3 219 3 qseB Transcriptional regulatory protein QseB Salmonella typhi
Q8XBS3 2.06e-28 110 31 3 219 2 qseB Transcriptional regulatory protein QseB Escherichia coli O157:H7
Q31S42 2.31e-28 110 32 6 231 1 rpaA DNA-binding dual master transcriptional regulator RpaA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P45337 5.55e-28 108 31 3 219 3 qseB Transcriptional regulatory protein QseB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q02540 9.68e-28 108 30 2 223 1 copR Transcriptional activator protein CopR Pseudomonas syringae pv. tomato
Q47744 1.13e-27 108 32 2 221 3 vanRB Regulatory protein VanRB Enterococcus faecalis (strain ATCC 700802 / V583)
P33112 1.74e-27 107 35 1 177 3 spaR Transcriptional regulatory protein SpaR Bacillus subtilis
Q9HV32 1.9e-27 107 32 3 219 1 pmrA Response regulator protein PmrA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q07597 4.01e-27 107 32 7 233 3 nisR Nisin biosynthesis regulatory protein NisR Lactococcus lactis subsp. lactis
Q8CQ37 7.42e-27 106 26 3 224 3 graR Response regulator protein GraR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HR81 7.42e-27 106 26 3 224 3 graR Response regulator protein GraR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q47456 1.21e-26 105 34 5 224 3 pcoR Transcriptional regulatory protein PcoR Escherichia coli
P0ACZ8 9.42e-26 103 32 2 222 1 cusR Transcriptional regulatory protein CusR Escherichia coli (strain K12)
P0ACZ9 9.42e-26 103 32 2 222 3 cusR Transcriptional regulatory protein CusR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AD00 9.42e-26 103 32 2 222 3 cusR Transcriptional regulatory protein CusR Escherichia coli O157:H7
P30843 1.94e-25 102 32 3 219 1 basR Transcriptional regulatory protein BasR Escherichia coli (strain K12)
P9WGN1 4.67e-25 101 26 1 223 1 kdpE Transcriptional regulatory protein KdpE Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGN0 4.67e-25 101 26 1 223 3 kdpE Transcriptional regulatory protein KdpE Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P36556 4.85e-25 101 32 3 219 1 basR Transcriptional regulatory protein BasR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A6WZ81 8.39e-25 101 31 5 221 3 ctrA Cell cycle response regulator CtrA Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
P0A4I0 8.41e-25 100 28 4 227 3 dltR Transcriptional regulatory protein DltR Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
P0A4H9 8.41e-25 100 28 4 227 3 dltR Transcriptional regulatory protein DltR Streptococcus agalactiae serotype III (strain NEM316)
P13359 8.98e-25 101 30 6 233 3 virG Regulatory protein VirG Rhizobium rhizogenes
Q8Z7H2 9.65e-25 100 31 5 229 3 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhi
P62722 9.91e-25 101 32 5 234 3 virG Regulatory protein VirG Agrobacterium tumefaciens (strain 15955)
Q9ZHD3 1.27e-24 100 32 3 224 3 silR Probable transcriptional regulatory protein SilR Salmonella typhimurium
P0DM78 1.32e-24 100 31 5 225 1 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
F5ZP95 1.32e-24 100 31 5 225 1 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhimurium (strain ATCC 68169 / UK-1)
E1WFA1 1.32e-24 100 31 5 225 2 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhimurium (strain SL1344)
D0ZV90 1.32e-24 100 31 5 225 1 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhimurium (strain 14028s / SGSC 2262)
Q5PMJ1 1.32e-24 100 31 5 225 3 phoP Virulence transcriptional regulatory protein PhoP Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q70FH0 1.41e-24 100 32 3 224 3 pmrA Transcriptional regulatory protein PmrA Pectobacterium parmentieri
Q8FZ93 1.58e-24 100 30 3 220 1 ctrA Cell cycle response regulator CtrA Brucella suis biovar 1 (strain 1330)
B0CI76 1.58e-24 100 30 3 220 3 ctrA Cell cycle response regulator CtrA Brucella suis (strain ATCC 23445 / NCTC 10510)
A5VRW9 1.58e-24 100 30 3 220 1 ctrA Cell cycle response regulator CtrA Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q7CNV1 1.58e-24 100 30 3 220 1 ctrA Cell cycle response regulator CtrA Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
A9M708 1.58e-24 100 30 3 220 3 ctrA Cell cycle response regulator CtrA Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q9ZHS1 1.58e-24 100 30 3 220 1 ctrA Cell cycle response regulator CtrA Brucella abortus biovar 1 (strain 9-941)
