Homologs in group_2589

Help

5 homologs were identified in 5 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_02925 FBDBKF_02925 100.0 Morganella morganii S1 prpR propionate catabolism operon regulatory protein PrpR
EHELCC_03395 EHELCC_03395 100.0 Morganella morganii S2 prpR propionate catabolism operon regulatory protein PrpR
NLDBIP_00065 NLDBIP_00065 100.0 Morganella morganii S4 prpR propionate catabolism operon regulatory protein PrpR
LHKJJB_01970 LHKJJB_01970 100.0 Morganella morganii S3 prpR propionate catabolism operon regulatory protein PrpR
F4V73_RS05370 F4V73_RS05370 87.5 Morganella psychrotolerans prpR propionate catabolism operon regulatory protein PrpR

Distribution of the homologs in the orthogroup group_2589

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2589

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P74839 0.0 613 58 4 529 4 prpR Propionate catabolism operon regulatory protein Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P77743 0.0 598 57 3 528 1 prpR Propionate catabolism operon regulatory protein Escherichia coli (strain K12)
P26047 2.3e-73 248 41 6 334 4 stc Signal-transduction and transcriptional-control protein Clostridium beijerinckii
Q00934 8.79e-69 231 38 9 364 1 pilR Response regulator protein PilR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
O85057 1.31e-68 233 42 8 322 1 None Limonene hydroxylase Geobacillus stearothermophilus
P03029 3.54e-68 230 39 10 378 1 ntrC DNA-binding transcriptional regulator NtrC Klebsiella pneumoniae
P28787 1.4e-67 228 38 9 374 3 ntrC DNA-binding transcriptional regulator NtrC Proteus hauseri
P41789 5.22e-67 227 38 7 376 1 glnG DNA-binding transcriptional regulator NtrC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q46802 1.82e-65 226 39 6 334 4 uacR Putative uric acid sigma-54-dependent transcriptional regulator UacR Escherichia coli (strain K12)
P25852 2.27e-65 222 41 9 325 1 zraR Transcriptional regulatory protein ZraR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0AFB8 4.77e-65 222 38 7 376 1 glnG DNA-binding transcriptional regulator NtrC Escherichia coli (strain K12)
P0AFB9 4.77e-65 222 38 7 376 3 glnG DNA-binding transcriptional regulator NtrC Escherichia coli O157:H7
P14375 7.46e-65 220 42 9 325 1 zraR Transcriptional regulatory protein ZraR Escherichia coli (strain K12)
Q06065 1.1e-64 221 38 10 383 1 atoC Regulatory protein AtoC Escherichia coli (strain K12)
Q9APD9 2.89e-64 219 43 9 322 3 zraR Transcriptional regulatory protein ZraR Klebsiella oxytoca
Q8X613 3.42e-64 219 43 9 322 3 zraR Transcriptional regulatory protein ZraR Escherichia coli O157:H7
Q8Z333 1.06e-63 217 41 9 323 3 zraR Transcriptional regulatory protein ZraR Salmonella typhi
Q01265 3.59e-63 211 43 4 250 4 None Uncharacterized protein in HyuA 5'region (Fragment) Pseudomonas sp. (strain NS671)
P17899 2.41e-62 214 41 11 334 4 flbD Transcriptional regulatory protein FlbD Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q04848 4.71e-62 214 40 10 349 3 ntrC DNA-binding transcriptional regulator NtrC Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
O31551 6.03e-62 217 41 8 330 2 acoR Acetoin dehydrogenase operon transcriptional activator AcoR Bacillus subtilis (strain 168)
P0AFU5 2.27e-61 211 45 7 263 1 qseF Transcriptional regulatory protein QseF Escherichia coli O157:H7
P0AFU4 2.27e-61 211 45 7 263 1 glrR Transcriptional regulatory protein GlrR Escherichia coli (strain K12)
P54529 8.4e-61 216 41 3 267 4 yqiR Putative sigma L-dependent transcriptional regulator YqiR Bacillus subtilis (strain 168)
P12626 1.94e-60 211 37 7 349 4 anfA Nitrogen fixation protein AnfA Azotobacter vinelandii
P10576 4.78e-60 209 38 10 349 3 ntrC DNA-binding transcriptional regulator NtrC Bradyrhizobium sp. (strain RP501 Parasponia)
Q3K999 8.5e-60 205 48 4 225 3 sfnR Sigma54-dependent transcriptional regulator SfnR Pseudomonas fluorescens (strain Pf0-1)
P09570 9.31e-60 209 41 5 287 4 nifA Nif-specific regulatory protein Azotobacter vinelandii
P45671 1.85e-59 207 44 8 274 3 ntrC DNA-binding transcriptional regulator NtrC Azospirillum brasilense
P10577 2.07e-59 207 37 10 355 1 ntrC DNA-binding transcriptional regulator NtrC Rhizobium meliloti (strain 1021)
P27713 2.47e-59 208 41 3 265 4 nifA Nif-specific regulatory protein Herbaspirillum seropedicae
P71229 5.57e-59 210 40 8 336 1 hyfR DNA-binding transcriptional activator HyfR Escherichia coli (strain K12)
P0C5S5 1.2e-58 204 36 13 376 3 luxO Luminescence regulatory protein LuxO Vibrio harveyi
A7MVC2 1.2e-58 204 36 13 376 1 luxO Luminescence regulatory protein LuxO Vibrio campbellii (strain ATCC BAA-1116)
