Homologs in group_2589

Help

5 homologs were identified in 5 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_02925 FBDBKF_02925 87.5 Morganella morganii S1 prpR propionate catabolism operon regulatory protein PrpR
EHELCC_03395 EHELCC_03395 87.5 Morganella morganii S2 prpR propionate catabolism operon regulatory protein PrpR
NLDBIP_00065 NLDBIP_00065 87.5 Morganella morganii S4 prpR propionate catabolism operon regulatory protein PrpR
LHKJJB_01970 LHKJJB_01970 87.5 Morganella morganii S3 prpR propionate catabolism operon regulatory protein PrpR
HKOGLL_02010 HKOGLL_02010 87.5 Morganella morganii S5 prpR propionate catabolism operon regulatory protein PrpR

Distribution of the homologs in the orthogroup group_2589

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2589

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P74839 0.0 607 57 3 528 4 prpR Propionate catabolism operon regulatory protein Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P77743 0.0 590 56 5 532 1 prpR Propionate catabolism operon regulatory protein Escherichia coli (strain K12)
P26047 1.56e-76 256 41 5 334 4 stc Signal-transduction and transcriptional-control protein Clostridium beijerinckii
P03029 2.73e-69 233 41 10 371 1 ntrC DNA-binding transcriptional regulator NtrC Klebsiella pneumoniae
Q46802 3.37e-69 236 41 6 334 4 uacR Putative uric acid sigma-54-dependent transcriptional regulator UacR Escherichia coli (strain K12)
Q00934 6.23e-68 228 39 9 364 1 pilR Response regulator protein PilR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P0AFB8 8.09e-68 229 42 8 340 1 glnG DNA-binding transcriptional regulator NtrC Escherichia coli (strain K12)
P0AFB9 8.09e-68 229 42 8 340 3 glnG DNA-binding transcriptional regulator NtrC Escherichia coli O157:H7
P41789 9.38e-68 229 41 8 351 1 glnG DNA-binding transcriptional regulator NtrC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
O31551 2.08e-66 229 42 6 327 2 acoR Acetoin dehydrogenase operon transcriptional activator AcoR Bacillus subtilis (strain 168)
P28787 5.27e-66 224 37 10 373 3 ntrC DNA-binding transcriptional regulator NtrC Proteus hauseri
O85057 4.95e-65 224 41 5 312 1 None Limonene hydroxylase Geobacillus stearothermophilus
Q06065 5.58e-65 221 40 10 375 1 atoC Regulatory protein AtoC Escherichia coli (strain K12)
Q01265 3.3e-64 214 44 4 250 4 None Uncharacterized protein in HyuA 5'region (Fragment) Pseudomonas sp. (strain NS671)
P25852 1.44e-63 217 42 10 325 1 zraR Transcriptional regulatory protein ZraR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P14375 2.56e-63 216 43 9 320 1 zraR Transcriptional regulatory protein ZraR Escherichia coli (strain K12)
P0AFU5 1.86e-62 214 41 12 336 1 qseF Transcriptional regulatory protein QseF Escherichia coli O157:H7
P0AFU4 1.86e-62 214 41 12 336 1 glrR Transcriptional regulatory protein GlrR Escherichia coli (strain K12)
Q8Z333 2.27e-62 214 41 9 325 3 zraR Transcriptional regulatory protein ZraR Salmonella typhi
Q8X613 2.68e-62 214 42 9 320 3 zraR Transcriptional regulatory protein ZraR Escherichia coli O157:H7
P12626 2.86e-62 216 38 8 336 4 anfA Nitrogen fixation protein AnfA Azotobacter vinelandii
Q04848 1.09e-60 210 39 10 353 3 ntrC DNA-binding transcriptional regulator NtrC Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
P17899 1.53e-60 209 40 8 329 4 flbD Transcriptional regulatory protein FlbD Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
P54529 2.05e-60 214 36 6 338 4 yqiR Putative sigma L-dependent transcriptional regulator YqiR Bacillus subtilis (strain 168)
Q9APD9 3.85e-60 208 42 10 324 3 zraR Transcriptional regulatory protein ZraR Klebsiella oxytoca
Q7MM78 3.93e-60 208 38 13 380 3 luxO Regulatory protein LuxO Vibrio vulnificus (strain YJ016)
Q8CWJ5 3.93e-60 208 38 13 380 3 luxO Regulatory protein LuxO Vibrio vulnificus (strain CMCP6)
P27713 7.67e-60 209 38 6 314 4 nifA Nif-specific regulatory protein Herbaspirillum seropedicae
P71229 1.08e-59 212 41 9 337 1 hyfR DNA-binding transcriptional activator HyfR Escherichia coli (strain K12)
P0C5S5 2.79e-59 206 39 9 329 3 luxO Luminescence regulatory protein LuxO Vibrio harveyi
A7MVC2 2.79e-59 206 39 9 329 1 luxO Luminescence regulatory protein LuxO Vibrio campbellii (strain ATCC BAA-1116)
G3XCV0 3e-59 207 48 4 243 1 fleQ Transcriptional regulator FleQ Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P45671 3.45e-59 206 38 10 346 3 ntrC DNA-binding transcriptional regulator NtrC Azospirillum brasilense
P10577 3.54e-59 206 38 12 358 1 ntrC DNA-binding transcriptional regulator NtrC Rhizobium meliloti (strain 1021)