Q2YQA4 1.58e-24 100 30 3 220 1 ctrA Cell cycle response regulator CtrA Brucella abortus (strain 2308)
B2S753 1.58e-24 100 30 3 220 3 ctrA Cell cycle response regulator CtrA Brucella abortus (strain S19)
Q57QC3 2.44e-24 99 31 5 225 3 phoP Virulence transcriptional regulatory protein PhoP Salmonella choleraesuis (strain SC-B67)
B8H358 4.75e-24 99 28 3 232 3 ctrA Cell cycle transcriptional regulator CtrA Caulobacter vibrioides (strain NA1000 / CB15N)
P0CAW8 4.75e-24 99 28 3 232 3 ctrA Cell cycle transcriptional regulator CtrA Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q83RR0 7.58e-24 98 31 5 228 3 phoP Virulence transcriptional regulatory protein PhoP Shigella flexneri
Q8CXZ9 7.58e-24 98 31 5 228 3 phoP Transcriptional regulatory protein PhoP Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q04803 7.77e-24 100 33 1 221 3 pfeR Transcriptional activator protein PfeR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P52108 9.71e-24 98 29 4 233 1 rstA Transcriptional regulatory protein RstA Escherichia coli (strain K12)
Q8X738 9.76e-24 98 30 4 227 3 phoP Transcriptional regulatory protein PhoP Escherichia coli O157:H7
P23836 1.04e-23 98 31 5 228 1 phoP Transcriptional regulatory protein PhoP Escherichia coli (strain K12)
O31432 1.13e-23 97 29 8 225 3 ybdJ Uncharacterized transcriptional regulatory protein YbdJ Bacillus subtilis (strain 168)
Q44444 1.97e-23 98 32 5 234 3 virG Regulatory protein VirG Rhizobium radiobacter
Q55933 3.72e-23 96 28 5 234 1 rppA Response regulator RppA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q8GP20 5.39e-23 95 31 5 219 1 rssB Swarming motility regulation protein RssB Serratia marcescens
P07545 9.46e-23 96 31 5 232 3 virG Regulatory protein VirG Agrobacterium fabrum (strain C58 / ATCC 33970)
Q9I4F9 2.63e-22 94 32 3 221 1 phoP Two-component response regulator PhoP Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8DN02 1.32e-21 92 28 4 225 1 rr06 Response regulator RR06 Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
A0A0H2ZNF6 1.32e-21 92 28 4 225 1 rr06 Response regulator RR06 Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
P76340 2.27e-21 91 28 2 220 1 hprR Transcriptional regulatory protein HprR Escherichia coli (strain K12)
P0A4H8 2.54e-21 91 29 3 202 3 ciaR Transcriptional regulatory protein CiaR Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A4H7 2.54e-21 91 29 3 202 3 ciaR Transcriptional regulatory protein CiaR Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
P0CL17 8.34e-20 87 29 5 226 2 tctD Transcriptional regulatory protein TctD Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
E1WA34 8.34e-20 87 29 5 226 3 tctD Transcriptional regulatory protein TctD Salmonella typhimurium (strain SL1344)
P0A4I2 2.3e-19 86 29 4 221 3 cutR Transcriptional regulatory protein CutR Streptomyces lividans
P0A4I1 2.3e-19 86 29 4 221 3 cutR Transcriptional regulatory protein CutR Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P72781 2.53e-15 75 26 5 174 1 rre1 Response regulator Rre1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
B8GZM2 1.63e-14 75 34 1 120 1 pleD Response regulator PleD Caulobacter vibrioides (strain NA1000 / CB15N)
Q9A5I5 1.63e-14 75 34 1 120 1 pleD Response regulator PleD Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
O25918 1.68e-14 73 25 6 223 3 crdR Transcriptional regulatory protein CrdR Helicobacter pylori (strain ATCC 700392 / 26695)
Q9HV27 1.92e-14 75 39 4 136 1 PA4781 Cyclic di-GMP phosphodiesterase PA4781 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
T2KMF4 1.22e-13 73 34 3 128 3 BN863_21930 Histidine kinase P4 Formosa agariphila (strain DSM 15362 / KCTC 12365 / LMG 23005 / KMM 3901 / M-2Alg 35-1)
P55701 5.41e-13 69 29 4 179 4 NGR_a00800 Probable transcriptional regulatory protein y4xI Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q05943 8.52e-13 69 32 8 193 3 glnR Transcriptional regulatory protein GlnR Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P43501 1.04e-12 66 29 1 117 3 pilH Protein PilH Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8KIY1 4.55e-12 68 31 2 123 1 tmoS Sensor histidine kinase TmoS Pseudomonas mendocina
P40138 7.08e-12 67 32 2 131 1 cyaB Adenylate cyclase 2 Stigmatella aurantiaca
Q54SP4 7.22e-12 68 31 2 134 2 dhkD Hybrid signal transduction histidine kinase D Dictyostelium discoideum