P54930 1.65e-58 206 43 5 266 4 nifA Nif-specific regulatory protein Enterobacter agglomerans
Q87MX7 1.88e-58 204 36 12 376 3 luxO Regulatory protein LuxO Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q7MM78 2.42e-58 203 36 11 376 3 luxO Regulatory protein LuxO Vibrio vulnificus (strain YJ016)
Q8CWJ5 2.42e-58 203 36 11 376 3 luxO Regulatory protein LuxO Vibrio vulnificus (strain CMCP6)
P03027 3.95e-58 205 44 5 255 1 nifA Nif-specific regulatory protein Klebsiella pneumoniae
P56266 4.03e-58 204 44 5 255 3 nifA Nif-specific regulatory protein Klebsiella oxytoca
P05407 5.48e-58 206 46 5 246 1 nifA Nif-specific regulatory protein Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
G3XCV0 7.11e-58 203 47 4 243 1 fleQ Transcriptional regulator FleQ Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P12627 8.22e-58 204 37 8 329 1 vnfA Nitrogen fixation protein VnfA Azotobacter vinelandii
Q845S7 8.46e-58 199 47 4 225 2 sfnR Sigma54-dependent transcriptional activator SfnR Pseudomonas putida
P54931 1.54e-57 204 44 3 245 4 nifA Nif-specific regulatory protein Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q9I4N3 2.7e-57 201 43 4 257 1 fleR Response regulator protein FleR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P54929 5.27e-57 204 44 7 269 4 nifA Nif-specific regulatory protein Azospirillum lipoferum
P30667 6.12e-57 204 44 7 269 1 nifA Nif-specific regulatory protein Azospirillum brasilense
P38022 6.31e-57 200 37 9 344 1 rocR Transcriptional activator RocR Bacillus subtilis (strain 168)
Q9KN48 8.81e-57 201 38 10 351 4 vasH Transcriptional regulator VasH Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P37344 1.32e-56 195 37 9 335 1 pspF Psp operon transcriptional activator Escherichia coli (strain K12)
B7MZ04 3.98e-56 199 41 10 318 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O81 (strain ED1a)
B7M9E6 6.81e-56 198 41 10 318 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O8 (strain IAI1)
Q3YYF5 7.17e-56 198 42 8 296 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Shigella sonnei (strain Ss046)
A8ANR6 7.63e-56 198 41 12 327 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q8FEN6 9.87e-56 198 41 10 318 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A8A3I6 1.01e-55 197 42 8 296 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O9:H4 (strain HS)
B7LEC0 1.01e-55 197 42 8 296 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain 55989 / EAEC)
B1IUX0 1.03e-55 197 42 8 296 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P09133 1.03e-55 200 44 4 254 2 nifA Nif-specific regulatory protein Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
B7UHC1 1.06e-55 197 41 10 318 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A4WDR5 1.11e-55 197 40 11 337 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Enterobacter sp. (strain 638)
Q31X73 1.15e-55 197 42 8 296 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Shigella boydii serotype 4 (strain Sb227)
Q53206 1.28e-55 199 45 4 242 4 nifA Nif-specific regulatory protein Sinorhizobium fredii (strain NBRC 101917 / NGR234)
B5Z370 1.59e-55 197 41 11 320 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X854 1.59e-55 197 41 11 320 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O157:H7
Q9KT84 2.17e-55 196 37 7 338 1 luxO Regulatory protein LuxO Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
C0PWN2 2.4e-55 197 42 11 305 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella paratyphi C (strain RKS4594)
Q0TEH1 4.49e-55 196 41 10 318 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q1R7Z1 5.46e-55 196 41 10 318 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain UTI89 / UPEC)
A1AEP9 5.46e-55 196 41 10 318 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O1:K1 / APEC
B7MKH8 5.46e-55 196 41 10 318 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O45:K1 (strain S88 / ExPEC)
B7NSI9 5.87e-55 196 41 8 296 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O7:K1 (strain IAI39 / ExPEC)
Q9K4U8 6.68e-55 196 43 3 245 2 norR2 Nitric oxide reductase transcription regulator NorR2 Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
P37013 7.52e-55 195 42 10 299 1 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain K12)
B1XCN6 7.52e-55 195 42 10 299 2 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain K12 / DH10B)
C4ZYV4 7.52e-55 195 42 10 299 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain K12 / MC4100 / BW2952)
Q32CL9 7.83e-55 195 40 11 320 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Shigella dysenteriae serotype 1 (strain Sd197)