Q845S7 4.58e-59 203 47 4 227 2 sfnR Sigma54-dependent transcriptional activator SfnR Pseudomonas putida
Q3K999 8.92e-59 202 47 4 227 3 sfnR Sigma54-dependent transcriptional regulator SfnR Pseudomonas fluorescens (strain Pf0-1)
P54931 1.04e-58 207 46 4 249 4 nifA Nif-specific regulatory protein Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
P10576 1.3e-58 205 38 10 351 3 ntrC DNA-binding transcriptional regulator NtrC Bradyrhizobium sp. (strain RP501 Parasponia)
Q9KT84 1.43e-58 204 38 12 375 1 luxO Regulatory protein LuxO Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q87MX7 1.84e-58 204 40 11 339 3 luxO Regulatory protein LuxO Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
P54930 2.01e-58 205 44 6 267 4 nifA Nif-specific regulatory protein Enterobacter agglomerans
P09570 2.89e-58 205 45 5 260 4 nifA Nif-specific regulatory protein Azotobacter vinelandii
P37344 4.98e-58 199 42 6 261 1 pspF Psp operon transcriptional activator Escherichia coli (strain K12)
O87455 6.54e-58 204 45 4 251 1 luxO Regulatory protein LuxO Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q9KN48 1.15e-57 204 38 10 351 4 vasH Transcriptional regulator VasH Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P54929 2.02e-57 205 44 7 269 4 nifA Nif-specific regulatory protein Azospirillum lipoferum
P30667 2.84e-57 204 45 7 269 1 nifA Nif-specific regulatory protein Azospirillum brasilense
P03027 3.38e-57 202 43 6 272 1 nifA Nif-specific regulatory protein Klebsiella pneumoniae
P56266 3.56e-57 202 43 6 272 3 nifA Nif-specific regulatory protein Klebsiella oxytoca
P12627 4.65e-57 202 43 3 244 1 vnfA Nitrogen fixation protein VnfA Azotobacter vinelandii
P38022 9.46e-57 199 38 9 341 1 rocR Transcriptional activator RocR Bacillus subtilis (strain 168)
Q9I4N3 1.11e-56 199 47 3 231 1 fleR Response regulator protein FleR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P05407 3.33e-56 201 46 5 244 1 nifA Nif-specific regulatory protein Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q53206 4.08e-56 201 45 3 245 4 nifA Nif-specific regulatory protein Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q9HU19 4.13e-56 197 37 8 362 3 dctD C4-dicarboxylate transport transcriptional regulatory protein DctD Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A6TCX4 5.48e-56 199 42 7 287 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B5XVA2 8.11e-56 198 41 7 300 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Klebsiella pneumoniae (strain 342)
P09133 2.83e-55 199 44 4 254 2 nifA Nif-specific regulatory protein Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q88AQ2 1.73e-54 193 40 9 327 3 algB Alginate biosynthesis transcriptional regulatory protein AlgB Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
P24426 2.73e-54 190 41 6 264 4 nifA Nif-specific regulatory protein Rhizobium leguminosarum bv. trifolii
Q9K4U8 3.02e-54 194 44 4 247 2 norR2 Nitric oxide reductase transcription regulator NorR2 Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
A4STH5 7.07e-54 193 44 4 252 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Aeromonas salmonicida (strain A449)
Q6D8R9 7.43e-54 193 37 6 324 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A0KEJ0 8e-54 192 45 4 248 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q7MFY9 1.99e-53 192 43 5 252 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Vibrio vulnificus (strain YJ016)
P28614 2.13e-53 195 38 8 313 1 acoR Acetoin catabolism regulatory protein Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
C0PWN2 3.74e-53 191 43 6 272 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella paratyphi C (strain RKS4594)
A9MFX7 4.83e-53 191 43 6 272 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
A8ANR6 5.99e-53 190 43 6 272 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
P19323 6.2e-53 194 39 9 333 1 fhlA Formate hydrogenlyase transcriptional activator FhlA Escherichia coli (strain K12)
B5FSZ0 6.25e-53 190 43 7 283 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella dublin (strain CT_02021853)
Q8D4F9 6.62e-53 190 43 5 252 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Vibrio vulnificus (strain CMCP6)
A8GG93 8.67e-53 190 42 6 268 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Serratia proteamaculans (strain 568)
B5F363 1.31e-52 189 43 6 272 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella agona (strain SL483)
Q8ZMJ8 1.59e-52 189 43 6 272 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TT16 1.59e-52 189 43 6 272 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella schwarzengrund (strain CVM19633)