Q9K998 1.51e-11 65 32 5 140 3 dctR Probable C4-dicarboxylate response regulator DctR Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q1XDE4 7.03e-11 63 26 1 119 3 ycf29 Probable transcriptional regulator ycf29 Neopyropia yezoensis
P96602 7.18e-11 63 26 3 138 3 dctR Probable C4-dicarboxylate response regulator DctR Bacillus subtilis (strain 168)
Q9KSB1 8.46e-11 64 34 6 147 1 VC_1348 Probable cyclic di-GMP phosphodiesterase VC_1348 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
E0X9C7 8.61e-11 65 29 2 123 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain DOT-T1E)
Q4UU85 1.23e-10 63 36 1 91 1 rpfG Cyclic di-GMP phosphodiesterase response regulator RpfG Xanthomonas campestris pv. campestris (strain 8004)
Q56312 2.79e-10 59 27 2 111 1 cheY Chemotaxis protein CheY Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
A5W4E3 3.59e-10 63 28 2 123 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
P24072 3.83e-10 59 28 2 118 1 cheY Chemotaxis protein CheY Bacillus subtilis (strain 168)
P46384 6.89e-10 58 24 2 123 1 pilG Protein PilG Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
O25153 2.55e-09 60 40 1 62 1 cheAY Sensor histidine kinase CheAY Helicobacter pylori (strain ATCC 700392 / 26695)
Q06065 2.6e-09 60 32 1 102 1 atoC Regulatory protein AtoC Escherichia coli (strain K12)
P0AE41 3.25e-09 58 30 4 134 3 ypdB Transcriptional regulatory protein YpdB Shigella flexneri
P0AE39 3.25e-09 58 30 4 134 1 ypdB Transcriptional regulatory protein YpdB Escherichia coli (strain K12)
P0AE40 3.25e-09 58 30 4 134 3 ypdB Transcriptional regulatory protein YpdB Escherichia coli O157:H7
A6X580 3.7e-09 56 31 1 116 3 divK Polar-differentiation response regulator DivK Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
Q8FFE0 4.06e-09 58 31 4 128 3 ypdB Transcriptional regulatory protein YpdB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P71403 4.18e-09 56 26 4 120 1 cheY1 Chemotaxis protein CheY1 Helicobacter pylori (strain ATCC 700392 / 26695)
Q9ZM64 4.23e-09 56 26 4 120 3 cheY1 Chemotaxis protein CheY1 Helicobacter pylori (strain J99 / ATCC 700824)
B0R4K1 5.64e-09 55 28 1 117 1 cheY Chemotaxis protein CheY Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
P41789 6.47e-09 58 28 1 123 1 glnG DNA-binding transcriptional regulator NtrC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P52929 8.92e-09 57 31 4 119 3 spo0A Stage 0 sporulation protein A (Fragment) Brevibacillus parabrevis
P51343 1.78e-08 56 28 1 124 3 ycf29 Probable transcriptional regulator ycf29 Porphyra purpurea
O07528 1.84e-08 56 24 7 199 3 yhcZ Uncharacterized transcriptional regulatory protein YhcZ Bacillus subtilis (strain 168)
Q8FW53 2.23e-08 54 31 1 116 3 divK Polar-differentiation response regulator DivK Brucella suis biovar 1 (strain 1330)
A9WYT1 2.23e-08 54 31 1 116 3 divK Polar-differentiation response regulator DivK Brucella suis (strain ATCC 23445 / NCTC 10510)
A5VUU3 2.23e-08 54 31 1 116 3 divK Polar-differentiation response regulator DivK Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q8YC73 2.23e-08 54 31 1 116 3 divK Polar-differentiation response regulator DivK Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
A9MBQ2 2.23e-08 54 31 1 116 3 divK Polar-differentiation response regulator DivK Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q7BBW0 2.23e-08 54 31 1 116 1 divK Polar-differentiation response regulator DivK Brucella abortus biovar 1 (strain 9-941)
Q2YKN1 2.23e-08 54 31 1 116 3 divK Polar-differentiation response regulator DivK Brucella abortus (strain 2308)
B2SB45 2.23e-08 54 31 1 116 3 divK Polar-differentiation response regulator DivK Brucella abortus (strain S19)
P0AFB8 2.61e-08 57 27 1 123 1 glnG DNA-binding transcriptional regulator NtrC Escherichia coli (strain K12)
P0AFB9 2.61e-08 57 27 1 123 3 glnG DNA-binding transcriptional regulator NtrC Escherichia coli O157:H7
P21649 2.91e-08 56 30 5 129 1 mrkE Protein MrkE Klebsiella pneumoniae
P52940 3.54e-08 56 28 5 153 3 spo0A Stage 0 sporulation protein A homolog Clostridium pasteurianum
Q30RX5 3.69e-08 56 25 7 188 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Sulfurimonas denitrificans (strain ATCC 33889 / DSM 1251)
O29221 4.8e-08 56 34 2 103 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
