Homologs in group_3024

Help

5 homologs were identified in 5 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_17895 FBDBKF_17895 100.0 Morganella morganii S1 grsT Surfactin synthase thioesterase subunit
EHELCC_06440 EHELCC_06440 100.0 Morganella morganii S2 grsT Surfactin synthase thioesterase subunit
NLDBIP_06760 NLDBIP_06760 100.0 Morganella morganii S4 grsT Surfactin synthase thioesterase subunit
LHKJJB_18900 LHKJJB_18900 100.0 Morganella morganii S3 grsT Surfactin synthase thioesterase subunit
PMI_RS12850 PMI_RS12850 100.0 Proteus mirabilis HI4320 - thioesterase domain-containing protein

Distribution of the homologs in the orthogroup group_3024

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_3024

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0DJG9 3.68e-54 178 40 2 230 3 angT Probable anguibactin biosynthesis thioesterase AngT Vibrio anguillarum
Q6W4T2 3.68e-54 178 40 2 230 3 angT Probable anguibactin biosynthesis thioesterase AngT Vibrio anguillarum (strain ATCC 68554 / 775)
Q9ZGI1 1.41e-28 112 30 5 240 1 pikAV Thioesterase PikA5 Streptomyces venezuelae
P08635 2.61e-28 111 30 6 243 1 Olah S-acyl fatty acid synthase thioesterase, medium chain Rattus norvegicus
Q8R197 6.47e-27 108 31 6 222 2 Olah S-acyl fatty acid synthase thioesterase, medium chain Mus musculus
P33586 3.24e-21 94 28 3 216 3 None Probable cadicidin biosynthesis thioesterase Streptomyces griseus
Q9Z5K4 1.21e-20 91 24 4 236 3 tesA Thioesterase TesA Mycobacterium leprae (strain TN)
Q08788 2.06e-20 90 28 11 239 1 srfAD Surfactin synthase thioesterase subunit Bacillus subtilis (strain 168)
P14686 4.4e-17 81 27 6 224 3 grsT Gramicidin S biosynthesis protein GrsT Aneurinibacillus migulanus
P9WQD5 8.11e-17 80 25 9 247 1 tesA Thioesterase TesA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQD4 8.11e-17 80 25 9 247 3 tesA Thioesterase TesA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63461 8.11e-17 80 25 9 247 3 tesA Thioesterase TesA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
B2HIN3 2.39e-16 79 27 6 216 1 tesA Thioesterase TesA Mycobacterium marinum (strain ATCC BAA-535 / M)
Q9NV23 7.34e-16 78 27 6 216 1 OLAH S-acyl fatty acid synthase thioesterase, medium chain Homo sapiens
Q70LM8 1.19e-15 77 26 5 212 1 lgrE Linear gramicidin dehydrogenase LgrE Brevibacillus parabrevis
P00633 1.52e-15 77 25 6 238 2 None S-acyl fatty acid synthase thioesterase, medium chain Anas platyrhynchos
P9WQ63 4.1e-12 69 27 5 215 1 mbtB Phenyloxazoline synthase MbtB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQ62 4.1e-12 69 27 5 215 1 mbtB Phenyloxazoline synthase MbtB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q7TYQ4 4.1e-12 69 27 5 215 3 mbtB Phenyloxazoline synthase MbtB Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q9I1H3 6.54e-06 50 21 6 228 1 ambE AMB antimetabolite synthase AmbE Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)

  • Number of RefSeq hits:

General

Source Morganella morganii S5
Locus tag HKOGLL_04630
Feature type CDS
Gene grsT
Product Surfactin synthase thioesterase subunit
Location 251108 - 251881 (strand: 1)
Length 774 (nucleotides) / 257 (amino acids)
In genomic island GI74

Contig

Accession ZDB_681
Length 269562 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_3024
Orthogroup size 6
N. genomes 6

Actions

Genomic region

Domains

PF00975 Thioesterase domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG3208 Secondary metabolites biosynthesis, transport and catabolism (Q) Q Surfactin synthase thioesterase subunit

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K05374 yersiniabactin synthetase, thioesterase component - -

Virulence factor Annotation(s)

VF gene ID Protein VF ID Category
VFG044302 thioesterase II family protein VF1251 Nutritional/Metabolic factor

Protein Sequence

MIKQSPKYITPLNEQNVNKDNANLLVCPFAGASNSAFNSWRSTDISGLNCQLVNYSGHGCRFKEPAFNDIGLLANELITIIKKFYPPRHNSLLLCGHSMGAQVAFETAIQLEKNGWELSGLILSGCQAPHIQARRLLSDLNDDDFIQQLIAIGGCDAELIKQPQLLKQFMPLLRADFLATERYFFQKSTKRLFHTPVLLMYGSHDSEADKNEVEAWQDWIDKHCTINCIAGDHFYPITRPNTFCRFIIDFYHQFIND

Flanking regions ( +/- flanking 50bp)

GCGCCATTTAAGCGAATGAACTTCACCAAAAGTAGTGGACGGAGAAAATAATGATAAAACAATCTCCCAAATATATTACTCCTTTAAATGAGCAAAATGTAAATAAAGACAATGCTAACCTATTGGTTTGCCCATTTGCTGGTGCCAGTAATAGTGCATTTAACTCGTGGAGATCTACCGATATTTCAGGGTTAAATTGTCAATTAGTTAATTACTCTGGCCATGGTTGCAGATTTAAAGAACCAGCCTTTAATGATATTGGGTTATTAGCCAATGAATTAATAACAATAATAAAGAAATTTTATCCACCACGGCATAATTCATTATTACTTTGCGGTCACAGTATGGGGGCCCAAGTTGCCTTTGAAACTGCTATTCAATTAGAAAAAAATGGCTGGGAATTATCTGGACTAATATTATCAGGCTGCCAAGCTCCTCATATTCAAGCAAGGAGATTACTGAGTGATTTAAATGATGATGACTTTATTCAACAATTAATTGCCATTGGTGGATGTGATGCTGAATTAATCAAGCAGCCACAGTTGTTAAAACAGTTTATGCCATTATTACGTGCTGATTTCCTTGCTACCGAGCGTTATTTTTTTCAAAAAAGCACTAAACGGCTTTTTCATACCCCTGTTTTATTAATGTATGGTAGTCATGATAGTGAAGCTGATAAAAACGAAGTTGAAGCATGGCAAGATTGGATAGATAAGCATTGCACTATTAATTGCATCGCTGGAGATCACTTTTATCCAATTACACGCCCAAATACTTTTTGTCGTTTTATTATTGATTTTTATCACCAATTTATCAATGATTAAATTGATTAGGTAATATATATGAATAAAACAATAGATACTTTGCCACTTAA