E1WAA4 2.25e-52 192 39 12 336 3 fhlA Formate hydrogenlyase transcriptional activator Salmonella typhimurium (strain SL1344)
Q9K4V0 2.43e-52 189 43 3 247 2 norR1 Nitric oxide reductase transcription regulator NorR1 Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q3YYF5 2.71e-52 188 43 5 263 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Shigella sonnei (strain Ss046)
Q8Z4C6 3.03e-52 188 43 6 272 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella typhi
A9N0D7 3.03e-52 188 43 6 272 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B5QV88 3.03e-52 188 43 6 272 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella enteritidis PT4 (strain P125109)
Q57KT4 3.03e-52 188 43 6 272 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella choleraesuis (strain SC-B67)
B7LEC0 3.07e-52 188 43 5 263 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain 55989 / EAEC)
B1IUX0 3.16e-52 188 43 5 263 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
B5RDG4 3.32e-52 188 43 6 272 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella gallinarum (strain 287/91 / NCTC 13346)
Q5PF20 3.36e-52 188 43 6 272 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q31X73 3.5e-52 188 43 5 263 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Shigella boydii serotype 4 (strain Sb227)
B7M9E6 3.5e-52 188 43 5 263 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O8 (strain IAI1)
P29267 3.56e-52 187 39 10 326 3 hoxA Hydrogenase transcriptional regulatory protein HoxA Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
A8A3I6 3.65e-52 188 43 5 263 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O9:H4 (strain HS)
P0CL46 4.14e-52 191 39 11 336 1 fhlA Formate hydrogenlyase transcriptional activator Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4T3B0 4.38e-52 188 43 5 269 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella newport (strain SL254)
Q88RJ6 5.36e-52 186 39 9 327 3 algB Alginate biosynthesis transcriptional regulatory protein AlgB Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A4WDR5 6.68e-52 187 41 7 287 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Enterobacter sp. (strain 638)
B1LQ27 1.03e-51 187 42 5 263 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain SMS-3-5 / SECEC)
B4TF23 1.2e-51 187 42 6 272 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella heidelberg (strain SL476)
O25408 1.26e-51 184 33 8 364 1 flgR Transcriptional regulatory protein FlgR Helicobacter pylori (strain ATCC 700392 / 26695)
Q0TEH1 1.78e-51 186 42 5 263 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B7N6T9 1.84e-51 186 42 5 263 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q8FEN6 2.1e-51 186 42 5 263 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
B7UHC1 2.1e-51 186 42 5 263 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O127:H6 (strain E2348/69 / EPEC)
P09828 2.13e-51 186 42 5 268 4 nifA Nif-specific regulatory protein Rhizobium leguminosarum
B7MZ04 2.17e-51 186 42 5 263 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O81 (strain ED1a)
P13632 2.18e-51 185 37 6 320 1 dctD C4-dicarboxylate transport transcriptional regulatory protein DctD Rhizobium meliloti (strain 1021)
Q1R7Z1 2.26e-51 186 42 5 263 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain UTI89 / UPEC)
A1AEP9 2.26e-51 186 42 5 263 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O1:K1 / APEC
B7MKH8 2.26e-51 186 42 5 263 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O45:K1 (strain S88 / ExPEC)
B7NSI9 2.5e-51 186 43 5 258 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O7:K1 (strain IAI39 / ExPEC)
A7ZQD8 2.66e-51 186 42 5 263 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O139:H28 (strain E24377A / ETEC)
P59402 2.83e-51 186 43 6 260 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Shigella flexneri
Q0T1D4 2.83e-51 186 43 6 260 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Shigella flexneri serotype 5b (strain 8401)
B5Z370 2.92e-51 186 43 6 260 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X854 2.92e-51 186 43 6 260 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O157:H7
P37931 3.22e-51 180 40 6 296 4 hrpS Pathogenicity locus probable regulatory protein HrpS Pseudomonas syringae pv. syringae
Q32CL9 3.47e-51 186 43 6 260 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Shigella dysenteriae serotype 1 (strain Sd197)
P06519 4.07e-51 187 38 10 338 4 xylR Transcriptional regulatory protein XylR Pseudomonas putida
P37013 4.67e-51 185 43 6 260 1 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain K12)