P06628 6.35e-08 53 28 1 116 1 spo0F Sporulation initiation phosphotransferase F Bacillus subtilis (strain 168)
Q9UYF3 6.5e-08 55 32 4 124 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Pyrococcus abyssi (strain GE5 / Orsay)
P45709 7.15e-08 53 27 2 116 3 ccdB Protein CcdB Bacillus subtilis (strain 168)
P48359 7.97e-08 54 27 3 111 3 ycf29 Probable transcriptional regulator ycf29 Cyanophora paradoxa
Q10WZ6 8.23e-08 55 34 4 105 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Trichodesmium erythraeum (strain IMS101)
Q54YZ9 1e-07 55 31 1 118 3 dhkJ Hybrid signal transduction histidine kinase J Dictyostelium discoideum
Q7A0I0 1.03e-07 54 23 5 184 3 vraR Response regulator protein VraR Staphylococcus aureus (strain MW2)
Q6G850 1.03e-07 54 23 5 184 3 vraR Response regulator protein VraR Staphylococcus aureus (strain MSSA476)
Q6GFH3 1.03e-07 54 23 5 184 3 vraR Response regulator protein VraR Staphylococcus aureus (strain MRSA252)
Q7A4R9 1.03e-07 54 23 5 184 1 vraR Response regulator protein VraR Staphylococcus aureus (strain N315)
Q7A2Q1 1.03e-07 54 23 5 184 1 vraR Response regulator protein VraR Staphylococcus aureus (strain Mu50 / ATCC 700699)
P0C0Z1 1.03e-07 54 23 5 184 3 vraR Response regulator protein VraR Staphylococcus aureus (strain Mu3 / ATCC 700698)
P03029 1.12e-07 55 28 1 121 1 ntrC DNA-binding transcriptional regulator NtrC Klebsiella pneumoniae
O85128 1.28e-07 55 33 3 105 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Agrobacterium fabrum (strain C58 / ATCC 33970)
Q39T95 1.55e-07 54 41 0 58 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
P66797 1.59e-07 53 33 1 83 3 uvrY Response regulator UvrY Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P66798 1.59e-07 53 33 1 83 3 uvrY Response regulator UvrY Escherichia coli O157:H7
P0AED6 1.99e-07 53 33 1 83 3 uvrY Response regulator UvrY Shigella flexneri
P0AED5 1.99e-07 53 33 1 83 1 uvrY Response regulator UvrY Escherichia coli (strain K12)
O58192 2.06e-07 54 32 5 124 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
A1W0A5 2.35e-07 51 24 3 120 3 cheY Chemotaxis protein CheY homolog Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
P0C635 2.35e-07 51 24 3 120 3 cheY Chemotaxis protein CheY homolog Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
A8FMH1 2.35e-07 51 24 3 120 3 cheY Chemotaxis protein CheY homolog Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
P52936 2.71e-07 53 26 5 157 3 spo0A Stage 0 sporulation protein A homolog Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
P52941 2.97e-07 53 27 3 108 3 spo0A Stage 0 sporulation protein A homolog Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
P39486 4.04e-07 52 27 3 112 3 dctR Probable C4-dicarboxylate response regulator DctR Priestia megaterium
Q0AWZ8 4.87e-07 53 31 3 104 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
O05251 4.93e-07 52 31 4 124 3 malR Transcriptional regulatory protein MalR Bacillus subtilis (strain 168)
P58253 5.2e-07 52 26 4 133 3 spo0A Stage 0 sporulation protein A homolog Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q9RC52 5.26e-07 52 37 5 106 3 citT Transcriptional regulatory protein CitT Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
P10577 5.27e-07 53 24 1 128 1 ntrC DNA-binding transcriptional regulator NtrC Rhizobium meliloti (strain 1021)
P51586 5.27e-07 50 30 1 109 3 None Uncharacterized 14.6 kDa protein in sodA1 3'region Leptolyngbya boryana
P45671 6.62e-07 53 24 3 187 3 ntrC DNA-binding transcriptional regulator NtrC Azospirillum brasilense
Q6H805 6.68e-07 53 28 1 102 2 RR24 Two-component response regulator ORR24 Oryza sativa subsp. japonica
A2X1N2 6.68e-07 53 28 1 102 3 RR24 Two-component response regulator ORR24 Oryza sativa subsp. indica
Q82Z76 7.9e-07 52 26 3 113 4 lytT Sensory transduction protein LytT Enterococcus faecalis (strain ATCC 700802 / V583)
Q5L0L0 8.9e-07 52 31 4 108 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Geobacillus kaustophilus (strain HTA426)
Q9KT84 1.39e-06 52 24 3 166 1 luxO Regulatory protein LuxO Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q2LR65 1.46e-06 52 28 8 196 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Syntrophus aciditrophicus (strain SB)
P62640 1.49e-06 52 37 0 58 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
P52942 1.52e-06 49 28 2 109 3 spo0F Sporulation initiation phosphotransferase F Bacillus thuringiensis subsp. kurstaki