P59402 8.6e-55 195 41 9 298 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Shigella flexneri
Q0T1D4 8.6e-55 195 41 9 298 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Shigella flexneri serotype 5b (strain 8401)
A7ZQD8 9.14e-55 195 41 8 296 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O139:H28 (strain E24377A / ETEC)
A9MFX7 9.24e-55 195 41 10 304 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
P28614 9.49e-55 198 39 6 308 1 acoR Acetoin catabolism regulatory protein Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
B6I695 9.53e-55 195 40 10 318 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain SE11)
Q9HU19 9.84e-55 194 36 8 371 3 dctD C4-dicarboxylate transport transcriptional regulatory protein DctD Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
B5F363 1e-54 195 42 11 305 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella agona (strain SL483)
Q8ZMJ8 1.01e-54 195 42 11 305 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TT16 1.01e-54 195 42 11 305 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella schwarzengrund (strain CVM19633)
B1LQ27 1.02e-54 195 41 10 318 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain SMS-3-5 / SECEC)
B7N6T9 1.51e-54 194 40 10 318 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q8Z4C6 2.36e-54 194 41 11 305 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella typhi
A9N0D7 2.36e-54 194 41 11 305 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B5QV88 2.36e-54 194 41 11 305 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella enteritidis PT4 (strain P125109)
Q57KT4 2.36e-54 194 41 11 305 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella choleraesuis (strain SC-B67)
B5RDG4 2.75e-54 194 41 11 305 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella gallinarum (strain 287/91 / NCTC 13346)
Q5PF20 2.86e-54 194 41 11 305 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella paratyphi A (strain ATCC 9150 / SARB42)
P24426 5.72e-54 189 41 7 269 4 nifA Nif-specific regulatory protein Rhizobium leguminosarum bv. trifolii
B7LW25 8.18e-54 192 41 8 296 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
O87455 8.62e-54 193 43 4 251 1 luxO Regulatory protein LuxO Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
B4TF23 1.06e-53 192 41 11 305 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella heidelberg (strain SL476)
B4T3B0 1.16e-53 192 42 7 279 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella newport (strain SL254)
B5FSZ0 2.53e-53 191 42 12 305 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella dublin (strain CT_02021853)
B5XVA2 1.09e-52 190 38 9 327 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Klebsiella pneumoniae (strain 342)
Q9K4V0 1.22e-52 190 42 3 247 2 norR1 Nitric oxide reductase transcription regulator NorR1 Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
P19323 1.81e-52 192 36 10 361 1 fhlA Formate hydrogenlyase transcriptional activator FhlA Escherichia coli (strain K12)
E1WAA4 3.67e-52 192 36 8 360 3 fhlA Formate hydrogenlyase transcriptional activator Salmonella typhimurium (strain SL1344)
P0CY94 3.93e-52 190 42 5 249 4 nifA1 Nif-specific regulatory protein Rhodobacter capsulatus
D5ARW9 4.05e-52 189 42 5 249 4 nifA1 Nif-specific regulatory protein Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
Q88AQ2 4.06e-52 187 37 10 329 3 algB Alginate biosynthesis transcriptional regulatory protein AlgB Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q6D8R9 9.1e-52 187 36 5 307 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
P06519 1.12e-51 188 42 6 262 4 xylR Transcriptional regulatory protein XylR Pseudomonas putida
P13632 1.32e-51 186 43 5 245 1 dctD C4-dicarboxylate transport transcriptional regulatory protein DctD Rhizobium meliloti (strain 1021)
A8GG93 1.74e-51 186 38 9 314 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Serratia proteamaculans (strain 568)
A4STH5 1.97e-51 186 42 3 248 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Aeromonas salmonicida (strain A449)
P0CL46 2.3e-51 189 36 8 360 1 fhlA Formate hydrogenlyase transcriptional activator Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P23747 2.44e-51 184 39 9 328 1 algB Alginate biosynthesis transcriptional regulatory protein AlgB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q7MFY9 2.64e-51 186 42 6 253 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Vibrio vulnificus (strain YJ016)
A0KEJ0 2.7e-51 186 42 4 249 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