B1XCN6 4.67e-51 185 43 6 260 2 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain K12 / DH10B)
C4ZYV4 4.67e-51 185 43 6 260 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain K12 / MC4100 / BW2952)
B6I695 5.12e-51 185 42 5 263 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain SE11)
B7LW25 5.97e-51 185 42 5 263 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q43965 8.97e-51 186 37 7 331 1 mopR Phenol regulator MopR Acinetobacter guillouiae
P23747 1.62e-50 182 38 9 317 1 algB Alginate biosynthesis transcriptional regulatory protein AlgB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
D5ARW9 5.54e-50 184 41 5 249 4 nifA1 Nif-specific regulatory protein Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
P26316 5.6e-50 177 40 8 304 4 hrpS Pathogenicity locus probable regulatory protein HrpS Pseudomonas savastanoi pv. phaseolicola
P0CY94 5.77e-50 184 41 5 249 4 nifA1 Nif-specific regulatory protein Rhodobacter capsulatus
P31908 6.91e-50 181 34 11 419 3 hoxA Hydrogenase transcriptional regulatory protein HoxA Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q5E3W8 8.61e-49 179 38 6 281 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q9ZIB7 6.89e-48 177 40 3 243 1 tyrR HTH-type transcriptional regulatory protein TyrR Enterobacter agglomerans
P10046 8.6e-48 175 36 9 325 3 dctD C4-dicarboxylate transport transcriptional regulatory protein DctD Rhizobium leguminosarum
P37930 8.81e-48 171 38 7 304 4 hrpR Pathogenicity locus probable regulatory protein HrpR Pseudomonas syringae pv. syringae
P03028 1.47e-45 171 42 6 263 4 nifA Nif-specific regulatory protein Rhizobium meliloti (strain 1021)
P36219 5.05e-44 161 37 6 293 4 wtsA Pathogenicity locus probable regulatory protein WtsA Pantoea stewartii subsp. stewartii
Q04849 3.17e-43 162 33 8 355 3 ntrX Nitrogen assimilation regulatory protein NtrX Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
O54426 8.46e-43 163 39 4 248 3 tyrR HTH-type transcriptional regulatory protein TyrR Citrobacter braakii
P0A2D7 1.83e-42 162 40 5 249 3 tyrR HTH-type transcriptional regulatory protein TyrR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2D8 1.83e-42 162 40 5 249 3 tyrR HTH-type transcriptional regulatory protein TyrR Salmonella typhi
P44694 2.57e-41 154 34 7 318 1 tyrR HTH-type transcriptional regulatory protein TyrR Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P07604 5.7e-41 157 38 4 248 1 tyrR HTH-type transcriptional regulatory protein TyrR Escherichia coli (strain K12)
Q4UL27 4.7e-34 137 26 10 370 3 RF_0895 Putative response regulator NtrX-like Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
P26408 5.14e-34 137 32 8 321 1 hupR1 Hydrogenase transcriptional regulatory protein HupR1 Rhodobacter capsulatus
Q1RJS1 2.48e-33 135 26 9 372 3 RBE_0312 Putative response regulator NtrX-like Rickettsia bellii (strain RML369-C)
Q68WH4 2.87e-33 135 26 9 370 3 RT0550 Putative response regulator NtrX-like Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q9ZCY9 4.57e-33 135 26 10 370 3 RP562 Putative response regulator NtrX-like Rickettsia prowazekii (strain Madrid E)
P45512 9.23e-32 133 31 13 374 4 dhaR Glycerol metabolism operon regulatory protein Citrobacter freundii
P76016 3.02e-28 122 31 8 311 1 dhaR PTS-dependent dihydroxyacetone kinase operon regulatory protein Escherichia coli (strain K12)
Q92HC2 3.68e-28 120 26 10 370 3 RC0849 Putative response regulator NtrX-like Rickettsia conorii (strain ATCC VR-613 / Malish 7)
P54156 8.13e-28 117 34 9 255 2 yplP Putative sigma L-dependent transcriptional regulator YplP Bacillus subtilis (strain 168)
P38035 6.53e-27 117 33 4 232 4 rtcR Transcriptional regulatory protein RtcR Escherichia coli (strain K12)
P09432 3.01e-21 100 31 9 247 3 ntrC DNA-binding transcriptional regulator NtrC Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
P55610 2.19e-17 89 29 9 323 4 NGR_a02110 Putative transcriptional regulatory protein y4pA Sinorhizobium fredii (strain NBRC 101917 / NGR234)
D0ZLR9 1.59e-12 73 36 5 130 2 dgaR Transcriptional regulatory protein DagR Salmonella typhimurium (strain 14028s / SGSC 2262)
P23914 4.55e-12 72 32 7 165 3 levR Transcriptional regulatory protein LevR Bacillus subtilis (strain 168)
P06184 6.83e-06 52 24 10 324 3 pgtA Phosphoglycerate transport system transcriptional regulatory protein PgtA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS05370
Feature type CDS
Gene prpR
Product propionate catabolism operon regulatory protein PrpR
Location 1138799 - 1140409 (strand: -1)
Length 1611 (nucleotides) / 536 (amino acids)