P33394 1.52e-06 49 26 3 134 3 rrf1 Protein Rrf1 Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q05522 1.71e-06 51 30 3 104 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Bacillus subtilis (strain 168)
P96686 1.8e-06 50 36 1 75 3 ydfI Transcriptional regulatory protein YdfI Bacillus subtilis (strain 168)
Q1IQS9 1.9e-06 51 28 3 124 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Koribacter versatilis (strain Ellin345)
P18769 1.98e-06 52 29 1 112 1 frzE Gliding motility regulatory protein Myxococcus xanthus
Q65JK6 2.04e-06 51 30 3 104 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q0A9Z5 2.32e-06 51 31 2 106 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q5A4X5 2.47e-06 51 26 1 126 3 SKN7 Transcription factor SKN7 Candida albicans (strain SC5314 / ATCC MYA-2876)
O34534 2.48e-06 50 25 2 152 1 citT Transcriptional regulatory protein CitT Bacillus subtilis (strain 168)
Q1IRH0 2.54e-06 51 28 5 146 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Koribacter versatilis (strain Ellin345)
Q4ZSY3 2.6e-06 51 30 6 123 3 Psyr_2700 Blue-light-activated protein Pseudomonas syringae pv. syringae (strain B728a)
P09432 2.68e-06 51 25 1 121 3 ntrC DNA-binding transcriptional regulator NtrC Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
Q8RAZ3 2.77e-06 50 32 3 104 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q3ADA6 2.94e-06 50 33 3 104 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
P38889 3.04e-06 51 27 1 102 1 SKN7 Transcription factor SKN7 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q7MD16 3.13e-06 51 29 1 108 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio vulnificus (strain YJ016)
Q8D5Z6 3.16e-06 51 29 1 108 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio vulnificus (strain CMCP6)
P45365 3.19e-06 51 28 1 118 3 None Uncharacterized 76.5 kDa protein in phbC 3'region Thiocystis violacea
Q5N6V8 3.21e-06 51 29 1 108 3 RR26 Two-component response regulator ORR26 Oryza sativa subsp. japonica
P37599 3.21e-06 50 32 4 114 1 cheV Chemotaxis protein CheV Bacillus subtilis (strain 168)
Q9ZWJ9 3.3e-06 51 28 1 102 1 ARR2 Two-component response regulator ARR2 Arabidopsis thaliana
P10576 3.35e-06 50 21 2 130 3 ntrC DNA-binding transcriptional regulator NtrC Bradyrhizobium sp. (strain RP501 Parasponia)
A1SMR4 3.71e-06 50 31 5 140 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Nocardioides sp. (strain ATCC BAA-499 / JS614)
Q881J7 3.71e-06 50 30 6 123 1 PSPTO_2896 Blue-light-activated protein Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
A5VW00 3.95e-06 49 27 9 212 3 ftcR Flagellar transcriptional regulator FtcR Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q9KL96 4.13e-06 50 24 2 103 3 VC_A0850 Uncharacterized response regulatory protein VC_A0850 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q8FUS8 4.3e-06 49 27 9 212 3 ftcR Flagellar transcriptional regulator FtcR Brucella suis biovar 1 (strain 1330)
Q8YDL7 4.3e-06 49 27 9 212 1 ftcR Flagellar transcriptional regulator FtcR Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q576I4 4.3e-06 49 27 9 212 3 ftcR Flagellar transcriptional regulator FtcR Brucella abortus biovar 1 (strain 9-941)
Q2YJF8 4.3e-06 49 27 9 212 3 ftcR Flagellar transcriptional regulator FtcR Brucella abortus (strain 2308)
Q04848 4.92e-06 50 21 1 122 3 ntrC DNA-binding transcriptional regulator NtrC Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
P52934 5.12e-06 49 26 7 156 1 spo0A Stage 0 sporulation protein A Geobacillus stearothermophilus
Q12YX1 5.28e-06 50 27 3 110 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Methanococcoides burtonii (strain DSM 6242 / NBRC 107633 / OCM 468 / ACE-M)
Q9APD9 5.62e-06 50 31 1 100 3 zraR Transcriptional regulatory protein ZraR Klebsiella oxytoca
P9WGM3 6.63e-06 48 28 3 121 1 pdtaR Transcriptional regulatory protein PdtaR Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM2 6.63e-06 48 28 3 121 3 pdtaR Transcriptional regulatory protein PdtaR Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q2SFK0 7.13e-06 49 31 3 122 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Hahella chejuensis (strain KCTC 2396)
P52931 7.78e-06 48 27 7 154 3 spo0A Stage 0 sporulation protein A (Fragment) Niallia circulans
P0AEV3 8.45e-06 49 30 1 103 3 rssB Regulator of RpoS Shigella flexneri