A6TCX4 3.78e-51 186 40 6 278 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
P26316 4.21e-51 180 39 9 321 4 hrpS Pathogenicity locus probable regulatory protein HrpS Pseudomonas savastanoi pv. phaseolicola
Q43965 4.59e-51 186 37 7 331 1 mopR Phenol regulator MopR Acinetobacter guillouiae
Q5E3W8 9.25e-51 184 37 5 302 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q8D4F9 9.57e-51 184 41 6 266 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Vibrio vulnificus (strain CMCP6)
O25408 1.57e-50 181 39 5 257 1 flgR Transcriptional regulatory protein FlgR Helicobacter pylori (strain ATCC 700392 / 26695)
P37931 1.69e-50 178 38 8 319 4 hrpS Pathogenicity locus probable regulatory protein HrpS Pseudomonas syringae pv. syringae
P09828 4.26e-50 183 40 4 267 4 nifA Nif-specific regulatory protein Rhizobium leguminosarum
P29267 1.29e-49 181 38 8 321 3 hoxA Hydrogenase transcriptional regulatory protein HoxA Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
P10046 1.36e-48 177 34 8 332 3 dctD C4-dicarboxylate transport transcriptional regulatory protein DctD Rhizobium leguminosarum
P31908 2.22e-48 177 40 8 305 3 hoxA Hydrogenase transcriptional regulatory protein HoxA Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q9ZIB7 2.76e-48 178 40 3 243 1 tyrR HTH-type transcriptional regulatory protein TyrR Enterobacter agglomerans
Q88RJ6 3.09e-48 176 36 11 338 3 algB Alginate biosynthesis transcriptional regulatory protein AlgB Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
P37930 1.15e-47 171 39 7 299 4 hrpR Pathogenicity locus probable regulatory protein HrpR Pseudomonas syringae pv. syringae
Q04849 3.81e-46 171 33 9 361 3 ntrX Nitrogen assimilation regulatory protein NtrX Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
P03028 2.31e-44 167 37 8 319 4 nifA Nif-specific regulatory protein Rhizobium meliloti (strain 1021)
O54426 6.84e-43 163 40 5 242 3 tyrR HTH-type transcriptional regulatory protein TyrR Citrobacter braakii
P0A2D7 7.82e-43 163 39 4 251 3 tyrR HTH-type transcriptional regulatory protein TyrR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2D8 7.82e-43 163 39 4 251 3 tyrR HTH-type transcriptional regulatory protein TyrR Salmonella typhi
P07604 8.72e-43 162 38 4 251 1 tyrR HTH-type transcriptional regulatory protein TyrR Escherichia coli (strain K12)
P36219 1.08e-42 158 42 4 219 4 wtsA Pathogenicity locus probable regulatory protein WtsA Pantoea stewartii subsp. stewartii
P44694 5.03e-40 150 34 7 318 1 tyrR HTH-type transcriptional regulatory protein TyrR Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9ZCY9 1.65e-33 136 29 7 282 3 RP562 Putative response regulator NtrX-like Rickettsia prowazekii (strain Madrid E)
Q4UL27 7.52e-33 134 29 7 282 3 RF_0895 Putative response regulator NtrX-like Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q1RJS1 3.78e-32 132 26 11 374 3 RBE_0312 Putative response regulator NtrX-like Rickettsia bellii (strain RML369-C)
Q68WH4 5.62e-32 132 29 6 282 3 RT0550 Putative response regulator NtrX-like Rickettsia typhi (strain ATCC VR-144 / Wilmington)
P26408 6.72e-31 129 31 9 322 1 hupR1 Hydrogenase transcriptional regulatory protein HupR1 Rhodobacter capsulatus
P45512 8.5e-29 124 32 15 344 4 dhaR Glycerol metabolism operon regulatory protein Citrobacter freundii
P76016 5.39e-28 121 31 12 342 1 dhaR PTS-dependent dihydroxyacetone kinase operon regulatory protein Escherichia coli (strain K12)
Q92HC2 4.58e-27 117 29 7 282 3 RC0849 Putative response regulator NtrX-like Rickettsia conorii (strain ATCC VR-613 / Malish 7)
P54156 6.69e-27 114 33 8 255 2 yplP Putative sigma L-dependent transcriptional regulator YplP Bacillus subtilis (strain 168)
P38035 8.73e-26 114 37 2 169 4 rtcR Transcriptional regulatory protein RtcR Escherichia coli (strain K12)
P55610 1.17e-19 96 25 16 510 4 NGR_a02110 Putative transcriptional regulatory protein y4pA Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P09432 1.53e-19 95 31 9 247 3 ntrC DNA-binding transcriptional regulator NtrC Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
D0ZLR9 2e-12 73 36 5 130 2 dgaR Transcriptional regulatory protein DagR Salmonella typhimurium (strain 14028s / SGSC 2262)
P23914 3.05e-11 70 29 6 166 3 levR Transcriptional regulatory protein LevR Bacillus subtilis (strain 168)
P06184 5.9e-06 52 23 9 323 3 pgtA Phosphoglycerate transport system transcriptional regulatory protein PgtA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P42425 0.000227 47 28 5 145 1 lon2 Lon protease 2 Bacillus subtilis (strain 168)