Contig

Accession term accessions NZ_VXKB01000001 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2589
Orthogroup size 6
N. genomes 6

Actions

Genomic region

Domains

PF00158 Sigma-54 interaction domain
PF02954 Bacterial regulatory protein, Fis family
PF06506 Propionate catabolism activator

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG3829 Transcription (K)
Signal transduction mechanisms (T)		 KT RocR-type transcriptional regulator, contains PAS, AAA-type ATPase, and DNA-binding Fis domains

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K02688 transcriptional regulator, propionate catabolism operon regulatory protein - -

Protein Sequence

MTQSDKPVIWTVSISRLFTQFRDISPEFSARATISAINLGFDAAVDAIRERLKTQSCDVIVSAGSNGAYLKQHLPVPVIIAAPGGFDVMQALVQARQISDRIGLVYYRDTFPALESLAQSFGMQIEQRSYITAEDARAACHALKAAGITVVVGAGLITDIAAECGMTGIFIYSNDAVRRAFTDAIELTRIRHQPQSFPLPVAGSLSIRHTINDILGTSGVMEQVRETITLFARSKATVMIQGESGTGKEMAAQAIHHEYTLFRTHKRTKRSAPFVAVNCGAIPESLLEAELFGYEEGAFTGSRRGGRAGLFEAADGGTLFLDEIGEMPLSLQTRLLRVLEDRAIVRIGGYKPITVDVRVICATHGDLDRWVTEGRFRADLFYRLGVLRLQLPALRERDADILLLAEKLLKLAFAELDLPLHRGHLQQILAYSPFFYQYRWPGNARELRNLMERVALYCSAYPDKIITESLLMQLSPERRAERQPADIFPVTAEPAITATAAEAIVRFRGDRQAAADWLGISRTTLWRRLKQERAAS