P0AEV1 8.45e-06 49 30 1 103 1 rssB Regulator of RpoS Escherichia coli (strain K12)
P0AEV2 8.45e-06 49 30 1 103 3 rssB Regulator of RpoS Escherichia coli O157:H7
Q39WQ9 8.96e-06 49 30 3 113 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
Q2SPQ1 9.01e-06 49 29 2 104 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Hahella chejuensis (strain KCTC 2396)
Q48IV1 9.65e-06 49 30 6 123 3 PSPPH_2483 Blue-light-activated protein Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q2RRX2 1e-05 49 27 6 222 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q6K8X6 1.1e-05 49 25 2 139 2 RR23 Two-component response regulator ORR23 Oryza sativa subsp. japonica
B8AEH1 1.12e-05 49 25 2 139 3 RR23 Two-component response regulator ORR23 Oryza sativa subsp. indica
P25852 1.19e-05 49 31 1 100 1 zraR Transcriptional regulatory protein ZraR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8Z333 1.24e-05 49 31 1 100 3 zraR Transcriptional regulatory protein ZraR Salmonella typhi
Q5SML5 1.27e-05 49 29 3 126 2 RR22 Two-component response regulator ORR22 Oryza sativa subsp. japonica
B8B3I4 1.27e-05 49 29 3 126 3 RR22 Two-component response regulator ORR22 Oryza sativa subsp. indica
Q9FXD6 1.31e-05 49 25 1 118 1 ARR11 Two-component response regulator ARR11 Arabidopsis thaliana
Q7MM78 1.36e-05 48 25 4 166 3 luxO Regulatory protein LuxO Vibrio vulnificus (strain YJ016)
Q8CWJ5 1.36e-05 48 25 4 166 3 luxO Regulatory protein LuxO Vibrio vulnificus (strain CMCP6)
P48027 1.41e-05 49 27 1 135 3 gacS Sensor protein GacS Pseudomonas syringae pv. syringae
B2J4Q8 1.41e-05 48 29 5 139 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
Q87MX7 1.43e-05 48 23 4 166 3 luxO Regulatory protein LuxO Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
P0C5S5 1.47e-05 48 23 4 166 3 luxO Luminescence regulatory protein LuxO Vibrio harveyi
A7MVC2 1.47e-05 48 23 4 166 1 luxO Luminescence regulatory protein LuxO Vibrio campbellii (strain ATCC BAA-1116)
Q5A599 1.72e-05 48 24 1 137 1 NIK1 Histidine protein kinase NIK1 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q1D359 1.78e-05 48 32 0 61 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Myxococcus xanthus (strain DK1622)
P52938 1.83e-05 48 25 4 129 3 spo0A Stage 0 sporulation protein A homolog Clostridioides difficile
Q3SIG0 2.1e-05 48 33 1 65 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Thiobacillus denitrificans (strain ATCC 25259)
P0DMI2 2.11e-05 48 33 3 101 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
B0R4K0 2.11e-05 48 33 3 101 1 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
P28787 2.13e-05 48 22 2 132 3 ntrC DNA-binding transcriptional regulator NtrC Proteus hauseri
Q04849 2.15e-05 48 30 2 107 3 ntrX Nitrogen assimilation regulatory protein NtrX Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
P62646 2.22e-05 48 25 4 127 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q5JF95 2.28e-05 48 32 3 106 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
O83639 2.31e-05 48 33 3 77 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Treponema pallidum (strain Nichols)
Q9F8D7 2.34e-05 48 25 1 135 3 gacS Sensor histidine kinase GacS Pseudomonas protegens (strain DSM 19095 / LMG 27888 / CFBP 6595 / CHA0)
Q7NSI8 2.47e-05 48 34 1 64 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q13SY2 2.55e-05 48 35 1 65 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Paraburkholderia xenovorans (strain LB400)
Q54SK5 2.58e-05 48 26 2 121 3 dhkM Hybrid signal transduction histidine kinase M Dictyostelium discoideum
Q2ILG8 2.92e-05 47 28 1 102 3 cheB6 Protein-glutamate methylesterase/protein-glutamine glutaminase 6 Anaeromyxobacter dehalogenans (strain 2CP-C)
Q9I6V9 3.23e-05 47 28 5 126 1 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q54RP6 3.44e-05 48 27 4 129 3 dhkL Hybrid signal transduction histidine kinase L Dictyostelium discoideum
Q940D0 3.54e-05 48 27 1 102 1 ARR1 Two-component response regulator ARR1 Arabidopsis thaliana
Q8XQ83 3.56e-05 47 33 1 65 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q1BRL2 3.71e-05 47 37 2 66 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Burkholderia orbicola (strain AU 1054)
Q39KQ1 3.8e-05 47 37 2 66 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