  • Number of RefSeq hits:

General

Source Morganella morganii S5
Locus tag HKOGLL_02010
Feature type CDS
Gene prpR
Product propionate catabolism operon regulatory protein PrpR
Location 384528 - 386141 (strand: -1)
Length 1614 (nucleotides) / 537 (amino acids)

Contig

Accession ZDB_679
Length 398279 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2589
Orthogroup size 6
N. genomes 6

Actions

Genomic region

Domains

PF00158 Sigma-54 interaction domain
PF02954 Bacterial regulatory protein, Fis family
PF06506 Propionate catabolism activator

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG3829 Transcription (K)
Signal transduction mechanisms (T)		 KT RocR-type transcriptional regulator, contains PAS, AAA-type ATPase, and DNA-binding Fis domains

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K02688 transcriptional regulator, propionate catabolism operon regulatory protein - -

Protein Sequence

MAQSDKPVIWTVSISRLFTLFRDISPEFSARAGISAINLGFDAAVEAIRERLKTERCDAIVSAGSNGAYLKQHLPVPVIVAAPGGFDIMQALARARQLSQRIGLIYYRNTFPALDSLAQSFGMQIEQRSYVTAEDARAACLALKADGISVVVGAGLITDIAAECGMTCIFIYSNDAVRRAFTDAIELTRIRDQPQNMPLPVAGSLNVRHTLNDILGTSPVMEQVRETITLFGRSKATVMIQGESGTGKEMAAQAIHHEYTLFHKHKRTKRAAPFVAVNCGAIPESLLEAELFGYEEGAFTGSRRGGRAGLFEAADGGTLFLDEIGEMPVSLQTRLLRVLEDRAIVRIGGYKPITVDVRVICATHNDLDNRVAAGTFRADLFYRLGVLRLQLPALRDRGADILLLTEKLLKLAFAELDLPLHRGHLQQILACSDFFYHYRWPGNARELRNLMERVALYCSAYPDKIITESLLLKLSPERRTVIAPAPVTDLPPEPVNTATATEAVARFRGDRRAAADWLGISRTTLWRRLKQEQNTSS