Flanking regions ( +/- flanking 50bp)

ACATATGAAACACTTGAAACGAATGAAACATCTGAAACAGGAGCAGACTGATGACGCAAAGCGACAAACCGGTGATCTGGACTGTTTCCATCTCCCGCCTGTTTACCCAGTTTCGCGATATCAGCCCGGAATTCAGCGCCCGCGCCACTATCAGTGCTATCAACCTCGGATTTGATGCGGCGGTTGATGCCATCCGCGAGCGGCTGAAAACGCAGAGCTGTGATGTGATTGTCAGTGCCGGATCAAATGGTGCATATCTGAAGCAGCATTTACCGGTGCCGGTGATTATCGCCGCTCCCGGCGGGTTTGATGTGATGCAGGCACTGGTTCAGGCGCGTCAAATCAGTGATCGCATTGGTCTTGTCTATTACCGGGATACCTTTCCGGCACTGGAATCGCTGGCGCAGAGTTTCGGGATGCAGATTGAGCAGCGCAGTTACATCACTGCTGAAGATGCACGCGCAGCGTGTCATGCACTGAAAGCGGCGGGGATCACCGTTGTGGTGGGTGCCGGGCTGATTACAGATATTGCGGCTGAGTGCGGAATGACCGGTATTTTCATTTATTCTAATGATGCTGTCCGCCGGGCATTCACGGACGCAATAGAATTAACGCGGATCCGCCACCAGCCACAAAGCTTCCCGCTGCCGGTTGCCGGCTCGCTGAGTATTCGTCATACCATTAATGATATTCTGGGTACATCCGGGGTCATGGAACAGGTCCGCGAGACAATCACACTGTTTGCCCGTTCAAAAGCAACGGTGATGATCCAGGGCGAAAGCGGCACCGGCAAAGAAATGGCGGCACAAGCCATTCACCATGAATATACCTTGTTCCGTACCCATAAACGCACAAAGCGCAGTGCGCCGTTTGTTGCGGTTAACTGCGGGGCAATTCCGGAAAGTCTGCTGGAAGCTGAATTATTTGGTTATGAAGAGGGCGCATTTACCGGCTCACGCCGGGGCGGCCGTGCCGGGCTATTTGAAGCCGCAGACGGCGGCACCTTGTTCCTCGATGAAATCGGCGAAATGCCTTTGTCACTTCAGACCCGCCTGCTGCGGGTGCTGGAAGACCGCGCAATAGTGCGTATCGGCGGATATAAACCTATTACGGTGGATGTGCGGGTTATTTGCGCTACTCACGGCGACCTTGACCGGTGGGTAACGGAAGGGCGCTTCCGCGCTGATCTTTTTTATCGTCTTGGTGTGTTGCGTCTGCAATTACCGGCACTGCGTGAGCGGGACGCCGATATTTTATTGTTAGCGGAAAAACTGCTCAAACTTGCCTTTGCTGAACTGGATTTGCCCCTGCATCGCGGGCATCTGCAACAAATTCTGGCATACAGCCCCTTTTTCTATCAGTACCGCTGGCCGGGCAATGCCCGTGAGTTGCGCAATCTGATGGAGCGGGTGGCACTGTATTGCAGTGCGTATCCTGACAAAATAATTACTGAATCATTATTAATGCAGTTATCACCGGAACGCCGTGCTGAGCGGCAACCCGCTGACATATTTCCTGTTACAGCAGAGCCTGCGATAACTGCAACGGCGGCAGAGGCCATTGTCCGTTTCCGTGGTGACCGGCAGGCGGCGGCTGACTGGCTGGGGATCAGCCGGACAACCTTGTGGCGGCGTTTAAAACAGGAGCGCGCTGCATCATGACGTTGAGTATATCCGAATTGAAAAGCAAGAGCCGGAGTGTTTGCCCGCCT