P0A2D5 3.89e-05 45 24 2 120 1 cheY Chemotaxis protein CheY Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2D6 3.89e-05 45 24 2 120 3 cheY Chemotaxis protein CheY Salmonella typhi
P62645 4.01e-05 47 33 3 110 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase of group 3 operon Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q2STS8 4.02e-05 47 35 1 65 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q3JY65 4.09e-05 47 35 1 65 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Burkholderia pseudomallei (strain 1710b)
Q62G12 4.09e-05 47 35 1 65 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Burkholderia mallei (strain ATCC 23344)
Q63PS2 4.34e-05 47 37 2 66 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Burkholderia pseudomallei (strain K96243)
Q8D0P1 4.5e-05 45 23 2 126 3 cheY Chemotaxis protein CheY Yersinia pestis
Q51455 4.59e-05 45 23 2 122 3 cheY Chemotaxis protein CheY Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P0DMC5 4.83e-05 47 30 1 102 1 rcsC Sensor histidine kinase RcsC Escherichia coli (strain K12)
Q55169 4.91e-05 45 28 3 124 1 rcp1 Response regulator Rcp1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q7VZ94 5.08e-05 47 37 2 66 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q93P00 5.22e-05 45 23 2 126 3 cheY Chemotaxis protein CheY Yersinia enterocolitica
P52928 5.4e-05 46 24 3 120 3 spo0A Stage 0 sporulation protein A Bacillus anthracis
Q8L9Y3 5.43e-05 47 24 3 138 1 ARR14 Two-component response regulator ARR14 Arabidopsis thaliana
Q7WAA4 5.51e-05 47 37 2 66 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WJE7 5.56e-05 47 37 2 66 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q8EQQ3 5.61e-05 46 25 5 127 3 lytT Sensory transduction protein LytT Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
P58662 5.74e-05 47 30 1 102 3 rcsC Sensor histidine kinase RcsC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q1RAQ1 5.87e-05 47 29 4 106 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Escherichia coli (strain UTI89 / UPEC)
P07330 5.87e-05 47 29 4 106 1 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Escherichia coli (strain K12)
Q0TGV0 5.87e-05 47 29 4 106 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q56128 5.95e-05 47 30 1 102 3 rcsC Sensor histidine kinase RcsC Salmonella typhi
Q8XCF9 6.09e-05 47 29 4 106 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Escherichia coli O157:H7
Q2T8Y5 6.09e-05 47 29 2 104 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
P13632 6.2e-05 47 23 1 110 1 dctD C4-dicarboxylate transport transcriptional regulatory protein DctD Rhizobium meliloti (strain 1021)
Q2L1D1 6.22e-05 47 33 1 65 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Bordetella avium (strain 197N)
Q9KS59 6.3e-05 47 32 3 107 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q83R52 6.32e-05 47 29 4 106 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Shigella flexneri
P04042 6.32e-05 47 29 4 106 1 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q5PMY3 6.32e-05 47 29 4 106 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
P0DOA0 6.4e-05 47 27 4 121 1 cckA Sensor kinase CckA Brucella abortus (strain 2308)
P0AE69 6.41e-05 45 23 2 120 3 cheY Chemotaxis protein CheY Shigella flexneri
P0AE67 6.41e-05 45 23 2 120 1 cheY Chemotaxis protein CheY Escherichia coli (strain K12)
P0AE68 6.41e-05 45 23 2 120 3 cheY Chemotaxis protein CheY Escherichia coli O157:H7
Q3Z2R1 6.49e-05 47 29 4 106 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Shigella sonnei (strain Ss046)
Q8FGP5 6.49e-05 47 29 4 106 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8Z5V2 6.55e-05 47 29 4 106 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Salmonella typhi
P0A4I4 6.63e-05 46 24 3 120 3 spo0A Stage 0 sporulation protein A Bacillus thuringiensis
P0A4I3 6.63e-05 46 24 3 120 3 spo0A Stage 0 sporulation protein A Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q57N81 6.67e-05 47 29 4 106 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Salmonella choleraesuis (strain SC-B67)
Q6LTM2 6.69e-05 47 34 1 72 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Photobacterium profundum (strain SS9)
Q8FGP6 6.93e-05 44 23 2 120 3 cheY Chemotaxis protein CheY Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q322K2 7.17e-05 46 29 4 106 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Shigella boydii serotype 4 (strain Sb227)