Flanking regions ( +/- flanking 50bp)

CATGAAATTAATATGAAACATTTGAAACGCATGAAACGGGGGAGAAACGCATGGCTCAGAGTGACAAACCGGTGATCTGGACGGTCTCCATTTCACGCCTTTTTACCCTGTTCCGTGACATCAGCCCGGAATTCAGTGCCCGTGCCGGTATCAGTGCGATTAATCTGGGGTTCGATGCCGCAGTGGAGGCGATTCGTGAACGGCTCAAAACAGAACGCTGTGATGCGATTGTCAGTGCGGGCTCTAACGGCGCGTATCTGAAACAGCATCTGCCGGTGCCGGTGATTGTCGCCGCGCCGGGCGGGTTCGACATCATGCAGGCTTTGGCGCGGGCACGGCAGCTCAGTCAGCGCATCGGCCTCATTTATTACCGCAATACTTTTCCGGCTCTGGATTCGCTGGCGCAGAGTTTCGGCATGCAGATTGAACAGCGCAGTTATGTGACCGCCGAAGATGCAAGGGCGGCCTGTCTTGCCCTGAAAGCGGACGGCATTTCGGTGGTGGTGGGCGCGGGCCTGATTACCGATATCGCCGCAGAGTGCGGCATGACCTGCATTTTCATTTATTCCAATGATGCCGTCCGCCGGGCATTCACCGATGCAATAGAACTGACGCGCATCCGCGACCAGCCGCAGAACATGCCTTTGCCGGTGGCGGGCTCTCTGAATGTCCGCCATACGCTGAATGATATTCTCGGCACCTCGCCGGTGATGGAACAGGTGCGTGAAACCATCACGCTGTTCGGGCGCTCGAAAGCGACAGTGATGATCCAGGGGGAAAGCGGTACCGGTAAAGAGATGGCGGCACAAGCTATTCATCATGAATATACGTTGTTTCATAAACATAAGCGGACAAAACGCGCTGCACCGTTTGTGGCGGTGAACTGCGGGGCTATCCCGGAGAGCCTGCTGGAAGCGGAACTCTTTGGTTATGAGGAGGGCGCATTTACCGGTTCGCGGCGCGGCGGCCGTGCCGGGTTATTTGAGGCGGCGGACGGCGGCACACTGTTTCTGGATGAAATCGGCGAAATGCCGGTATCGCTGCAAACCCGCCTGCTGCGGGTACTGGAAGACCGCGCCATTGTACGTATCGGCGGCTATAAACCGATTACTGTGGATGTGCGGGTGATTTGTGCGACTCACAATGATCTGGATAACCGGGTGGCGGCGGGTACATTCCGCGCGGATCTGTTTTACCGGCTGGGGGTGCTGCGTTTACAGCTTCCGGCACTGCGCGACCGGGGGGCGGATATCCTGTTACTGACAGAAAAACTGCTCAAACTGGCGTTTGCTGAGCTGGATCTGCCGCTGCATCGTGGCCATTTACAACAGATTCTGGCATGCAGTGACTTTTTCTATCACTACCGCTGGCCGGGAAATGCCCGCGAGCTGCGTAATCTGATGGAACGGGTGGCGCTGTATTGCAGTGCTTATCCGGATAAAATTATTACAGAATCATTATTACTGAAACTCTCTCCTGAACGGCGCACGGTGATTGCTCCTGCCCCTGTGACCGACCTCCCGCCGGAGCCGGTGAACACCGCCACGGCAACAGAAGCGGTAGCCCGTTTCCGGGGCGATCGCCGCGCCGCCGCCGACTGGCTGGGGATCAGCCGCACCACCTTATGGCGCCGTCTGAAACAGGAACAGAACACTTCATCCTGACTGCCCGCCGCTTTATACTGTGCCTCAGAATTGAAAAGCAAGAGCCGGAG