P14375 7.25e-05 47 29 1 100 1 zraR Transcriptional regulatory protein ZraR Escherichia coli (strain K12)
Q8D4U6 7.43e-05 46 30 3 100 3 VV2_1193 Uncharacterized response regulatory protein VV2_1193 Vibrio vulnificus (strain CMCP6)
Q86CZ2 7.53e-05 47 23 1 134 1 dhkK Hybrid signal transduction histidine kinase K Dictyostelium discoideum
A0A0H3MDW1 8.02e-05 46 23 1 126 1 chxR Atypical response regulator protein ChxR Chlamydia trachomatis serovar L2 (strain ATCC VR-902B / DSM 19102 / 434/Bu)
P39048 8.25e-05 46 33 1 63 2 patA Protein PatA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q9FAD8 8.33e-05 46 29 4 106 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Enterobacter cloacae
P9WMF9 8.88e-05 45 23 4 168 1 devR DNA-binding transcriptional activator DevR/DosR Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WMF8 8.88e-05 45 23 4 168 2 devR DNA-binding transcriptional activator DevR/DosR Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
O87717 9.21e-05 46 25 4 144 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q3BUA2 9.34e-05 46 30 3 113 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q8PLB4 9.34e-05 46 30 3 113 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Xanthomonas axonopodis pv. citri (strain 306)
P26319 9.99e-05 45 25 4 157 3 fimZ Fimbriae Z protein Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q820K0 0.000101 46 29 2 103 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
P42012 0.000102 45 26 4 125 3 spo0A Stage 0 sporulation protein A Lysinibacillus sphaericus
Q87K77 0.000106 45 29 3 91 3 VPA0021 Uncharacterized response regulatory protein VPA0021 Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q1CI99 0.000108 46 29 4 106 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZFM0 0.000108 46 29 4 106 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Yersinia pestis
Q1C6W3 0.000108 46 29 4 106 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Yersinia pestis bv. Antiqua (strain Antiqua)
Q8X613 0.000108 46 29 1 100 3 zraR Transcriptional regulatory protein ZraR Escherichia coli O157:H7
Q2KCH8 0.000111 46 29 3 105 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q669T5 0.000116 46 29 4 106 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Yersinia pseudotuberculosis serotype I (strain IP32953)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS02985
Feature type CDS
Gene baeR
Product two-component system response regulator BaeR
Location 633283 - 634002 (strand: -1)
Length 720 (nucleotides) / 239 (amino acids)
In genomic island -

Contig

Accession NZ_VXKB01000001
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2223
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00072 Response regulator receiver domain
PF00486 Transcriptional regulatory protein, C terminal

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0745 Signal transduction mechanisms (T)
Transcription (K)
TK DNA-binding response regulator, OmpR family, contains REC and winged-helix (wHTH) domain

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K07664 two-component system, OmpR family, response regulator BaeR Two-component system -

Protein Sequence

MEENAERILIVEDEPKLAQLLMDYLHAAHYRTHWLARGGEVTAWVQENRPDLILLDLMLPEKDGLTLCREIRRFSDVPIMMVTAKTEEIDRLLGLEIGADDYVCKPYSPREVVARIKTILRRCQRNQEPSEDKSDVLIIDEVNYQVRSGEHSLDLTQVEFRLLRTMVSQPGTVLTRNQLLDNLYDDYRVVTDRTIDSHIKNLRRKLEQLDNGRDFIHSVYGLGYRWEGGNTEIITANII

Flanking regions ( +/- flanking 50bp)

GTCACCATCACCCTGGTGCTGCCCCGTTCTGACACCCGGGAGTAACCTGCATGGAAGAGAATGCTGAACGTATCCTGATAGTGGAAGATGAGCCGAAACTGGCTCAGTTACTGATGGATTATCTGCACGCCGCTCACTACCGCACGCACTGGCTGGCGCGCGGCGGTGAAGTGACTGCCTGGGTGCAGGAGAACCGGCCTGATCTTATCCTGCTGGATTTAATGCTGCCGGAGAAAGATGGTCTGACACTCTGTCGTGAAATCCGCCGGTTCAGTGACGTCCCCATTATGATGGTGACGGCAAAAACAGAAGAGATCGACCGCCTGCTGGGGCTCGAAATCGGCGCAGATGATTATGTCTGCAAGCCCTACAGCCCGCGTGAAGTGGTTGCCCGCATCAAGACGATTTTGCGCCGCTGTCAGCGCAATCAGGAGCCATCAGAGGATAAATCTGATGTACTGATTATTGATGAAGTAAATTATCAGGTGCGCAGCGGAGAGCATAGCTTGGATCTGACTCAGGTGGAATTTCGCCTGCTGCGCACTATGGTGTCACAACCGGGCACCGTGCTTACGCGCAATCAATTGTTGGATAATCTGTATGATGATTACCGCGTTGTTACAGACCGCACCATTGACAGCCACATTAAAAACCTGCGCCGGAAGCTGGAACAGTTAGATAACGGACGGGATTTTATACATTCGGTGTATGGACTGGGGTATCGCTGGGAAGGTGGTAATACAGAAATTATTACTGCCAATATTATATAGTTATACCCAACGTCATTCAAGGTGCAGGCAGGTGGCAAGCTCTGACCGCC